Incidental Mutation 'R7567:Nf1'
ID585535
Institutional Source Beutler Lab
Gene Symbol Nf1
Ensembl Gene ENSMUSG00000020716
Gene Nameneurofibromin 1
SynonymsNf-1, neurofibromin
MMRRC Submission
Accession Numbers

Genbank: NM_010897; MGI: 97306

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7567 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location79339693-79581612 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79547226 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 121 (T121S)
Ref Sequence ENSEMBL: ENSMUSP00000120982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071325] [ENSMUST00000108251] [ENSMUST00000137997]
Predicted Effect probably damaging
Transcript: ENSMUST00000071325
AA Change: T2137S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071289
Gene: ENSMUSG00000020716
AA Change: T2137S

DomainStartEndE-ValueType
RasGAP 1189 1559 2.56e-151 SMART
SEC14 1585 1737 2.36e-11 SMART
low complexity region 2619 2629 N/A INTRINSIC
low complexity region 2750 2763 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108251
AA Change: T2116S

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103886
Gene: ENSMUSG00000020716
AA Change: T2116S

DomainStartEndE-ValueType
RasGAP 1189 1538 1.23e-153 SMART
SEC14 1564 1716 2.36e-11 SMART
low complexity region 2598 2608 N/A INTRINSIC
low complexity region 2729 2742 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137997
AA Change: T121S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120982
Gene: ENSMUSG00000020716
AA Change: T121S

DomainStartEndE-ValueType
low complexity region 604 614 N/A INTRINSIC
low complexity region 735 748 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product appears to function as a negative regulator of the ras signal transduction pathway. Mutations in this gene have been linked to neurofibromatosis type 1, juvenile myelomonocytic leukemia and Watson syndrome. The mRNA for this gene is subject to RNA editing (CGA>UGA->Arg1306Term) resulting in premature translation termination. Alternatively spliced transcript variants encoding different isoforms have also been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous embryos die by day 14.5 with enlarged head and chest, pale liver, microphthalmia, cardiac defects and delayed organ development. Heterozygotes have elevated astrocyte number, predisposition to multiple tumor types and learning/memory deficits. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(16)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A T 17: 9,008,006 Q464H probably damaging Het
1810041L15Rik G A 15: 84,406,713 T131M probably benign Het
2210010C04Rik C A 6: 41,033,193 R69L probably benign Het
Abcc5 A T 16: 20,405,510 S108T probably damaging Het
Acss3 T C 10: 107,123,313 S91G probably benign Het
Adgrf4 T A 17: 42,667,442 I337L probably benign Het
Adgrv1 A G 13: 81,433,529 S4799P probably benign Het
Adgrv1 T C 13: 81,579,477 D348G probably damaging Het
Afdn A G 17: 13,888,808 D1546G probably benign Het
Agr2 A T 12: 35,995,947 R64S probably benign Het
Ankrd13a T A 5: 114,789,484 probably null Het
Apon T A 10: 128,255,053 M200K possibly damaging Het
Art4 T C 6: 136,854,430 S238G possibly damaging Het
Atp2a2 A T 5: 122,491,784 V74D probably benign Het
Atrnl1 T C 19: 57,699,523 S807P probably damaging Het
B020004J07Rik T C 4: 101,837,134 N184S probably benign Het
C2cd3 T C 7: 100,430,815 V936A Het
Car15 T A 16: 17,836,788 H122L probably damaging Het
Cav3 A T 6: 112,472,467 R149W probably benign Het
Ccdc8 A T 7: 16,994,762 I59F probably damaging Het
Ccng2 G A 5: 93,270,872 V119I probably benign Het
Ceacam2 A G 7: 25,527,908 I178T probably benign Het
Ces2a A G 8: 104,741,298 D520G probably benign Het
Cln8 T C 8: 14,895,057 S124P probably benign Het
Coro2a T A 4: 46,546,674 D227V probably damaging Het
Cpa4 A C 6: 30,573,890 R32S probably benign Het
Creb3l4 G T 3: 90,242,422 D45E probably benign Het
Crybb2 C T 5: 113,065,893 probably null Het
Cul7 T A 17: 46,654,595 H566Q probably benign Het
Cyp2b10 A G 7: 25,914,779 Y226C probably damaging Het
Dennd2a A T 6: 39,522,809 V274D probably benign Het
Dmbt1 G A 7: 131,061,363 probably null Het
Drc7 T C 8: 95,068,056 I363T probably benign Het
Drd3 G A 16: 43,822,684 V396I probably benign Het
Eif2ak4 A G 2: 118,450,314 N1054S probably benign Het
Epc1 A C 18: 6,450,084 V458G probably damaging Het
Exoc1 T A 5: 76,537,715 D91E probably damaging Het
Fat4 T A 3: 38,889,336 F793I probably damaging Het
Fhod1 T C 8: 105,347,837 E6G unknown Het
Galnt16 G A 12: 80,581,310 probably null Het
Ganc A T 2: 120,456,101 T804S probably benign Het
Gpam A T 19: 55,081,630 V398E possibly damaging Het
Gpr68 A G 12: 100,878,364 V307A probably benign Het
Grm7 C T 6: 111,358,761 S711L probably damaging Het
Hemgn T A 4: 46,397,034 R67S probably damaging Het
Hmg20b T C 10: 81,346,659 D281G possibly damaging Het
Ifi211 A C 1: 173,901,835 F277V probably damaging Het
Ighmbp2 T C 19: 3,272,981 I322V probably benign Het
Iqce A T 5: 140,686,075 L265H probably damaging Het
Itgal G T 7: 127,299,788 A101S probably benign Het
Kif5a C T 10: 127,237,379 M647I probably benign Het
Kirrel G T 3: 87,095,681 T135K probably damaging Het
Klf16 T C 10: 80,576,788 Y138C probably benign Het
Klhl7 A G 5: 24,126,846 T49A probably benign Het
Mr1 T C 1: 155,146,728 probably benign Het
Mrc1 A T 2: 14,325,293 I1238F probably damaging Het
Ncoa5 C T 2: 165,004,251 M225I possibly damaging Het
Ngfr T C 11: 95,574,321 T234A probably benign Het
Ninj1 T G 13: 49,193,880 F74V probably damaging Het
Npffr1 T C 10: 61,626,309 V408A probably benign Het
Nsd2 T C 5: 33,846,226 V240A probably damaging Het
Olfr103 T A 17: 37,337,171 E20D probably benign Het
Olfr1351 T A 10: 79,017,545 F74L probably benign Het
Olfr30 A G 11: 58,455,166 M261T probably damaging Het
Olfr907 G A 9: 38,499,073 V135I probably benign Het
Olfr954 T C 9: 39,461,877 S146P possibly damaging Het
Ovol1 T C 19: 5,551,586 H136R probably damaging Het
Prag1 T A 8: 36,102,606 D114E possibly damaging Het
Prss57 T A 10: 79,787,400 H71L probably benign Het
Ptgs2 T C 1: 150,102,697 F187L probably damaging Het
Ptprz1 A T 6: 22,959,780 N92I probably damaging Het
Rab23 A T 1: 33,734,731 T91S possibly damaging Het
Rag1 A G 2: 101,643,661 S379P probably damaging Het
Ribc2 G T 15: 85,143,247 D310Y probably damaging Het
Rims1 A G 1: 22,468,210 Y620H probably damaging Het
Rnf219 T C 14: 104,479,378 T520A probably damaging Het
Rock1 A C 18: 10,090,820 V938G probably benign Het
Rsph10b A G 5: 143,949,426 N314S possibly damaging Het
Sertad1 A G 7: 27,489,902 D216G possibly damaging Het
Slco6d1 T A 1: 98,497,527 V600D probably damaging Het
Snapc2 T C 8: 4,255,314 I232T probably damaging Het
Snx13 A G 12: 35,086,914 S125G probably damaging Het
Srcin1 C T 11: 97,534,725 R502H probably damaging Het
Tesmin A G 19: 3,392,218 E167G possibly damaging Het
Tex10 T C 4: 48,468,787 I129M possibly damaging Het
Tmem235 A G 11: 117,864,141 S140G probably benign Het
Trim60 T A 8: 65,001,525 D24V probably damaging Het
Ttc39c A G 18: 12,689,879 E148G probably benign Het
Vmn2r70 G T 7: 85,565,035 T303K probably benign Het
Wdr48 A T 9: 119,916,828 T426S possibly damaging Het
Wdr60 A T 12: 116,254,510 probably null Het
Xirp2 A T 2: 67,515,982 T2856S probably benign Het
Zswim8 A G 14: 20,719,933 N1356S probably damaging Het
Other mutations in Nf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Nf1 APN 11 79395905 missense probably damaging 0.99
IGL00801:Nf1 APN 11 79428700 splice site probably benign
IGL00823:Nf1 APN 11 79565517 missense probably damaging 1.00
IGL00945:Nf1 APN 11 79469803 missense probably damaging 0.99
IGL00960:Nf1 APN 11 79445121 missense probably damaging 1.00
IGL01118:Nf1 APN 11 79546986 missense probably damaging 0.99
IGL01604:Nf1 APN 11 79441709 splice site probably benign
IGL01637:Nf1 APN 11 79547120 missense probably damaging 1.00
IGL01659:Nf1 APN 11 79559449 missense probably benign
IGL01764:Nf1 APN 11 79384187 missense probably benign
IGL01772:Nf1 APN 11 79390249 missense probably damaging 1.00
IGL02047:Nf1 APN 11 79425535 missense probably benign 0.04
IGL02052:Nf1 APN 11 79412727 missense probably damaging 1.00
IGL02071:Nf1 APN 11 79444121 missense possibly damaging 0.96
IGL02312:Nf1 APN 11 79444648 missense possibly damaging 0.95
IGL02341:Nf1 APN 11 79564926 missense probably benign 0.33
IGL02390:Nf1 APN 11 79565935 missense possibly damaging 0.64
IGL02390:Nf1 APN 11 79411676 splice site probably benign
IGL02475:Nf1 APN 11 79535667 missense probably damaging 1.00
IGL02567:Nf1 APN 11 79547143 missense probably damaging 1.00
IGL02571:Nf1 APN 11 79428627 missense probably damaging 1.00
IGL02664:Nf1 APN 11 79444598 critical splice acceptor site probably null
IGL02664:Nf1 APN 11 79444599 critical splice acceptor site probably null
IGL02992:Nf1 APN 11 79434933 splice site probably benign
IGL03006:Nf1 APN 11 79545431 missense probably damaging 1.00
IGL03216:Nf1 APN 11 79564895 missense probably benign 0.17
Diesel UTSW 11 79556723 missense probably damaging 0.96
Franklin UTSW 11 79473320 splice site probably null
Gasoline UTSW 11 79556789 missense probably benign 0.17
jackson UTSW 11 79447572 missense probably damaging 1.00
Jefferson UTSW 11 79446864 missense probably damaging 1.00
Phyletic_dwarf UTSW 11 79454189 missense probably damaging 1.00
C9142:Nf1 UTSW 11 79556731 missense probably damaging 0.98
I2289:Nf1 UTSW 11 79547776 missense probably damaging 1.00
R0055:Nf1 UTSW 11 79471551 missense probably damaging 1.00
R0055:Nf1 UTSW 11 79471551 missense probably damaging 1.00
R0081:Nf1 UTSW 11 79453979 splice site probably benign
R0115:Nf1 UTSW 11 79468876 critical splice donor site probably null
R0144:Nf1 UTSW 11 79547127 missense probably damaging 1.00
R0196:Nf1 UTSW 11 79468769 missense possibly damaging 0.94
R0196:Nf1 UTSW 11 79578272 missense probably damaging 1.00
R0217:Nf1 UTSW 11 79428574 splice site probably benign
R0238:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0238:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0239:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0239:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0255:Nf1 UTSW 11 79408699 splice site probably null
R0362:Nf1 UTSW 11 79536878 missense probably damaging 1.00
R0364:Nf1 UTSW 11 79441957 nonsense probably null
R0464:Nf1 UTSW 11 79556789 missense probably benign 0.17
R0511:Nf1 UTSW 11 79438769 missense probably benign 0.01
R0549:Nf1 UTSW 11 79468771 missense probably damaging 0.99
R0585:Nf1 UTSW 11 79568701 missense probably damaging 0.99
R0636:Nf1 UTSW 11 79535703 missense probably damaging 0.99
R0924:Nf1 UTSW 11 79453866 missense probably damaging 0.98
R0942:Nf1 UTSW 11 79438711 missense probably benign 0.00
R1022:Nf1 UTSW 11 79547033 missense probably damaging 1.00
R1024:Nf1 UTSW 11 79547033 missense probably damaging 1.00
R1350:Nf1 UTSW 11 79412687 missense probably damaging 1.00
R1365:Nf1 UTSW 11 79547885 splice site probably null
R1395:Nf1 UTSW 11 79535983 missense possibly damaging 0.49
R1467:Nf1 UTSW 11 79428626 missense possibly damaging 0.88
R1467:Nf1 UTSW 11 79428626 missense possibly damaging 0.88
R1477:Nf1 UTSW 11 79395859 nonsense probably null
R1508:Nf1 UTSW 11 79440909 missense probably damaging 1.00
R1512:Nf1 UTSW 11 79390369 missense probably damaging 1.00
R1605:Nf1 UTSW 11 79440923 missense probably benign 0.01
R1680:Nf1 UTSW 11 79550998 nonsense probably null
R1704:Nf1 UTSW 11 79463301 splice site probably null
R1707:Nf1 UTSW 11 79535604 missense probably damaging 1.00
R1741:Nf1 UTSW 11 79443931 missense probably benign
R1761:Nf1 UTSW 11 79384265 missense probably damaging 1.00
R1800:Nf1 UTSW 11 79553968 missense possibly damaging 0.94
R1873:Nf1 UTSW 11 79547161 missense probably damaging 1.00
R1966:Nf1 UTSW 11 79411564 missense possibly damaging 0.72
R1967:Nf1 UTSW 11 79412745 missense probably damaging 0.96
R1970:Nf1 UTSW 11 79553961 missense probably benign 0.08
R2059:Nf1 UTSW 11 79556723 missense probably damaging 0.96
R2105:Nf1 UTSW 11 79469826 missense possibly damaging 0.50
R2151:Nf1 UTSW 11 79447570 missense possibly damaging 0.94
R2211:Nf1 UTSW 11 79444064 missense probably benign 0.39
R2497:Nf1 UTSW 11 79443884 missense probably damaging 1.00
R2899:Nf1 UTSW 11 79412758 missense possibly damaging 0.93
R3086:Nf1 UTSW 11 79546986 missense probably damaging 1.00
R3120:Nf1 UTSW 11 79564899 missense probably damaging 0.99
R3744:Nf1 UTSW 11 79548747 missense probably benign 0.23
R3801:Nf1 UTSW 11 79559521 missense probably null 0.98
R3804:Nf1 UTSW 11 79559521 missense probably null 0.98
R4212:Nf1 UTSW 11 79469798 missense probably damaging 1.00
R4298:Nf1 UTSW 11 79384244 missense probably damaging 1.00
R4578:Nf1 UTSW 11 79445759 missense probably damaging 1.00
R4579:Nf1 UTSW 11 79468757 missense probably damaging 1.00
R4587:Nf1 UTSW 11 79536037 critical splice donor site probably null
R4793:Nf1 UTSW 11 79447572 missense probably damaging 1.00
R4834:Nf1 UTSW 11 79546297 missense probably damaging 1.00
R4863:Nf1 UTSW 11 79409409 missense probably damaging 1.00
R4967:Nf1 UTSW 11 79565553 critical splice donor site probably null
R4971:Nf1 UTSW 11 79444643 missense probably damaging 1.00
R5034:Nf1 UTSW 11 79444150 missense probably damaging 0.98
R5036:Nf1 UTSW 11 79446864 missense probably damaging 1.00
R5207:Nf1 UTSW 11 79454189 missense probably damaging 1.00
R5348:Nf1 UTSW 11 79564899 missense probably damaging 1.00
R5356:Nf1 UTSW 11 79473456 missense possibly damaging 0.94
R5444:Nf1 UTSW 11 79443959 missense possibly damaging 0.94
R5533:Nf1 UTSW 11 79445789 missense probably damaging 0.99
R5918:Nf1 UTSW 11 79569222 intron probably benign
R5978:Nf1 UTSW 11 79540419 missense probably damaging 1.00
R6140:Nf1 UTSW 11 79473320 splice site probably null
R6195:Nf1 UTSW 11 79565975 missense probably damaging 0.99
R6216:Nf1 UTSW 11 79411607 missense possibly damaging 0.93
R6233:Nf1 UTSW 11 79565975 missense probably damaging 0.99
R6257:Nf1 UTSW 11 79549491 missense probably damaging 1.00
R6258:Nf1 UTSW 11 79565755 intron probably null
R6756:Nf1 UTSW 11 79444587 splice site probably null
R6878:Nf1 UTSW 11 79434882 missense probably damaging 1.00
R6959:Nf1 UTSW 11 79549468 missense probably damaging 0.98
R7007:Nf1 UTSW 11 79447023 intron probably null
R7066:Nf1 UTSW 11 79556720 missense probably damaging 1.00
R7099:Nf1 UTSW 11 79570330 missense probably benign 0.08
R7213:Nf1 UTSW 11 79469819 missense probably benign 0.23
R7326:Nf1 UTSW 11 79564943 missense probably benign
R7348:Nf1 UTSW 11 79536850 missense probably benign
R7380:Nf1 UTSW 11 79546276 missense probably damaging 1.00
R7407:Nf1 UTSW 11 79448143 missense probably damaging 1.00
R7412:Nf1 UTSW 11 79473414 missense probably damaging 1.00
R7545:Nf1 UTSW 11 79409524 missense probably benign
R7574:Nf1 UTSW 11 79408769 missense probably null 0.99
R7616:Nf1 UTSW 11 79384266 missense probably damaging 0.97
R7713:Nf1 UTSW 11 79425606 missense probably benign
R7737:Nf1 UTSW 11 79545488 missense probably benign 0.33
R7869:Nf1 UTSW 11 79418588 missense probably damaging 1.00
R7905:Nf1 UTSW 11 79547112 missense possibly damaging 0.80
R7952:Nf1 UTSW 11 79418588 missense probably damaging 1.00
R7988:Nf1 UTSW 11 79547112 missense possibly damaging 0.80
X0052:Nf1 UTSW 11 79559416 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGACGACATTGCCATTTTAG -3'
(R):5'- GCATGACAAAGAAAGCCCTTATTG -3'

Sequencing Primer
(F):5'- TAGCCCGCTACATGCTGATG -3'
(R):5'- AAGCCCTTATTGTAGCTTTCTATGG -3'
Posted On2019-10-17