Mutagenetix > Incidental Mutations

Incidental Mutation 'R0619:Olfr170'

58558

Institutional Source

Beutler Lab

Gene Symbol

Olfr170

Ensembl Gene

ENSMUSG00000062245

Gene Name

olfactory receptor 170

Synonyms

GA_x54KRFPKG5P-16052703-16051765, MOR273-2

MMRRC Submission

038808-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.080) question?

Stock #

R0619 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

19605696-19611882 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 19606272 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 132 (Y132F)

Ref Sequence

ENSEMBL: ENSMUSP00000151806 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078603] [ENSMUST00000206562] [ENSMUST00000218837]

Predicted Effect

probably damaging
Transcript: ENSMUST00000078603
AA Change: Y131F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000077674
Gene: ENSMUSG00000062245
AA Change: Y131F

Domain	Start	End	E-Value	Type
Pfam:7tm_4	29	308	1.5e-43	PFAM
Pfam:7tm_1	41	290	2.4e-25	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000206562
AA Change: Y131F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000218837
AA Change: Y132F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.4%
3x: 99.0%
10x: 97.8%
20x: 96.1%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adad2	G	A	8: 119,613,000	D74N	probably benign	Het
Adgre4	T	A	17: 55,820,679	V573D	possibly damaging	Het
Ak7	A	G	12: 105,733,511	K230E	probably damaging	Het
Amdhd2	T	C	17: 24,156,588	D375G	possibly damaging	Het
Anpep	T	C	7: 79,841,009	E253G	probably benign	Het
Bbs7	A	G	3: 36,607,576	L158S	probably benign	Het
BC037034	A	G	5: 138,263,826		probably benign	Het
Bdp1	T	C	13: 100,037,858	T2057A	probably benign	Het
C2	G	T	17: 34,872,503	H61Q	probably damaging	Het
Ccdc18	A	G	5: 108,180,416	K661E	probably benign	Het
Cdh23	C	T	10: 60,433,777	V655I	probably damaging	Het
Cep78	T	C	19: 15,978,862	T238A	probably damaging	Het
Ces2a	T	A	8: 104,736,110	N110K	probably benign	Het
Crat	T	C	2: 30,409,984	D128G	probably benign	Het
Dclre1a	A	T	19: 56,545,409	M233K	probably benign	Het
Dsg4	T	C	18: 20,461,359	V515A	probably benign	Het
Fer1l6	T	C	15: 58,662,935		probably null	Het
Fryl	T	C	5: 73,068,731	D1863G	probably benign	Het
Fsip2	T	A	2: 82,944,140	L57Q	probably damaging	Het
Gnb4	C	T	3: 32,591,207	V112I	probably benign	Het
Iqsec1	T	C	6: 90,670,406		probably null	Het
Kcnn3	A	C	3: 89,652,030	T536P	probably damaging	Het
Kctd3	T	C	1: 188,978,643	D441G	probably damaging	Het
Kifc3	G	A	8: 95,102,665	T528M	probably benign	Het
Kmt2c	G	A	5: 25,298,916	T3798I	probably benign	Het
Map1a	T	A	2: 121,305,255	M1946K	probably damaging	Het
Mfhas1	T	A	8: 35,590,675	V768E	probably benign	Het
Mroh8	C	A	2: 157,265,081	V223F	possibly damaging	Het
Mss51	A	T	14: 20,487,573	V30E	probably benign	Het
Mtmr10	G	A	7: 64,321,213	R392H	probably benign	Het
Mup3	T	C	4: 62,085,961	N105S	probably benign	Het
Myh7b	T	C	2: 155,611,722	M22T	probably benign	Het
Olfr1034	T	A	2: 86,047,311	Y276*	probably null	Het
Olfr97	T	A	17: 37,232,155	I72F	possibly damaging	Het
Os9	A	G	10: 127,120,991	I43T	probably damaging	Het
Pkhd1l1	T	C	15: 44,483,838	L200P	probably damaging	Het
Ptpru	C	T	4: 131,820,887	V100M	possibly damaging	Het
Rnf6	G	A	5: 146,210,721	R496C	possibly damaging	Het
Rsad1	C	T	11: 94,542,639	R407Q	probably damaging	Het
Rspo3	T	C	10: 29,504,637	D127G	probably damaging	Het
Sbf2	T	A	7: 110,310,262	T1760S	possibly damaging	Het
Sh2d3c	T	A	2: 32,753,025	V588E	probably damaging	Het
Siglech	A	T	7: 55,769,162	T238S	probably benign	Het
Slc15a2	T	A	16: 36,759,307	N328I	probably damaging	Het
Slc16a11	G	T	11: 70,215,032	G94C	probably damaging	Het
Stub1	T	C	17: 25,831,322		probably null	Het
Tacc2	T	A	7: 130,716,753	V40D	probably damaging	Het
Tagln3	C	A	16: 45,724,272	R12L	probably damaging	Het
Tsen54	A	G	11: 115,815,064	E69G	probably damaging	Het
Tsks	A	G	7: 44,950,834	E150G	probably damaging	Het
Ubap2l	A	C	3: 90,017,220	V680G	probably benign	Het
Usp16	A	T	16: 87,472,164	H315L	probably benign	Het
Vav2	A	G	2: 27,296,121		probably null	Het
Zfc3h1	T	C	10: 115,420,810	F1562L	possibly damaging	Het
Zfp764	C	A	7: 127,406,541	V22L	probably benign	Het

Other mutations in Olfr170

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01671:Olfr170	APN	16	19605921	missense	probably benign	0.00
IGL02002:Olfr170	APN	16	19606550	missense	possibly damaging	0.91
IGL02537:Olfr170	APN	16	19605799	missense	probably damaging	1.00
IGL02881:Olfr170	APN	16	19606300	missense	probably damaging	1.00
IGL03189:Olfr170	APN	16	19606591	missense	probably benign
R0012:Olfr170	UTSW	16	19606440	missense	probably benign	0.30
R0764:Olfr170	UTSW	16	19606432	missense	probably damaging	1.00
R1387:Olfr170	UTSW	16	19606027	missense	probably damaging	1.00
R1430:Olfr170	UTSW	16	19606002	missense	probably damaging	1.00
R1503:Olfr170	UTSW	16	19606312	missense	probably benign	0.19
R1878:Olfr170	UTSW	16	19605751	missense	probably benign
R1989:Olfr170	UTSW	16	19606657	missense	probably benign	0.00
R2012:Olfr170	UTSW	16	19606131	missense	probably benign	0.22
R3890:Olfr170	UTSW	16	19606455	missense	probably damaging	1.00
R3891:Olfr170	UTSW	16	19606455	missense	probably damaging	1.00
R5591:Olfr170	UTSW	16	19605858	missense	probably damaging	1.00
R6158:Olfr170	UTSW	16	19605925	missense	probably damaging	1.00
R6297:Olfr170	UTSW	16	19605930	missense	possibly damaging	0.81
R6512:Olfr170	UTSW	16	19606359	missense	probably damaging	1.00
R6962:Olfr170	UTSW	16	19605922	missense	probably benign	0.00
R7252:Olfr170	UTSW	16	19606499	missense	probably damaging	0.99
R7605:Olfr170	UTSW	16	19606272	missense	probably damaging	1.00
R7687:Olfr170	UTSW	16	19605735	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACTTCAACATGGCAGGGACTTCAC -3'
(R):5'- TCCACAGGGATTCTCGACTCCATAC -3'

Sequencing Primer
(F):5'- CTTCACAGAAAAAGTGATCAATGGC -3'
(R):5'- GATTCTCGACTCCATACCCCAATG -3'

Posted On

2013-07-11