Incidental Mutation 'R7568:F2rl1'
ID585599
Institutional Source Beutler Lab
Gene Symbol F2rl1
Ensembl Gene ENSMUSG00000021678
Gene Namecoagulation factor II (thrombin) receptor-like 1
Synonymsproteinase-activated receptor-2, PAR-2, Par2, Gpcr11, Protease-activated receptor-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7568 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location95511732-95525227 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 95514014 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 120 (A120V)
Ref Sequence ENSEMBL: ENSMUSP00000022185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022185]
Predicted Effect probably damaging
Transcript: ENSMUST00000022185
AA Change: A120V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022185
Gene: ENSMUSG00000021678
AA Change: A120V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:7TM_GPCR_Srv 75 363 3.8e-12 PFAM
Pfam:7TM_GPCR_Srw 82 364 1.2e-10 PFAM
Pfam:7tm_1 94 346 1.5e-42 PFAM
low complexity region 375 398 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein coupled receptor 1 family of proteins. The encoded cell surface receptor is activated through proteolytic cleavage of its extracellular amino terminus, resulting in a new amino terminus that acts as a tethered ligand that binds to an extracellular loop domain. Activation of the receptor has been shown to stimulate vascular smooth muscle relaxation, dilate blood vessels, increase blood flow, and lower blood pressure. This protein is also important in the inflammatory response, as well as innate and adaptive immunity. [provided by RefSeq, Jun 2016]
PHENOTYPE: Nullizygous mice may exhibit impaired leukocyte rolling and dendritic cell maturation, altered inflammatory response in various models of acute and chronic inflammatory disease, altered susceptibility to injury and to autoimmune disorders, and abnormal hemodynamic responses and pain thresholds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik T C 16: 38,828,447 E100G possibly damaging Het
Actbl2 T A 13: 111,255,422 V97E possibly damaging Het
Actl7a A T 4: 56,744,498 T342S probably damaging Het
Alcam A G 16: 52,268,386 S554P probably damaging Het
Ano3 T C 2: 110,950,293 probably benign Het
Atad2b T A 12: 5,010,390 probably null Het
Baz2a T C 10: 128,125,270 S1621P possibly damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 GTCACTGGTTCTGTGGTCACTGGTTCTGTG GTCACTGGTTCTGTGATCACTGGTTCTGTGGTCACTGGTTCTGTG 3: 95,888,151 probably benign Het
BC028528 GGTTCTGTGGTCACT GGTTCTGTGGTCACTAGTTCTGTGGTCACT 3: 95,888,172 probably benign Het
Best1 T A 19: 9,989,275 probably null Het
Catip G T 1: 74,368,930 E474* probably null Het
Comp A G 8: 70,373,859 D28G probably benign Het
Crebbp G A 16: 4,126,489 R600W probably benign Het
Cyfip1 A G 7: 55,872,249 probably null Het
Ddr1 A G 17: 35,684,282 S675P probably damaging Het
Dhtkd1 A T 2: 5,922,087 probably null Het
Fam136a A G 6: 86,365,802 N24D probably benign Het
Fbxw10 C A 11: 62,875,168 Q755K probably benign Het
Fbxw16 C A 9: 109,439,589 Q244H possibly damaging Het
Gabrg2 T C 11: 41,916,292 K373E probably benign Het
Herc3 G A 6: 58,843,810 V60I probably benign Het
Igkv19-93 T A 6: 68,736,493 K51* probably null Het
Krt23 T A 11: 99,492,800 K89* probably null Het
Mavs A G 2: 131,245,475 T298A probably benign Het
Mlec T C 5: 115,150,122 Y198C probably damaging Het
Ncam2 C A 16: 81,589,801 N689K probably benign Het
Nfkbia A G 12: 55,491,761 I82T probably damaging Het
Olfr104-ps A G 17: 37,362,605 I163V probably benign Het
Olfr1351 A T 10: 79,017,507 I62F probably benign Het
Olfr527 A G 7: 140,335,982 N40S probably damaging Het
Olfr902 A G 9: 38,449,646 Y258C probably damaging Het
Pom121l2 A T 13: 21,982,626 I356F probably benign Het
Ppip5k1 A T 2: 121,337,615 L719Q probably damaging Het
Satb1 A T 17: 51,782,724 V365D possibly damaging Het
Scrn2 T C 11: 97,030,886 Y61H probably damaging Het
Siglec1 C T 2: 131,072,682 V1505M probably damaging Het
Slc2a10 A G 2: 165,514,882 N154S probably damaging Het
Slc39a10 A T 1: 46,835,130 H337Q probably benign Het
Slc39a12 T A 2: 14,400,128 probably null Het
Slc6a6 T G 6: 91,724,851 L80R probably damaging Het
Slit1 T C 19: 41,601,635 Y1404C probably damaging Het
Sowahc A G 10: 59,223,299 E419G probably damaging Het
Ssh1 T C 5: 113,957,380 probably null Het
Stab1 C A 14: 31,152,595 C952F probably damaging Het
Stat5a T C 11: 100,875,024 M312T possibly damaging Het
Tex2 A G 11: 106,548,736 I606T unknown Het
Vmn1r19 A G 6: 57,404,828 H122R possibly damaging Het
Zfp959 A G 17: 55,897,886 I308V probably benign Het
Other mutations in F2rl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01745:F2rl1 APN 13 95513753 missense probably benign 0.03
IGL01996:F2rl1 APN 13 95513924 missense probably damaging 1.00
IGL02987:F2rl1 APN 13 95514233 missense probably benign 0.00
IGL03053:F2rl1 APN 13 95513618 missense probably benign 0.03
IGL03290:F2rl1 APN 13 95513589 missense possibly damaging 0.89
PIT4382001:F2rl1 UTSW 13 95513646 missense probably benign 0.00
R2005:F2rl1 UTSW 13 95513274 missense probably damaging 1.00
R3794:F2rl1 UTSW 13 95513211 missense unknown
R4236:F2rl1 UTSW 13 95513288 missense probably damaging 1.00
R4715:F2rl1 UTSW 13 95513267 missense probably damaging 0.99
R4741:F2rl1 UTSW 13 95514143 missense probably damaging 1.00
R4799:F2rl1 UTSW 13 95513969 missense possibly damaging 0.81
R4870:F2rl1 UTSW 13 95513984 missense probably damaging 0.99
R5992:F2rl1 UTSW 13 95514270 missense probably benign 0.01
R6276:F2rl1 UTSW 13 95513938 nonsense probably null
R7761:F2rl1 UTSW 13 95513874 missense probably damaging 1.00
R8087:F2rl1 UTSW 13 95513999 missense probably damaging 1.00
R8281:F2rl1 UTSW 13 95514077 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACGGCGATGTTTGCCTTC -3'
(R):5'- TTCCATCGATGAGTTCTCTGCG -3'

Sequencing Primer
(F):5'- GGGTTCACGATCACCCAGTAC -3'
(R):5'- GATGAGTTCTCTGCGTCCATC -3'
Posted On2019-10-17