Incidental Mutation 'R7567:Tesmin'
ID585562
Institutional Source Beutler Lab
Gene Symbol Tesmin
Ensembl Gene ENSMUSG00000024905
Gene Nametestis expressed metallothionein like
SynonymsMtl5, tesmin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R7567 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location3388857-3407823 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3392218 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 167 (E167G)
Ref Sequence ENSEMBL: ENSMUSP00000025840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025840] [ENSMUST00000127142] [ENSMUST00000142193] [ENSMUST00000151341]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025840
AA Change: E167G

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025840
Gene: ENSMUSG00000024905
AA Change: E167G

DomainStartEndE-ValueType
low complexity region 91 99 N/A INTRINSIC
low complexity region 107 123 N/A INTRINSIC
Blast:CXC 246 287 4e-13 BLAST
CXC 332 373 1.37e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127142
SMART Domains Protein: ENSMUSP00000122687
Gene: ENSMUSG00000024905

DomainStartEndE-ValueType
Blast:CXC 67 107 1e-13 BLAST
CXC 152 193 1.37e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142193
SMART Domains Protein: ENSMUSP00000114171
Gene: ENSMUSG00000024905

DomainStartEndE-ValueType
Blast:CXC 67 107 1e-13 BLAST
CXC 152 193 1.37e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000151341
AA Change: E167G

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114142
Gene: ENSMUSG00000024905
AA Change: E167G

DomainStartEndE-ValueType
low complexity region 91 99 N/A INTRINSIC
low complexity region 107 123 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Metallothionein proteins are highly conserved low-molecular-weight cysteine-rich proteins that are induced by and bind to heavy metal ions and have no enzymatic activity. They may play a central role in the regulation of cell growth and differentiation and are involved in spermatogenesis. This gene encodes a metallothionein-like protein which has been shown to be expressed differentially in mouse testis and ovary. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A T 17: 9,008,006 Q464H probably damaging Het
1810041L15Rik G A 15: 84,406,713 T131M probably benign Het
2210010C04Rik C A 6: 41,033,193 R69L probably benign Het
Abcc5 A T 16: 20,405,510 S108T probably damaging Het
Acss3 T C 10: 107,123,313 S91G probably benign Het
Adgrf4 T A 17: 42,667,442 I337L probably benign Het
Adgrv1 A G 13: 81,433,529 S4799P probably benign Het
Adgrv1 T C 13: 81,579,477 D348G probably damaging Het
Afdn A G 17: 13,888,808 D1546G probably benign Het
Agr2 A T 12: 35,995,947 R64S probably benign Het
Ankrd13a T A 5: 114,789,484 probably null Het
Apon T A 10: 128,255,053 M200K possibly damaging Het
Art4 T C 6: 136,854,430 S238G possibly damaging Het
Atp2a2 A T 5: 122,491,784 V74D probably benign Het
Atrnl1 T C 19: 57,699,523 S807P probably damaging Het
B020004J07Rik T C 4: 101,837,134 N184S probably benign Het
C2cd3 T C 7: 100,430,815 V936A Het
Car15 T A 16: 17,836,788 H122L probably damaging Het
Cav3 A T 6: 112,472,467 R149W probably benign Het
Ccdc8 A T 7: 16,994,762 I59F probably damaging Het
Ccng2 G A 5: 93,270,872 V119I probably benign Het
Ceacam2 A G 7: 25,527,908 I178T probably benign Het
Ces2a A G 8: 104,741,298 D520G probably benign Het
Cln8 T C 8: 14,895,057 S124P probably benign Het
Coro2a T A 4: 46,546,674 D227V probably damaging Het
Cpa4 A C 6: 30,573,890 R32S probably benign Het
Creb3l4 G T 3: 90,242,422 D45E probably benign Het
Crybb2 C T 5: 113,065,893 probably null Het
Cul7 T A 17: 46,654,595 H566Q probably benign Het
Cyp2b10 A G 7: 25,914,779 Y226C probably damaging Het
Dennd2a A T 6: 39,522,809 V274D probably benign Het
Dmbt1 G A 7: 131,061,363 probably null Het
Drc7 T C 8: 95,068,056 I363T probably benign Het
Drd3 G A 16: 43,822,684 V396I probably benign Het
Eif2ak4 A G 2: 118,450,314 N1054S probably benign Het
Epc1 A C 18: 6,450,084 V458G probably damaging Het
Exoc1 T A 5: 76,537,715 D91E probably damaging Het
Fat4 T A 3: 38,889,336 F793I probably damaging Het
Fhod1 T C 8: 105,347,837 E6G unknown Het
Galnt16 G A 12: 80,581,310 probably null Het
Ganc A T 2: 120,456,101 T804S probably benign Het
Gpam A T 19: 55,081,630 V398E possibly damaging Het
Gpr68 A G 12: 100,878,364 V307A probably benign Het
Grm7 C T 6: 111,358,761 S711L probably damaging Het
Hemgn T A 4: 46,397,034 R67S probably damaging Het
Hmg20b T C 10: 81,346,659 D281G possibly damaging Het
Ifi211 A C 1: 173,901,835 F277V probably damaging Het
Ighmbp2 T C 19: 3,272,981 I322V probably benign Het
Iqce A T 5: 140,686,075 L265H probably damaging Het
Itgal G T 7: 127,299,788 A101S probably benign Het
Kif5a C T 10: 127,237,379 M647I probably benign Het
Kirrel G T 3: 87,095,681 T135K probably damaging Het
Klf16 T C 10: 80,576,788 Y138C probably benign Het
Klhl7 A G 5: 24,126,846 T49A probably benign Het
Mr1 T C 1: 155,146,728 probably benign Het
Mrc1 A T 2: 14,325,293 I1238F probably damaging Het
Ncoa5 C T 2: 165,004,251 M225I possibly damaging Het
Nf1 A T 11: 79,547,226 T121S probably damaging Het
Ngfr T C 11: 95,574,321 T234A probably benign Het
Ninj1 T G 13: 49,193,880 F74V probably damaging Het
Npffr1 T C 10: 61,626,309 V408A probably benign Het
Nsd2 T C 5: 33,846,226 V240A probably damaging Het
Olfr103 T A 17: 37,337,171 E20D probably benign Het
Olfr1351 T A 10: 79,017,545 F74L probably benign Het
Olfr30 A G 11: 58,455,166 M261T probably damaging Het
Olfr907 G A 9: 38,499,073 V135I probably benign Het
Olfr954 T C 9: 39,461,877 S146P possibly damaging Het
Ovol1 T C 19: 5,551,586 H136R probably damaging Het
Prag1 T A 8: 36,102,606 D114E possibly damaging Het
Prss57 T A 10: 79,787,400 H71L probably benign Het
Ptgs2 T C 1: 150,102,697 F187L probably damaging Het
Ptprz1 A T 6: 22,959,780 N92I probably damaging Het
Rab23 A T 1: 33,734,731 T91S possibly damaging Het
Rag1 A G 2: 101,643,661 S379P probably damaging Het
Ribc2 G T 15: 85,143,247 D310Y probably damaging Het
Rims1 A G 1: 22,468,210 Y620H probably damaging Het
Rnf219 T C 14: 104,479,378 T520A probably damaging Het
Rock1 A C 18: 10,090,820 V938G probably benign Het
Rsph10b A G 5: 143,949,426 N314S possibly damaging Het
Sertad1 A G 7: 27,489,902 D216G possibly damaging Het
Slco6d1 T A 1: 98,497,527 V600D probably damaging Het
Snapc2 T C 8: 4,255,314 I232T probably damaging Het
Snx13 A G 12: 35,086,914 S125G probably damaging Het
Srcin1 C T 11: 97,534,725 R502H probably damaging Het
Tex10 T C 4: 48,468,787 I129M possibly damaging Het
Tmem235 A G 11: 117,864,141 S140G probably benign Het
Trim60 T A 8: 65,001,525 D24V probably damaging Het
Ttc39c A G 18: 12,689,879 E148G probably benign Het
Vmn2r70 G T 7: 85,565,035 T303K probably benign Het
Wdr48 A T 9: 119,916,828 T426S possibly damaging Het
Wdr60 A T 12: 116,254,510 probably null Het
Xirp2 A T 2: 67,515,982 T2856S probably benign Het
Zswim8 A G 14: 20,719,933 N1356S probably damaging Het
Other mutations in Tesmin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02552:Tesmin APN 19 3402483 unclassified probably benign
R0207:Tesmin UTSW 19 3404088 missense probably benign 0.00
R2441:Tesmin UTSW 19 3402577 critical splice donor site probably null
R5139:Tesmin UTSW 19 3406934 missense probably damaging 1.00
R5272:Tesmin UTSW 19 3406992 missense probably damaging 1.00
R6077:Tesmin UTSW 19 3389260 missense possibly damaging 0.49
R7246:Tesmin UTSW 19 3406965 missense probably damaging 1.00
R7357:Tesmin UTSW 19 3397042 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACCCCAGACTTAGACGTCAG -3'
(R):5'- CCATCAGTCCAAACTCTAGGG -3'

Sequencing Primer
(F):5'- GACGTCAGTCTTCCACGTG -3'
(R):5'- TCAGTCCAAACTCTAGGGTGGAC -3'
Posted On2019-10-17