Incidental Mutation 'R7568:Olfr1351'
ID 585588
Institutional Source Beutler Lab
Gene Symbol Olfr1351
Ensembl Gene ENSMUSG00000063216
Gene Name olfactory receptor 1351
Synonyms MOR139-4, GA_x6K02T2QGN0-2794907-2793948
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock # R7568 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 79012472-79019645 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 79017507 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 62 (I62F)
Ref Sequence ENSEMBL: ENSMUSP00000149241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080730] [ENSMUST00000216030]
AlphaFold Q8VGU6
Predicted Effect probably benign
Transcript: ENSMUST00000080730
AA Change: I62F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079555
Gene: ENSMUSG00000063216
AA Change: I62F

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
Pfam:7tm_4 32 308 2e-49 PFAM
Pfam:7tm_1 42 291 1.9e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216030
AA Change: I62F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik T C 16: 38,828,447 E100G possibly damaging Het
Actbl2 T A 13: 111,255,422 V97E possibly damaging Het
Actl7a A T 4: 56,744,498 T342S probably damaging Het
Alcam A G 16: 52,268,386 S554P probably damaging Het
Ano3 T C 2: 110,950,293 probably benign Het
Atad2b T A 12: 5,010,390 probably null Het
Baz2a T C 10: 128,125,270 S1621P possibly damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 GTCACTGGTTCTGTGGTCACTGGTTCTGTG GTCACTGGTTCTGTGATCACTGGTTCTGTGGTCACTGGTTCTGTG 3: 95,888,151 probably benign Het
BC028528 GGTTCTGTGGTCACT GGTTCTGTGGTCACTAGTTCTGTGGTCACT 3: 95,888,172 probably benign Het
Best1 T A 19: 9,989,275 probably null Het
Catip G T 1: 74,368,930 E474* probably null Het
Comp A G 8: 70,373,859 D28G probably benign Het
Crebbp G A 16: 4,126,489 R600W probably benign Het
Cyfip1 A G 7: 55,872,249 probably null Het
Ddr1 A G 17: 35,684,282 S675P probably damaging Het
Dhtkd1 A T 2: 5,922,087 probably null Het
F2rl1 G A 13: 95,514,014 A120V probably damaging Het
Fam136a A G 6: 86,365,802 N24D probably benign Het
Fbxw10 C A 11: 62,875,168 Q755K probably benign Het
Fbxw16 C A 9: 109,439,589 Q244H possibly damaging Het
Gabrg2 T C 11: 41,916,292 K373E probably benign Het
Herc3 G A 6: 58,843,810 V60I probably benign Het
Igkv19-93 T A 6: 68,736,493 K51* probably null Het
Krt23 T A 11: 99,492,800 K89* probably null Het
Mavs A G 2: 131,245,475 T298A probably benign Het
Mlec T C 5: 115,150,122 Y198C probably damaging Het
Ncam2 C A 16: 81,589,801 N689K probably benign Het
Nfkbia A G 12: 55,491,761 I82T probably damaging Het
Olfr104-ps A G 17: 37,362,605 I163V probably benign Het
Olfr527 A G 7: 140,335,982 N40S probably damaging Het
Olfr902 A G 9: 38,449,646 Y258C probably damaging Het
Pom121l2 A T 13: 21,982,626 I356F probably benign Het
Ppip5k1 A T 2: 121,337,615 L719Q probably damaging Het
Satb1 A T 17: 51,782,724 V365D possibly damaging Het
Scrn2 T C 11: 97,030,886 Y61H probably damaging Het
Siglec1 C T 2: 131,072,682 V1505M probably damaging Het
Slc2a10 A G 2: 165,514,882 N154S probably damaging Het
Slc39a10 A T 1: 46,835,130 H337Q probably benign Het
Slc39a12 T A 2: 14,400,128 probably null Het
Slc6a6 T G 6: 91,724,851 L80R probably damaging Het
Slit1 T C 19: 41,601,635 Y1404C probably damaging Het
Sowahc A G 10: 59,223,299 E419G probably damaging Het
Ssh1 T C 5: 113,957,380 probably null Het
Stab1 C A 14: 31,152,595 C952F probably damaging Het
Stat5a T C 11: 100,875,024 M312T possibly damaging Het
Tex2 A G 11: 106,548,736 I606T unknown Het
Vmn1r19 A G 6: 57,404,828 H122R possibly damaging Het
Zfp959 A G 17: 55,897,886 I308V probably benign Het
Other mutations in Olfr1351
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Olfr1351 APN 10 79018251 missense probably benign 0.00
IGL01833:Olfr1351 APN 10 79017936 missense probably benign
IGL02141:Olfr1351 APN 10 79017721 missense probably damaging 1.00
IGL02178:Olfr1351 APN 10 79017720 missense possibly damaging 0.59
R1070:Olfr1351 UTSW 10 79017850 missense probably damaging 0.99
R1631:Olfr1351 UTSW 10 79017405 missense probably benign 0.00
R1646:Olfr1351 UTSW 10 79017506 nonsense probably null
R1781:Olfr1351 UTSW 10 79017325 start codon destroyed probably null 0.89
R2358:Olfr1351 UTSW 10 79018188 missense probably damaging 1.00
R3161:Olfr1351 UTSW 10 79017604 missense probably benign
R3162:Olfr1351 UTSW 10 79017604 missense probably benign
R3162:Olfr1351 UTSW 10 79017604 missense probably benign
R5874:Olfr1351 UTSW 10 79017357 missense possibly damaging 0.95
R6382:Olfr1351 UTSW 10 79017517 missense probably damaging 1.00
R7108:Olfr1351 UTSW 10 79017649 nonsense probably null
R7567:Olfr1351 UTSW 10 79017545 missense probably benign 0.04
R7915:Olfr1351 UTSW 10 79017430 missense probably damaging 1.00
R7936:Olfr1351 UTSW 10 79018038 missense probably damaging 1.00
R9687:Olfr1351 UTSW 10 79018009 missense probably damaging 1.00
Z1176:Olfr1351 UTSW 10 79018205 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCCCTTCAAATTGAGCCC -3'
(R):5'- ACAGTCAGCAGAAAGATGTCC -3'

Sequencing Primer
(F):5'- TTTCCATAGGCGTGTCAAACAC -3'
(R):5'- GTCAGCAGAAAGATGTCCAGTACC -3'
Posted On 2019-10-17