Mutagenetix > Incidental Mutations

Incidental Mutation 'R0619:Usp16'

58561

Institutional Source

Beutler Lab

Gene Symbol

Usp16

Ensembl Gene

ENSMUSG00000025616

Gene Name

ubiquitin specific peptidase 16

Synonyms

2810483I07Rik, 1200004E02Rik, UBP-M, 6330514E22Rik

MMRRC Submission

038808-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0619 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

87454703-87483517 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 87472164 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 315 (H315L)

Ref Sequence

ENSEMBL: ENSMUSP00000026710 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026710] [ENSMUST00000119504] [ENSMUST00000144759]

Predicted Effect

probably benign
Transcript: ENSMUST00000026710
AA Change: H315L

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000026710
Gene: ENSMUSG00000025616
AA Change: H315L

Domain	Start	End	E-Value	Type
Pfam:zf-UBP	48	127	2.5e-23	PFAM
coiled coil region	149	182	N/A	INTRINSIC
Pfam:UCH	194	821	2e-54	PFAM
Pfam:UCH_1	195	800	3.8e-15	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000119504
AA Change: H314L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000114058
Gene: ENSMUSG00000025616
AA Change: H314L

Domain	Start	End	E-Value	Type
Pfam:zf-UBP	48	127	6.9e-24	PFAM
coiled coil region	149	181	N/A	INTRINSIC
Pfam:UCH	193	732	1.2e-36	PFAM
Pfam:UCH_1	194	737	2.5e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131206

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135399

Predicted Effect

probably benign
Transcript: ENSMUST00000144759
AA Change: H314L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000116323
Gene: ENSMUSG00000025616
AA Change: H314L

Domain	Start	End	E-Value	Type
Pfam:zf-UBP	48	127	2e-24	PFAM
coiled coil region	149	181	N/A	INTRINSIC
Pfam:UCH	193	330	2.4e-23	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146386

Coding Region Coverage

1x: 99.4%
3x: 99.0%
10x: 97.8%
20x: 96.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a deubiquitinating enzyme that is phosphorylated at the onset of mitosis and then dephosphorylated at the metaphase/anaphase transition. It can deubiquitinate H2A, one of two major ubiquitinated proteins of chromatin, in vitro and a mutant form of the protein was shown to block cell division. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adad2	G	A	8: 119,613,000	D74N	probably benign	Het
Adgre4	T	A	17: 55,820,679	V573D	possibly damaging	Het
Ak7	A	G	12: 105,733,511	K230E	probably damaging	Het
Amdhd2	T	C	17: 24,156,588	D375G	possibly damaging	Het
Anpep	T	C	7: 79,841,009	E253G	probably benign	Het
Bbs7	A	G	3: 36,607,576	L158S	probably benign	Het
BC037034	A	G	5: 138,263,826		probably benign	Het
Bdp1	T	C	13: 100,037,858	T2057A	probably benign	Het
C2	G	T	17: 34,872,503	H61Q	probably damaging	Het
Ccdc18	A	G	5: 108,180,416	K661E	probably benign	Het
Cdh23	C	T	10: 60,433,777	V655I	probably damaging	Het
Cep78	T	C	19: 15,978,862	T238A	probably damaging	Het
Ces2a	T	A	8: 104,736,110	N110K	probably benign	Het
Crat	T	C	2: 30,409,984	D128G	probably benign	Het
Dclre1a	A	T	19: 56,545,409	M233K	probably benign	Het
Dsg4	T	C	18: 20,461,359	V515A	probably benign	Het
Fer1l6	T	C	15: 58,662,935		probably null	Het
Fryl	T	C	5: 73,068,731	D1863G	probably benign	Het
Fsip2	T	A	2: 82,944,140	L57Q	probably damaging	Het
Gnb4	C	T	3: 32,591,207	V112I	probably benign	Het
Iqsec1	T	C	6: 90,670,406		probably null	Het
Kcnn3	A	C	3: 89,652,030	T536P	probably damaging	Het
Kctd3	T	C	1: 188,978,643	D441G	probably damaging	Het
Kifc3	G	A	8: 95,102,665	T528M	probably benign	Het
Kmt2c	G	A	5: 25,298,916	T3798I	probably benign	Het
Map1a	T	A	2: 121,305,255	M1946K	probably damaging	Het
Mfhas1	T	A	8: 35,590,675	V768E	probably benign	Het
Mroh8	C	A	2: 157,265,081	V223F	possibly damaging	Het
Mss51	A	T	14: 20,487,573	V30E	probably benign	Het
Mtmr10	G	A	7: 64,321,213	R392H	probably benign	Het
Mup3	T	C	4: 62,085,961	N105S	probably benign	Het
Myh7b	T	C	2: 155,611,722	M22T	probably benign	Het
Olfr1034	T	A	2: 86,047,311	Y276*	probably null	Het
Olfr170	T	A	16: 19,606,272	Y132F	probably damaging	Het
Olfr97	T	A	17: 37,232,155	I72F	possibly damaging	Het
Os9	A	G	10: 127,120,991	I43T	probably damaging	Het
Pkhd1l1	T	C	15: 44,483,838	L200P	probably damaging	Het
Ptpru	C	T	4: 131,820,887	V100M	possibly damaging	Het
Rnf6	G	A	5: 146,210,721	R496C	possibly damaging	Het
Rsad1	C	T	11: 94,542,639	R407Q	probably damaging	Het
Rspo3	T	C	10: 29,504,637	D127G	probably damaging	Het
Sbf2	T	A	7: 110,310,262	T1760S	possibly damaging	Het
Sh2d3c	T	A	2: 32,753,025	V588E	probably damaging	Het
Siglech	A	T	7: 55,769,162	T238S	probably benign	Het
Slc15a2	T	A	16: 36,759,307	N328I	probably damaging	Het
Slc16a11	G	T	11: 70,215,032	G94C	probably damaging	Het
Stub1	T	C	17: 25,831,322		probably null	Het
Tacc2	T	A	7: 130,716,753	V40D	probably damaging	Het
Tagln3	C	A	16: 45,724,272	R12L	probably damaging	Het
Tsen54	A	G	11: 115,815,064	E69G	probably damaging	Het
Tsks	A	G	7: 44,950,834	E150G	probably damaging	Het
Ubap2l	A	C	3: 90,017,220	V680G	probably benign	Het
Vav2	A	G	2: 27,296,121		probably null	Het
Zfc3h1	T	C	10: 115,420,810	F1562L	possibly damaging	Het
Zfp764	C	A	7: 127,406,541	V22L	probably benign	Het

Other mutations in Usp16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01322:Usp16	APN	16	87466276	missense	possibly damaging	0.95
IGL01589:Usp16	APN	16	87479183	missense	probably benign	0.00
IGL02570:Usp16	APN	16	87480893	missense	probably damaging	1.00
IGL02736:Usp16	APN	16	87464835	missense	possibly damaging	0.75
IGL02973:Usp16	APN	16	87479739	missense	probably damaging	1.00
IGL03066:Usp16	APN	16	87471833	missense	probably damaging	1.00
PIT1430001:Usp16	UTSW	16	87473132	missense	probably damaging	0.99
R0395:Usp16	UTSW	16	87475446	missense	probably damaging	1.00
R1146:Usp16	UTSW	16	87474648	missense	possibly damaging	0.93
R1146:Usp16	UTSW	16	87474648	missense	possibly damaging	0.93
R1549:Usp16	UTSW	16	87464834	missense	probably damaging	1.00
R1557:Usp16	UTSW	16	87462142	critical splice donor site	probably null
R1776:Usp16	UTSW	16	87479316	missense	probably damaging	0.97
R1818:Usp16	UTSW	16	87479132	nonsense	probably null
R1835:Usp16	UTSW	16	87480907	missense	probably damaging	1.00
R2022:Usp16	UTSW	16	87473126	missense	probably damaging	1.00
R2146:Usp16	UTSW	16	87473187	critical splice donor site	probably null
R2432:Usp16	UTSW	16	87466358	critical splice donor site	probably null
R3110:Usp16	UTSW	16	87471848	splice site	probably null
R3112:Usp16	UTSW	16	87471848	splice site	probably null
R3771:Usp16	UTSW	16	87458683	start codon destroyed	probably null	1.00
R4353:Usp16	UTSW	16	87470354	missense	probably damaging	1.00
R4959:Usp16	UTSW	16	87480914	missense	probably damaging	0.99
R4973:Usp16	UTSW	16	87480914	missense	probably damaging	0.99
R5276:Usp16	UTSW	16	87470451	critical splice donor site	probably null
R5753:Usp16	UTSW	16	87482899	missense	probably damaging	0.98
R6230:Usp16	UTSW	16	87464798	missense	possibly damaging	0.48
R6267:Usp16	UTSW	16	87483191	missense	probably benign	0.00
R6473:Usp16	UTSW	16	87483135	missense	probably benign	0.00
R6736:Usp16	UTSW	16	87470397	missense	probably damaging	1.00
R7006:Usp16	UTSW	16	87471836	missense	probably damaging	1.00
R7012:Usp16	UTSW	16	87458744	critical splice donor site	probably null
R7040:Usp16	UTSW	16	87480929	missense	probably damaging	1.00
R7136:Usp16	UTSW	16	87483171	missense	probably benign
R7295:Usp16	UTSW	16	87472089	missense	probably benign	0.44
R7434:Usp16	UTSW	16	87479319	nonsense	probably null
R7497:Usp16	UTSW	16	87466286	nonsense	probably null
R7571:Usp16	UTSW	16	87464835	missense	possibly damaging	0.75
R7576:Usp16	UTSW	16	87479300	missense	probably benign	0.34
R7624:Usp16	UTSW	16	87476805	missense	probably benign	0.23
R7889:Usp16	UTSW	16	87474584	missense	probably benign	0.44
R8499:Usp16	UTSW	16	87474648	missense	possibly damaging	0.93
X0061:Usp16	UTSW	16	87479457	missense	probably benign	0.01
X0064:Usp16	UTSW	16	87471725	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- ACCAACTGCACCAGCATGGTTC -3'
(R):5'- TCCTGCTCACTTGTCCCAAATGAAG -3'

Sequencing Primer
(F):5'- TAGGCTCTTCGTACAGCAGAC -3'
(R):5'- TGTCCCAAATGAAGAAGCACATTG -3'

Posted On

2013-07-11