Incidental Mutation 'R0619:Olfr170'
ID58558
Institutional Source Beutler Lab
Gene Symbol Olfr170
Ensembl Gene ENSMUSG00000062245
Gene Nameolfactory receptor 170
SynonymsGA_x54KRFPKG5P-16052703-16051765, MOR273-2
MMRRC Submission 038808-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R0619 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location19605696-19611882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 19606272 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 132 (Y132F)
Ref Sequence ENSEMBL: ENSMUSP00000151806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078603] [ENSMUST00000206562] [ENSMUST00000218837]
Predicted Effect probably damaging
Transcript: ENSMUST00000078603
AA Change: Y131F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077674
Gene: ENSMUSG00000062245
AA Change: Y131F

DomainStartEndE-ValueType
Pfam:7tm_4 29 308 1.5e-43 PFAM
Pfam:7tm_1 41 290 2.4e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000206562
AA Change: Y131F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000218837
AA Change: Y132F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 G A 8: 119,613,000 D74N probably benign Het
Adgre4 T A 17: 55,820,679 V573D possibly damaging Het
Ak7 A G 12: 105,733,511 K230E probably damaging Het
Amdhd2 T C 17: 24,156,588 D375G possibly damaging Het
Anpep T C 7: 79,841,009 E253G probably benign Het
Bbs7 A G 3: 36,607,576 L158S probably benign Het
BC037034 A G 5: 138,263,826 probably benign Het
Bdp1 T C 13: 100,037,858 T2057A probably benign Het
C2 G T 17: 34,872,503 H61Q probably damaging Het
Ccdc18 A G 5: 108,180,416 K661E probably benign Het
Cdh23 C T 10: 60,433,777 V655I probably damaging Het
Cep78 T C 19: 15,978,862 T238A probably damaging Het
Ces2a T A 8: 104,736,110 N110K probably benign Het
Crat T C 2: 30,409,984 D128G probably benign Het
Dclre1a A T 19: 56,545,409 M233K probably benign Het
Dsg4 T C 18: 20,461,359 V515A probably benign Het
Fer1l6 T C 15: 58,662,935 probably null Het
Fryl T C 5: 73,068,731 D1863G probably benign Het
Fsip2 T A 2: 82,944,140 L57Q probably damaging Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
Iqsec1 T C 6: 90,670,406 probably null Het
Kcnn3 A C 3: 89,652,030 T536P probably damaging Het
Kctd3 T C 1: 188,978,643 D441G probably damaging Het
Kifc3 G A 8: 95,102,665 T528M probably benign Het
Kmt2c G A 5: 25,298,916 T3798I probably benign Het
Map1a T A 2: 121,305,255 M1946K probably damaging Het
Mfhas1 T A 8: 35,590,675 V768E probably benign Het
Mroh8 C A 2: 157,265,081 V223F possibly damaging Het
Mss51 A T 14: 20,487,573 V30E probably benign Het
Mtmr10 G A 7: 64,321,213 R392H probably benign Het
Mup3 T C 4: 62,085,961 N105S probably benign Het
Myh7b T C 2: 155,611,722 M22T probably benign Het
Olfr1034 T A 2: 86,047,311 Y276* probably null Het
Olfr97 T A 17: 37,232,155 I72F possibly damaging Het
Os9 A G 10: 127,120,991 I43T probably damaging Het
Pkhd1l1 T C 15: 44,483,838 L200P probably damaging Het
Ptpru C T 4: 131,820,887 V100M possibly damaging Het
Rnf6 G A 5: 146,210,721 R496C possibly damaging Het
Rsad1 C T 11: 94,542,639 R407Q probably damaging Het
Rspo3 T C 10: 29,504,637 D127G probably damaging Het
Sbf2 T A 7: 110,310,262 T1760S possibly damaging Het
Sh2d3c T A 2: 32,753,025 V588E probably damaging Het
Siglech A T 7: 55,769,162 T238S probably benign Het
Slc15a2 T A 16: 36,759,307 N328I probably damaging Het
Slc16a11 G T 11: 70,215,032 G94C probably damaging Het
Stub1 T C 17: 25,831,322 probably null Het
Tacc2 T A 7: 130,716,753 V40D probably damaging Het
Tagln3 C A 16: 45,724,272 R12L probably damaging Het
Tsen54 A G 11: 115,815,064 E69G probably damaging Het
Tsks A G 7: 44,950,834 E150G probably damaging Het
Ubap2l A C 3: 90,017,220 V680G probably benign Het
Usp16 A T 16: 87,472,164 H315L probably benign Het
Vav2 A G 2: 27,296,121 probably null Het
Zfc3h1 T C 10: 115,420,810 F1562L possibly damaging Het
Zfp764 C A 7: 127,406,541 V22L probably benign Het
Other mutations in Olfr170
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01671:Olfr170 APN 16 19605921 missense probably benign 0.00
IGL02002:Olfr170 APN 16 19606550 missense possibly damaging 0.91
IGL02537:Olfr170 APN 16 19605799 missense probably damaging 1.00
IGL02881:Olfr170 APN 16 19606300 missense probably damaging 1.00
IGL03189:Olfr170 APN 16 19606591 missense probably benign
R0012:Olfr170 UTSW 16 19606440 missense probably benign 0.30
R0764:Olfr170 UTSW 16 19606432 missense probably damaging 1.00
R1387:Olfr170 UTSW 16 19606027 missense probably damaging 1.00
R1430:Olfr170 UTSW 16 19606002 missense probably damaging 1.00
R1503:Olfr170 UTSW 16 19606312 missense probably benign 0.19
R1878:Olfr170 UTSW 16 19605751 missense probably benign
R1989:Olfr170 UTSW 16 19606657 missense probably benign 0.00
R2012:Olfr170 UTSW 16 19606131 missense probably benign 0.22
R3890:Olfr170 UTSW 16 19606455 missense probably damaging 1.00
R3891:Olfr170 UTSW 16 19606455 missense probably damaging 1.00
R5591:Olfr170 UTSW 16 19605858 missense probably damaging 1.00
R6158:Olfr170 UTSW 16 19605925 missense probably damaging 1.00
R6297:Olfr170 UTSW 16 19605930 missense possibly damaging 0.81
R6512:Olfr170 UTSW 16 19606359 missense probably damaging 1.00
R6962:Olfr170 UTSW 16 19605922 missense probably benign 0.00
R7252:Olfr170 UTSW 16 19606499 missense probably damaging 0.99
R7605:Olfr170 UTSW 16 19606272 missense probably damaging 1.00
R7687:Olfr170 UTSW 16 19605735 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTTCAACATGGCAGGGACTTCAC -3'
(R):5'- TCCACAGGGATTCTCGACTCCATAC -3'

Sequencing Primer
(F):5'- CTTCACAGAAAAAGTGATCAATGGC -3'
(R):5'- GATTCTCGACTCCATACCCCAATG -3'
Posted On2013-07-11