Mutagenetix > Incidental Mutations

Incidental Mutation 'R7568:Ncam2'

585605

Institutional Source

Beutler Lab

Gene Symbol

Ncam2

Ensembl Gene

ENSMUSG00000022762

Gene Name

neural cell adhesion molecule 2

Synonyms

Ocam, RNCAM, Ncam-2, R4B12 antigen

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7568 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

81200697-81626828 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 81589801 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 689 (N689K)

Ref Sequence

ENSEMBL: ENSMUSP00000063468 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037785] [ENSMUST00000067602]

Predicted Effect

probably benign
Transcript: ENSMUST00000037785
AA Change: N689K

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000049390
Gene: ENSMUSG00000022762
AA Change: N689K

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
IGc2	33	100	3.18e-6	SMART
IGc2	127	193	1.13e-11	SMART
IGc2	223	288	2.03e-13	SMART
IGc2	313	387	1.12e-15	SMART
IGc2	413	482	9.93e-8	SMART
FN3	496	578	5.91e-13	SMART
FN3	594	675	2.87e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000067602
AA Change: N689K

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000063468
Gene: ENSMUSG00000022762
AA Change: N689K

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
IGc2	33	100	3.18e-6	SMART
IGc2	127	193	1.13e-11	SMART
IGc2	223	288	2.03e-13	SMART
IGc2	313	387	1.12e-15	SMART
IGc2	413	482	9.93e-8	SMART
FN3	496	578	5.91e-13	SMART
FN3	594	675	2.87e-2	SMART
transmembrane domain	696	718	N/A	INTRINSIC
low complexity region	741	757	N/A	INTRINSIC
low complexity region	789	812	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the immunoglobulin superfamily. It is a type I membrane protein and may function in selective fasciculation and zone-to-zone projection of the primary olfactory axons. [provided by RefSeq, Jul 2008]
PHENOTYPE: A gene trap insertion into an intron of this gene results in no obvious phenotype. Mice homozygous for a knock-out allele exhibit exhibit increased proliferation rate and clonogenic frequency in spinal cord-derived neurospheres. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930435E12Rik	T	C	16: 38,828,447	E100G	possibly damaging	Het
Actbl2	T	A	13: 111,255,422	V97E	possibly damaging	Het
Actl7a	A	T	4: 56,744,498	T342S	probably damaging	Het
Alcam	A	G	16: 52,268,386	S554P	probably damaging	Het
Ano3	T	C	2: 110,950,293		probably benign	Het
Atad2b	T	A	12: 5,010,390		probably null	Het
Baz2a	T	C	10: 128,125,270	S1621P	possibly damaging	Het
BC028528	CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT	CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT	3: 95,888,136		probably benign	Het
BC028528	GTCACTGGTTCTGTGGTCACTGGTTCTGTG	GTCACTGGTTCTGTGATCACTGGTTCTGTGGTCACTGGTTCTGTG	3: 95,888,151		probably benign	Het
BC028528	GGTTCTGTGGTCACT	GGTTCTGTGGTCACTAGTTCTGTGGTCACT	3: 95,888,172		probably benign	Het
Best1	T	A	19: 9,989,275		probably null	Het
Catip	G	T	1: 74,368,930	E474*	probably null	Het
Comp	A	G	8: 70,373,859	D28G	probably benign	Het
Crebbp	G	A	16: 4,126,489	R600W	probably benign	Het
Cyfip1	A	G	7: 55,872,249		probably null	Het
Ddr1	A	G	17: 35,684,282	S675P	probably damaging	Het
Dhtkd1	A	T	2: 5,922,087		probably null	Het
F2rl1	G	A	13: 95,514,014	A120V	probably damaging	Het
Fam136a	A	G	6: 86,365,802	N24D	probably benign	Het
Fbxw10	C	A	11: 62,875,168	Q755K	probably benign	Het
Fbxw16	C	A	9: 109,439,589	Q244H	possibly damaging	Het
Gabrg2	T	C	11: 41,916,292	K373E	probably benign	Het
Herc3	G	A	6: 58,843,810	V60I	probably benign	Het
Igkv19-93	T	A	6: 68,736,493	K51*	probably null	Het
Krt23	T	A	11: 99,492,800	K89*	probably null	Het
Mavs	A	G	2: 131,245,475	T298A	probably benign	Het
Mlec	T	C	5: 115,150,122	Y198C	probably damaging	Het
Nfkbia	A	G	12: 55,491,761	I82T	probably damaging	Het
Olfr104-ps	A	G	17: 37,362,605	I163V	probably benign	Het
Olfr1351	A	T	10: 79,017,507	I62F	probably benign	Het
Olfr527	A	G	7: 140,335,982	N40S	probably damaging	Het
Olfr902	A	G	9: 38,449,646	Y258C	probably damaging	Het
Pom121l2	A	T	13: 21,982,626	I356F	probably benign	Het
Ppip5k1	A	T	2: 121,337,615	L719Q	probably damaging	Het
Satb1	A	T	17: 51,782,724	V365D	possibly damaging	Het
Scrn2	T	C	11: 97,030,886	Y61H	probably damaging	Het
Siglec1	C	T	2: 131,072,682	V1505M	probably damaging	Het
Slc2a10	A	G	2: 165,514,882	N154S	probably damaging	Het
Slc39a10	A	T	1: 46,835,130	H337Q	probably benign	Het
Slc39a12	T	A	2: 14,400,128		probably null	Het
Slc6a6	T	G	6: 91,724,851	L80R	probably damaging	Het
Slit1	T	C	19: 41,601,635	Y1404C	probably damaging	Het
Sowahc	A	G	10: 59,223,299	E419G	probably damaging	Het
Ssh1	T	C	5: 113,957,380		probably null	Het
Stab1	C	A	14: 31,152,595	C952F	probably damaging	Het
Stat5a	T	C	11: 100,875,024	M312T	possibly damaging	Het
Tex2	A	G	11: 106,548,736	I606T	unknown	Het
Vmn1r19	A	G	6: 57,404,828	H122R	possibly damaging	Het
Zfp959	A	G	17: 55,897,886	I308V	probably benign	Het

Other mutations in Ncam2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01138:Ncam2	APN	16	81517579	missense	probably damaging	1.00
IGL01369:Ncam2	APN	16	81461571	missense	probably benign	0.09
IGL01554:Ncam2	APN	16	81512935	missense	possibly damaging	0.88
IGL01892:Ncam2	APN	16	81589699	missense	possibly damaging	0.71
IGL02320:Ncam2	APN	16	81434837	missense	probably damaging	0.99
IGL02669:Ncam2	APN	16	81517541	missense	probably benign	0.18
IGL03073:Ncam2	APN	16	81621347	missense	possibly damaging	0.70
IGL03353:Ncam2	APN	16	81434900	missense	probably benign	0.04
BB009:Ncam2	UTSW	16	81615820	missense	probably damaging	0.99
BB019:Ncam2	UTSW	16	81615820	missense	probably damaging	0.99
R0087:Ncam2	UTSW	16	81434901	missense	probably benign	0.11
R0097:Ncam2	UTSW	16	81517537	missense	probably damaging	1.00
R0276:Ncam2	UTSW	16	81517629	splice site	probably benign
R0279:Ncam2	UTSW	16	81623337	splice site	probably benign
R0471:Ncam2	UTSW	16	81200884	start gained	probably benign
R0523:Ncam2	UTSW	16	81461643	missense	probably damaging	0.99
R1353:Ncam2	UTSW	16	81200915	start codon destroyed	probably null
R1646:Ncam2	UTSW	16	81465706	critical splice donor site	probably benign
R1884:Ncam2	UTSW	16	81437683	missense	probably damaging	1.00
R2002:Ncam2	UTSW	16	81589698	missense	possibly damaging	0.70
R2157:Ncam2	UTSW	16	81490389	missense	probably damaging	1.00
R2330:Ncam2	UTSW	16	81512921	missense	probably benign	0.17
R2404:Ncam2	UTSW	16	81490240	splice site	probably benign
R2434:Ncam2	UTSW	16	81595225	missense	probably benign	0.01
R3104:Ncam2	UTSW	16	81465710	splice site	probably benign
R3842:Ncam2	UTSW	16	81434810	missense	probably damaging	1.00
R3954:Ncam2	UTSW	16	81589724	missense	probably damaging	1.00
R4039:Ncam2	UTSW	16	81490323	missense	probably benign	0.02
R4210:Ncam2	UTSW	16	81527103	missense	probably benign	0.02
R4514:Ncam2	UTSW	16	81512996	missense	probably benign	0.13
R4583:Ncam2	UTSW	16	81517557	missense	probably damaging	1.00
R4586:Ncam2	UTSW	16	81465569	missense	probably benign	0.06
R4710:Ncam2	UTSW	16	81465706	critical splice donor site	probably null
R4732:Ncam2	UTSW	16	81434884	missense	possibly damaging	0.63
R4733:Ncam2	UTSW	16	81434884	missense	possibly damaging	0.63
R4876:Ncam2	UTSW	16	81490346	missense	probably benign	0.27
R4923:Ncam2	UTSW	16	81589791	missense	possibly damaging	0.48
R5131:Ncam2	UTSW	16	81437662	missense	probably benign	0.44
R5329:Ncam2	UTSW	16	81434819	missense	probably damaging	1.00
R5478:Ncam2	UTSW	16	81434878	nonsense	probably null
R5479:Ncam2	UTSW	16	81434878	nonsense	probably null
R5481:Ncam2	UTSW	16	81434878	nonsense	probably null
R5519:Ncam2	UTSW	16	81434878	nonsense	probably null
R5522:Ncam2	UTSW	16	81434878	nonsense	probably null
R5523:Ncam2	UTSW	16	81434878	nonsense	probably null
R5524:Ncam2	UTSW	16	81434878	nonsense	probably null
R5526:Ncam2	UTSW	16	81434878	nonsense	probably null
R5718:Ncam2	UTSW	16	81589814	splice site	probably null
R5793:Ncam2	UTSW	16	81576103	missense	possibly damaging	0.95
R6050:Ncam2	UTSW	16	81443166	nonsense	probably null
R6212:Ncam2	UTSW	16	81432762	missense	probably damaging	1.00
R6847:Ncam2	UTSW	16	81432718	missense	probably damaging	1.00
R6935:Ncam2	UTSW	16	81526991	missense	probably benign	0.24
R7159:Ncam2	UTSW	16	81490374	missense	probably damaging	1.00
R7193:Ncam2	UTSW	16	81589795	missense	probably damaging	1.00
R7232:Ncam2	UTSW	16	81512871	missense	probably damaging	1.00
R7346:Ncam2	UTSW	16	81623368	missense	probably damaging	1.00
R7686:Ncam2	UTSW	16	81621454	missense	probably damaging	0.99
R7759:Ncam2	UTSW	16	81615784	missense	probably damaging	1.00
R7848:Ncam2	UTSW	16	81490379	missense	probably benign
R7932:Ncam2	UTSW	16	81615820	missense	probably damaging	0.99
R8078:Ncam2	UTSW	16	81443248	missense	possibly damaging	0.60
R8287:Ncam2	UTSW	16	81526995	missense	probably benign	0.07
R8354:Ncam2	UTSW	16	81512959	missense	probably benign	0.00
R8429:Ncam2	UTSW	16	81589635	missense	probably damaging	1.00
R8507:Ncam2	UTSW	16	81512979	missense	possibly damaging	0.63
R8546:Ncam2	UTSW	16	81517531	missense	probably benign	0.21

Predicted Primers

PCR Primer
(F):5'- TGCTTCCACAGAAAGACAAGG -3'
(R):5'- GTGACCCTGCTAAAGACATCAG -3'

Sequencing Primer
(F):5'- GCTTCCACAGAAAGACAAGGAAGATC -3'
(R):5'- TCTCCTACTGACAAGAACTGTGG -3'

Posted On

2019-10-17