Incidental Mutation 'R0619:Usp16'
ID58561
Institutional Source Beutler Lab
Gene Symbol Usp16
Ensembl Gene ENSMUSG00000025616
Gene Nameubiquitin specific peptidase 16
Synonyms2810483I07Rik, 1200004E02Rik, UBP-M, 6330514E22Rik
MMRRC Submission 038808-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0619 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location87454703-87483517 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87472164 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 315 (H315L)
Ref Sequence ENSEMBL: ENSMUSP00000026710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026710] [ENSMUST00000119504] [ENSMUST00000144759]
Predicted Effect probably benign
Transcript: ENSMUST00000026710
AA Change: H315L

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000026710
Gene: ENSMUSG00000025616
AA Change: H315L

DomainStartEndE-ValueType
Pfam:zf-UBP 48 127 2.5e-23 PFAM
coiled coil region 149 182 N/A INTRINSIC
Pfam:UCH 194 821 2e-54 PFAM
Pfam:UCH_1 195 800 3.8e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119504
AA Change: H314L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000114058
Gene: ENSMUSG00000025616
AA Change: H314L

DomainStartEndE-ValueType
Pfam:zf-UBP 48 127 6.9e-24 PFAM
coiled coil region 149 181 N/A INTRINSIC
Pfam:UCH 193 732 1.2e-36 PFAM
Pfam:UCH_1 194 737 2.5e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135399
Predicted Effect probably benign
Transcript: ENSMUST00000144759
AA Change: H314L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000116323
Gene: ENSMUSG00000025616
AA Change: H314L

DomainStartEndE-ValueType
Pfam:zf-UBP 48 127 2e-24 PFAM
coiled coil region 149 181 N/A INTRINSIC
Pfam:UCH 193 330 2.4e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146386
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a deubiquitinating enzyme that is phosphorylated at the onset of mitosis and then dephosphorylated at the metaphase/anaphase transition. It can deubiquitinate H2A, one of two major ubiquitinated proteins of chromatin, in vitro and a mutant form of the protein was shown to block cell division. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 G A 8: 119,613,000 D74N probably benign Het
Adgre4 T A 17: 55,820,679 V573D possibly damaging Het
Ak7 A G 12: 105,733,511 K230E probably damaging Het
Amdhd2 T C 17: 24,156,588 D375G possibly damaging Het
Anpep T C 7: 79,841,009 E253G probably benign Het
Bbs7 A G 3: 36,607,576 L158S probably benign Het
BC037034 A G 5: 138,263,826 probably benign Het
Bdp1 T C 13: 100,037,858 T2057A probably benign Het
C2 G T 17: 34,872,503 H61Q probably damaging Het
Ccdc18 A G 5: 108,180,416 K661E probably benign Het
Cdh23 C T 10: 60,433,777 V655I probably damaging Het
Cep78 T C 19: 15,978,862 T238A probably damaging Het
Ces2a T A 8: 104,736,110 N110K probably benign Het
Crat T C 2: 30,409,984 D128G probably benign Het
Dclre1a A T 19: 56,545,409 M233K probably benign Het
Dsg4 T C 18: 20,461,359 V515A probably benign Het
Fer1l6 T C 15: 58,662,935 probably null Het
Fryl T C 5: 73,068,731 D1863G probably benign Het
Fsip2 T A 2: 82,944,140 L57Q probably damaging Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
Iqsec1 T C 6: 90,670,406 probably null Het
Kcnn3 A C 3: 89,652,030 T536P probably damaging Het
Kctd3 T C 1: 188,978,643 D441G probably damaging Het
Kifc3 G A 8: 95,102,665 T528M probably benign Het
Kmt2c G A 5: 25,298,916 T3798I probably benign Het
Map1a T A 2: 121,305,255 M1946K probably damaging Het
Mfhas1 T A 8: 35,590,675 V768E probably benign Het
Mroh8 C A 2: 157,265,081 V223F possibly damaging Het
Mss51 A T 14: 20,487,573 V30E probably benign Het
Mtmr10 G A 7: 64,321,213 R392H probably benign Het
Mup3 T C 4: 62,085,961 N105S probably benign Het
Myh7b T C 2: 155,611,722 M22T probably benign Het
Olfr1034 T A 2: 86,047,311 Y276* probably null Het
Olfr170 T A 16: 19,606,272 Y132F probably damaging Het
Olfr97 T A 17: 37,232,155 I72F possibly damaging Het
Os9 A G 10: 127,120,991 I43T probably damaging Het
Pkhd1l1 T C 15: 44,483,838 L200P probably damaging Het
Ptpru C T 4: 131,820,887 V100M possibly damaging Het
Rnf6 G A 5: 146,210,721 R496C possibly damaging Het
Rsad1 C T 11: 94,542,639 R407Q probably damaging Het
Rspo3 T C 10: 29,504,637 D127G probably damaging Het
Sbf2 T A 7: 110,310,262 T1760S possibly damaging Het
Sh2d3c T A 2: 32,753,025 V588E probably damaging Het
Siglech A T 7: 55,769,162 T238S probably benign Het
Slc15a2 T A 16: 36,759,307 N328I probably damaging Het
Slc16a11 G T 11: 70,215,032 G94C probably damaging Het
Stub1 T C 17: 25,831,322 probably null Het
Tacc2 T A 7: 130,716,753 V40D probably damaging Het
Tagln3 C A 16: 45,724,272 R12L probably damaging Het
Tsen54 A G 11: 115,815,064 E69G probably damaging Het
Tsks A G 7: 44,950,834 E150G probably damaging Het
Ubap2l A C 3: 90,017,220 V680G probably benign Het
Vav2 A G 2: 27,296,121 probably null Het
Zfc3h1 T C 10: 115,420,810 F1562L possibly damaging Het
Zfp764 C A 7: 127,406,541 V22L probably benign Het
Other mutations in Usp16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Usp16 APN 16 87466276 missense possibly damaging 0.95
IGL01589:Usp16 APN 16 87479183 missense probably benign 0.00
IGL02570:Usp16 APN 16 87480893 missense probably damaging 1.00
IGL02736:Usp16 APN 16 87464835 missense possibly damaging 0.75
IGL02973:Usp16 APN 16 87479739 missense probably damaging 1.00
IGL03066:Usp16 APN 16 87471833 missense probably damaging 1.00
PIT1430001:Usp16 UTSW 16 87473132 missense probably damaging 0.99
R0395:Usp16 UTSW 16 87475446 missense probably damaging 1.00
R1146:Usp16 UTSW 16 87474648 missense possibly damaging 0.93
R1146:Usp16 UTSW 16 87474648 missense possibly damaging 0.93
R1549:Usp16 UTSW 16 87464834 missense probably damaging 1.00
R1557:Usp16 UTSW 16 87462142 critical splice donor site probably null
R1776:Usp16 UTSW 16 87479316 missense probably damaging 0.97
R1818:Usp16 UTSW 16 87479132 nonsense probably null
R1835:Usp16 UTSW 16 87480907 missense probably damaging 1.00
R2022:Usp16 UTSW 16 87473126 missense probably damaging 1.00
R2146:Usp16 UTSW 16 87473187 critical splice donor site probably null
R2432:Usp16 UTSW 16 87466358 critical splice donor site probably null
R3110:Usp16 UTSW 16 87471848 splice site probably null
R3112:Usp16 UTSW 16 87471848 splice site probably null
R3771:Usp16 UTSW 16 87458683 start codon destroyed probably null 1.00
R4353:Usp16 UTSW 16 87470354 missense probably damaging 1.00
R4959:Usp16 UTSW 16 87480914 missense probably damaging 0.99
R4973:Usp16 UTSW 16 87480914 missense probably damaging 0.99
R5276:Usp16 UTSW 16 87470451 critical splice donor site probably null
R5753:Usp16 UTSW 16 87482899 missense probably damaging 0.98
R6230:Usp16 UTSW 16 87464798 missense possibly damaging 0.48
R6267:Usp16 UTSW 16 87483191 missense probably benign 0.00
R6473:Usp16 UTSW 16 87483135 missense probably benign 0.00
R6736:Usp16 UTSW 16 87470397 missense probably damaging 1.00
R7006:Usp16 UTSW 16 87471836 missense probably damaging 1.00
R7012:Usp16 UTSW 16 87458744 critical splice donor site probably null
R7040:Usp16 UTSW 16 87480929 missense probably damaging 1.00
R7136:Usp16 UTSW 16 87483171 missense probably benign
R7295:Usp16 UTSW 16 87472089 missense probably benign 0.44
R7434:Usp16 UTSW 16 87479319 nonsense probably null
R7497:Usp16 UTSW 16 87466286 nonsense probably null
R7571:Usp16 UTSW 16 87464835 missense possibly damaging 0.75
R7576:Usp16 UTSW 16 87479300 missense probably benign 0.34
R7624:Usp16 UTSW 16 87476805 missense probably benign 0.23
R7889:Usp16 UTSW 16 87474584 missense probably benign 0.44
R7972:Usp16 UTSW 16 87474584 missense probably benign 0.44
X0061:Usp16 UTSW 16 87479457 missense probably benign 0.01
X0064:Usp16 UTSW 16 87471725 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACCAACTGCACCAGCATGGTTC -3'
(R):5'- TCCTGCTCACTTGTCCCAAATGAAG -3'

Sequencing Primer
(F):5'- TAGGCTCTTCGTACAGCAGAC -3'
(R):5'- TGTCCCAAATGAAGAAGCACATTG -3'
Posted On2013-07-11