Incidental Mutation 'R7568:Fbxw16'
ID 585586
Institutional Source Beutler Lab
Gene Symbol Fbxw16
Ensembl Gene ENSMUSG00000074062
Gene Name F-box and WD-40 domain protein 16
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock # R7568 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 109432316-109449140 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 109439589 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Histidine at position 244 (Q244H)
Ref Sequence ENSEMBL: ENSMUSP00000082051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084984]
AlphaFold Q497Z0
Predicted Effect possibly damaging
Transcript: ENSMUST00000084984
AA Change: Q244H

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000082051
Gene: ENSMUSG00000074062
AA Change: Q244H

DomainStartEndE-ValueType
FBOX 5 45 2.72e-6 SMART
SCOP:d1e1aa_ 128 249 3e-5 SMART
Blast:WD40 137 176 1e-7 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik T C 16: 38,828,447 E100G possibly damaging Het
Actbl2 T A 13: 111,255,422 V97E possibly damaging Het
Actl7a A T 4: 56,744,498 T342S probably damaging Het
Alcam A G 16: 52,268,386 S554P probably damaging Het
Ano3 T C 2: 110,950,293 probably benign Het
Atad2b T A 12: 5,010,390 probably null Het
Baz2a T C 10: 128,125,270 S1621P possibly damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 GTCACTGGTTCTGTGGTCACTGGTTCTGTG GTCACTGGTTCTGTGATCACTGGTTCTGTGGTCACTGGTTCTGTG 3: 95,888,151 probably benign Het
BC028528 GGTTCTGTGGTCACT GGTTCTGTGGTCACTAGTTCTGTGGTCACT 3: 95,888,172 probably benign Het
Best1 T A 19: 9,989,275 probably null Het
Catip G T 1: 74,368,930 E474* probably null Het
Comp A G 8: 70,373,859 D28G probably benign Het
Crebbp G A 16: 4,126,489 R600W probably benign Het
Cyfip1 A G 7: 55,872,249 probably null Het
Ddr1 A G 17: 35,684,282 S675P probably damaging Het
Dhtkd1 A T 2: 5,922,087 probably null Het
F2rl1 G A 13: 95,514,014 A120V probably damaging Het
Fam136a A G 6: 86,365,802 N24D probably benign Het
Fbxw10 C A 11: 62,875,168 Q755K probably benign Het
Gabrg2 T C 11: 41,916,292 K373E probably benign Het
Herc3 G A 6: 58,843,810 V60I probably benign Het
Igkv19-93 T A 6: 68,736,493 K51* probably null Het
Krt23 T A 11: 99,492,800 K89* probably null Het
Mavs A G 2: 131,245,475 T298A probably benign Het
Mlec T C 5: 115,150,122 Y198C probably damaging Het
Ncam2 C A 16: 81,589,801 N689K probably benign Het
Nfkbia A G 12: 55,491,761 I82T probably damaging Het
Olfr104-ps A G 17: 37,362,605 I163V probably benign Het
Olfr1351 A T 10: 79,017,507 I62F probably benign Het
Olfr527 A G 7: 140,335,982 N40S probably damaging Het
Olfr902 A G 9: 38,449,646 Y258C probably damaging Het
Pom121l2 A T 13: 21,982,626 I356F probably benign Het
Ppip5k1 A T 2: 121,337,615 L719Q probably damaging Het
Satb1 A T 17: 51,782,724 V365D possibly damaging Het
Scrn2 T C 11: 97,030,886 Y61H probably damaging Het
Siglec1 C T 2: 131,072,682 V1505M probably damaging Het
Slc2a10 A G 2: 165,514,882 N154S probably damaging Het
Slc39a10 A T 1: 46,835,130 H337Q probably benign Het
Slc39a12 T A 2: 14,400,128 probably null Het
Slc6a6 T G 6: 91,724,851 L80R probably damaging Het
Slit1 T C 19: 41,601,635 Y1404C probably damaging Het
Sowahc A G 10: 59,223,299 E419G probably damaging Het
Ssh1 T C 5: 113,957,380 probably null Het
Stab1 C A 14: 31,152,595 C952F probably damaging Het
Stat5a T C 11: 100,875,024 M312T possibly damaging Het
Tex2 A G 11: 106,548,736 I606T unknown Het
Vmn1r19 A G 6: 57,404,828 H122R possibly damaging Het
Zfp959 A G 17: 55,897,886 I308V probably benign Het
Other mutations in Fbxw16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02139:Fbxw16 APN 9 109436686 missense probably benign 0.34
IGL02801:Fbxw16 APN 9 109441076 missense possibly damaging 0.73
milky_way UTSW 9 109441250 missense probably damaging 1.00
R0041:Fbxw16 UTSW 9 109448164 missense probably damaging 1.00
R0245:Fbxw16 UTSW 9 109436168 missense possibly damaging 0.93
R0389:Fbxw16 UTSW 9 109432482 missense probably benign 0.03
R0652:Fbxw16 UTSW 9 109436168 missense possibly damaging 0.93
R1693:Fbxw16 UTSW 9 109436259 missense possibly damaging 0.74
R1772:Fbxw16 UTSW 9 109439582 missense possibly damaging 0.91
R1965:Fbxw16 UTSW 9 109441221 missense probably damaging 1.00
R2190:Fbxw16 UTSW 9 109436671 missense probably damaging 1.00
R2334:Fbxw16 UTSW 9 109438361 missense probably benign 0.16
R3800:Fbxw16 UTSW 9 109436597 missense probably damaging 0.99
R3976:Fbxw16 UTSW 9 109439629 missense probably benign 0.42
R4298:Fbxw16 UTSW 9 109446557 missense probably benign 0.00
R4914:Fbxw16 UTSW 9 109438177 missense probably benign 0.01
R4948:Fbxw16 UTSW 9 109438347 missense probably damaging 1.00
R4995:Fbxw16 UTSW 9 109441250 missense probably damaging 1.00
R5057:Fbxw16 UTSW 9 109441164 missense probably damaging 1.00
R5077:Fbxw16 UTSW 9 109441049 critical splice donor site probably null
R5111:Fbxw16 UTSW 9 109436728 missense probably benign 0.11
R5294:Fbxw16 UTSW 9 109436644 missense probably benign 0.34
R5901:Fbxw16 UTSW 9 109441217 missense probably benign 0.06
R6295:Fbxw16 UTSW 9 109448769 intron probably benign
R6303:Fbxw16 UTSW 9 109449101 missense probably benign 0.00
R6664:Fbxw16 UTSW 9 109438258 missense probably benign 0.27
R6670:Fbxw16 UTSW 9 109438212 missense probably damaging 1.00
R6890:Fbxw16 UTSW 9 109436742 missense probably benign 0.14
R7056:Fbxw16 UTSW 9 109436284 missense possibly damaging 0.50
R7073:Fbxw16 UTSW 9 109441055 missense probably damaging 1.00
R7344:Fbxw16 UTSW 9 109449035 missense probably benign 0.00
R7396:Fbxw16 UTSW 9 109449023 missense probably damaging 1.00
R7464:Fbxw16 UTSW 9 109439551 missense possibly damaging 0.50
R7735:Fbxw16 UTSW 9 109441067 missense probably damaging 1.00
R7808:Fbxw16 UTSW 9 109448154 missense probably damaging 0.96
R7998:Fbxw16 UTSW 9 109436698 missense probably damaging 1.00
R9019:Fbxw16 UTSW 9 109441067 missense probably damaging 1.00
R9111:Fbxw16 UTSW 9 109436611 missense probably damaging 1.00
R9216:Fbxw16 UTSW 9 109447819 missense probably damaging 1.00
R9758:Fbxw16 UTSW 9 109449101 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACATTTGCCATTGTGACTGGTC -3'
(R):5'- CAGTGCAGATAAAACTCCTTCCTC -3'

Sequencing Primer
(F):5'- TGACTGGTCACGTGACTGCTC -3'
(R):5'- TGCAGATAAAACTCCTTCCTCCATAC -3'
Posted On 2019-10-17