Incidental Mutation 'R7567:Cul7'
ID585557
Institutional Source Beutler Lab
Gene Symbol Cul7
Ensembl Gene ENSMUSG00000038545
Gene Namecullin 7
Synonymsp185, 2510004L20Rik, C230011P08Rik, p193
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7567 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location46650337-46664364 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 46654595 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 566 (H566Q)
Ref Sequence ENSEMBL: ENSMUSP00000116133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002844] [ENSMUST00000043464] [ENSMUST00000113429] [ENSMUST00000113430] [ENSMUST00000133393] [ENSMUST00000145567]
Predicted Effect probably benign
Transcript: ENSMUST00000002844
SMART Domains Protein: ENSMUSP00000002844
Gene: ENSMUSG00000002767

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Ribosomal_L2 84 166 3.44e-29 SMART
Ribosomal_L2_C 177 298 1.32e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043464
AA Change: H566Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000049128
Gene: ENSMUSG00000038545
AA Change: H566Q

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 218 229 N/A INTRINSIC
low complexity region 315 324 N/A INTRINSIC
Pfam:Cul7 349 423 5.7e-34 PFAM
low complexity region 462 476 N/A INTRINSIC
low complexity region 603 618 N/A INTRINSIC
low complexity region 635 648 N/A INTRINSIC
APC10 811 973 9.35e-49 SMART
low complexity region 983 993 N/A INTRINSIC
low complexity region 1063 1074 N/A INTRINSIC
low complexity region 1301 1318 N/A INTRINSIC
low complexity region 1335 1370 N/A INTRINSIC
Blast:Cullin_Nedd8 1550 1633 1e-41 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000113429
SMART Domains Protein: ENSMUSP00000109056
Gene: ENSMUSG00000002767

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Ribosomal_L2 84 166 1.1e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113430
SMART Domains Protein: ENSMUSP00000109057
Gene: ENSMUSG00000002767

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Ribosomal_L2 82 164 1.6e-31 PFAM
Pfam:Ribosomal_L2_C 175 279 5.6e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132790
Predicted Effect probably benign
Transcript: ENSMUST00000133393
AA Change: H268Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119393
Gene: ENSMUSG00000038545
AA Change: H268Q

DomainStartEndE-ValueType
low complexity region 17 26 N/A INTRINSIC
Pfam:Cul7 51 126 8e-34 PFAM
low complexity region 164 178 N/A INTRINSIC
low complexity region 305 320 N/A INTRINSIC
low complexity region 337 350 N/A INTRINSIC
SCOP:d1gqpa_ 487 568 1e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144966
Predicted Effect probably benign
Transcript: ENSMUST00000145567
AA Change: H566Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000116133
Gene: ENSMUSG00000038545
AA Change: H566Q

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
SCOP:d1jdha_ 63 222 2e-4 SMART
low complexity region 315 324 N/A INTRINSIC
Pfam:Cul7 349 424 9.5e-34 PFAM
low complexity region 462 476 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146183
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of an E3 ubiquitin-protein ligase complex. The encoded protein interacts with TP53, CUL9, and FBXW8 proteins. Defects in this gene are a cause of 3M syndrome type 1 (3M1). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
PHENOTYPE: During late gestation, homozygous null fetuses display reduced growth associated with abnormal placental development and hemorrhaging due to vascular defects. Mutant mice are born but die shortly after birth, succumbing to respiratory distress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A T 17: 9,008,006 Q464H probably damaging Het
1810041L15Rik G A 15: 84,406,713 T131M probably benign Het
2210010C04Rik C A 6: 41,033,193 R69L probably benign Het
Abcc5 A T 16: 20,405,510 S108T probably damaging Het
Acss3 T C 10: 107,123,313 S91G probably benign Het
Adgrf4 T A 17: 42,667,442 I337L probably benign Het
Adgrv1 T C 13: 81,579,477 D348G probably damaging Het
Adgrv1 A G 13: 81,433,529 S4799P probably benign Het
Afdn A G 17: 13,888,808 D1546G probably benign Het
Agr2 A T 12: 35,995,947 R64S probably benign Het
Ankrd13a T A 5: 114,789,484 probably null Het
Apon T A 10: 128,255,053 M200K possibly damaging Het
Art4 T C 6: 136,854,430 S238G possibly damaging Het
Atp2a2 A T 5: 122,491,784 V74D probably benign Het
Atrnl1 T C 19: 57,699,523 S807P probably damaging Het
B020004J07Rik T C 4: 101,837,134 N184S probably benign Het
C2cd3 T C 7: 100,430,815 V936A Het
Car15 T A 16: 17,836,788 H122L probably damaging Het
Cav3 A T 6: 112,472,467 R149W probably benign Het
Ccdc8 A T 7: 16,994,762 I59F probably damaging Het
Ccng2 G A 5: 93,270,872 V119I probably benign Het
Ceacam2 A G 7: 25,527,908 I178T probably benign Het
Ces2a A G 8: 104,741,298 D520G probably benign Het
Cln8 T C 8: 14,895,057 S124P probably benign Het
Coro2a T A 4: 46,546,674 D227V probably damaging Het
Cpa4 A C 6: 30,573,890 R32S probably benign Het
Creb3l4 G T 3: 90,242,422 D45E probably benign Het
Crybb2 C T 5: 113,065,893 probably null Het
Cyp2b10 A G 7: 25,914,779 Y226C probably damaging Het
Dennd2a A T 6: 39,522,809 V274D probably benign Het
Dmbt1 G A 7: 131,061,363 probably null Het
Drc7 T C 8: 95,068,056 I363T probably benign Het
Drd3 G A 16: 43,822,684 V396I probably benign Het
Eif2ak4 A G 2: 118,450,314 N1054S probably benign Het
Epc1 A C 18: 6,450,084 V458G probably damaging Het
Exoc1 T A 5: 76,537,715 D91E probably damaging Het
Fat4 T A 3: 38,889,336 F793I probably damaging Het
Fhod1 T C 8: 105,347,837 E6G unknown Het
Galnt16 G A 12: 80,581,310 probably null Het
Ganc A T 2: 120,456,101 T804S probably benign Het
Gpam A T 19: 55,081,630 V398E possibly damaging Het
Gpr68 A G 12: 100,878,364 V307A probably benign Het
Grm7 C T 6: 111,358,761 S711L probably damaging Het
Hemgn T A 4: 46,397,034 R67S probably damaging Het
Hmg20b T C 10: 81,346,659 D281G possibly damaging Het
Ifi211 A C 1: 173,901,835 F277V probably damaging Het
Ighmbp2 T C 19: 3,272,981 I322V probably benign Het
Iqce A T 5: 140,686,075 L265H probably damaging Het
Itgal G T 7: 127,299,788 A101S probably benign Het
Kif5a C T 10: 127,237,379 M647I probably benign Het
Kirrel G T 3: 87,095,681 T135K probably damaging Het
Klf16 T C 10: 80,576,788 Y138C probably benign Het
Klhl7 A G 5: 24,126,846 T49A probably benign Het
Mr1 T C 1: 155,146,728 probably benign Het
Mrc1 A T 2: 14,325,293 I1238F probably damaging Het
Ncoa5 C T 2: 165,004,251 M225I possibly damaging Het
Nf1 A T 11: 79,547,226 T121S probably damaging Het
Ngfr T C 11: 95,574,321 T234A probably benign Het
Ninj1 T G 13: 49,193,880 F74V probably damaging Het
Npffr1 T C 10: 61,626,309 V408A probably benign Het
Nsd2 T C 5: 33,846,226 V240A probably damaging Het
Olfr103 T A 17: 37,337,171 E20D probably benign Het
Olfr1351 T A 10: 79,017,545 F74L probably benign Het
Olfr30 A G 11: 58,455,166 M261T probably damaging Het
Olfr907 G A 9: 38,499,073 V135I probably benign Het
Olfr954 T C 9: 39,461,877 S146P possibly damaging Het
Ovol1 T C 19: 5,551,586 H136R probably damaging Het
Prag1 T A 8: 36,102,606 D114E possibly damaging Het
Prss57 T A 10: 79,787,400 H71L probably benign Het
Ptgs2 T C 1: 150,102,697 F187L probably damaging Het
Ptprz1 A T 6: 22,959,780 N92I probably damaging Het
Rab23 A T 1: 33,734,731 T91S possibly damaging Het
Rag1 A G 2: 101,643,661 S379P probably damaging Het
Ribc2 G T 15: 85,143,247 D310Y probably damaging Het
Rims1 A G 1: 22,468,210 Y620H probably damaging Het
Rnf219 T C 14: 104,479,378 T520A probably damaging Het
Rock1 A C 18: 10,090,820 V938G probably benign Het
Rsph10b A G 5: 143,949,426 N314S possibly damaging Het
Sertad1 A G 7: 27,489,902 D216G possibly damaging Het
Slco6d1 T A 1: 98,497,527 V600D probably damaging Het
Snapc2 T C 8: 4,255,314 I232T probably damaging Het
Snx13 A G 12: 35,086,914 S125G probably damaging Het
Srcin1 C T 11: 97,534,725 R502H probably damaging Het
Tesmin A G 19: 3,392,218 E167G possibly damaging Het
Tex10 T C 4: 48,468,787 I129M possibly damaging Het
Tmem235 A G 11: 117,864,141 S140G probably benign Het
Trim60 T A 8: 65,001,525 D24V probably damaging Het
Ttc39c A G 18: 12,689,879 E148G probably benign Het
Vmn2r70 G T 7: 85,565,035 T303K probably benign Het
Wdr48 A T 9: 119,916,828 T426S possibly damaging Het
Wdr60 A T 12: 116,254,510 probably null Het
Xirp2 A T 2: 67,515,982 T2856S probably benign Het
Zswim8 A G 14: 20,719,933 N1356S probably damaging Het
Other mutations in Cul7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Cul7 APN 17 46652508 missense probably damaging 1.00
IGL01288:Cul7 APN 17 46657807 splice site probably benign
IGL01669:Cul7 APN 17 46658715 missense possibly damaging 0.94
P0019:Cul7 UTSW 17 46660247 splice site probably benign
PIT4453001:Cul7 UTSW 17 46651820 missense probably damaging 0.99
R0083:Cul7 UTSW 17 46655556 missense probably benign 0.00
R0121:Cul7 UTSW 17 46663373 missense probably damaging 1.00
R0157:Cul7 UTSW 17 46653835 missense possibly damaging 0.93
R0266:Cul7 UTSW 17 46654595 missense probably benign 0.00
R0358:Cul7 UTSW 17 46663744 critical splice donor site probably null
R0544:Cul7 UTSW 17 46663544 missense possibly damaging 0.94
R0565:Cul7 UTSW 17 46652003 missense probably damaging 0.98
R0677:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R0696:Cul7 UTSW 17 46659608 missense probably damaging 1.00
R0702:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R0735:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R0893:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R0900:Cul7 UTSW 17 46658337 missense probably benign 0.36
R0975:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R0976:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1014:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1016:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1104:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1162:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1378:Cul7 UTSW 17 46662126 missense probably damaging 0.99
R1479:Cul7 UTSW 17 46651747 missense probably damaging 1.00
R1498:Cul7 UTSW 17 46655710 missense probably benign 0.01
R1521:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1542:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1545:Cul7 UTSW 17 46651553 missense probably damaging 1.00
R1598:Cul7 UTSW 17 46663091 missense probably benign 0.10
R1600:Cul7 UTSW 17 46651822 nonsense probably null
R1618:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1752:Cul7 UTSW 17 46653167 missense probably benign 0.10
R1881:Cul7 UTSW 17 46651962 missense probably damaging 1.00
R1901:Cul7 UTSW 17 46655740 missense probably damaging 1.00
R1902:Cul7 UTSW 17 46655740 missense probably damaging 1.00
R1913:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R2213:Cul7 UTSW 17 46651472 missense probably damaging 0.99
R2370:Cul7 UTSW 17 46661641 missense probably damaging 1.00
R2929:Cul7 UTSW 17 46651600 missense probably benign 0.00
R2930:Cul7 UTSW 17 46651600 missense probably benign 0.00
R2990:Cul7 UTSW 17 46651600 missense probably benign 0.00
R2992:Cul7 UTSW 17 46651600 missense probably benign 0.00
R4201:Cul7 UTSW 17 46661312 missense probably damaging 1.00
R4792:Cul7 UTSW 17 46657050 nonsense probably null
R4971:Cul7 UTSW 17 46659119 missense probably benign 0.00
R5014:Cul7 UTSW 17 46655942 makesense probably null
R5384:Cul7 UTSW 17 46654477 missense probably benign 0.44
R5957:Cul7 UTSW 17 46657757 missense probably damaging 1.00
R6128:Cul7 UTSW 17 46651662 missense probably damaging 1.00
R6294:Cul7 UTSW 17 46663148 missense probably benign
R6812:Cul7 UTSW 17 46661409 missense probably benign 0.00
R7073:Cul7 UTSW 17 46658731 missense probably damaging 1.00
R7112:Cul7 UTSW 17 46651698 missense probably damaging 1.00
R7246:Cul7 UTSW 17 46662067 missense probably benign 0.04
R7361:Cul7 UTSW 17 46657007 missense probably damaging 1.00
R7682:Cul7 UTSW 17 46655595 missense probably benign
R7689:Cul7 UTSW 17 46652821 nonsense probably null
R7797:Cul7 UTSW 17 46658642 missense possibly damaging 0.65
R7897:Cul7 UTSW 17 46658005 missense probably benign
R7980:Cul7 UTSW 17 46658005 missense probably benign
Z1177:Cul7 UTSW 17 46652805 frame shift probably null
Z1177:Cul7 UTSW 17 46658738 missense probably damaging 0.99
Z1177:Cul7 UTSW 17 46659569 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCGACAGGCTGACTTTTCTTC -3'
(R):5'- ACAGCTGAGGAATGACATCTG -3'

Sequencing Primer
(F):5'- AGGCTGACTTTTCTTCCCCGTAG -3'
(R):5'- CACATGCACATCGTAAGTTTCTGGG -3'
Posted On2019-10-17