Incidental Mutation 'R7568:Best1'
ID585610
Institutional Source Beutler Lab
Gene Symbol Best1
Ensembl Gene ENSMUSG00000037418
Gene Namebestrophin 1
Synonymsbest macular dystrophy, mBest1, Vmd2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7568 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location9985174-10001633 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 9989275 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025563] [ENSMUST00000117346]
Predicted Effect probably benign
Transcript: ENSMUST00000025563
SMART Domains Protein: ENSMUSP00000025563
Gene: ENSMUSG00000024661

DomainStartEndE-ValueType
Pfam:Ferritin 18 159 1.5e-40 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000117346
SMART Domains Protein: ENSMUSP00000113053
Gene: ENSMUSG00000037418

DomainStartEndE-ValueType
Pfam:Bestrophin 8 316 8.5e-111 PFAM
low complexity region 476 488 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the bestrophin gene family. This small gene family is characterized by proteins with a highly conserved N-terminus with four to six transmembrane domains. Bestrophins may form chloride ion channels or may regulate voltage-gated L-type calcium-ion channels. Bestrophins are generally believed to form calcium-activated chloride-ion channels in epithelial cells but they have also been shown to be highly permeable to bicarbonate ion transport in retinal tissue. Mutations in this gene are responsible for juvenile-onset vitelliform macular dystrophy (VMD2), also known as Best macular dystrophy, in addition to adult-onset vitelliform macular dystrophy (AVMD) and other retinopathies. Alternative splicing results in multiple variants encoding distinct isoforms.[provided by RefSeq, Nov 2008]
PHENOTYPE: Homozygous null mutations of this gene generally result in abnormal retinal pigment epithelium morphology and/or altered eye electrophysiology. Homozygotes for a null allele show male subfertility associated with abnormal sperm morphology and reduced motility in the absence of retinal pathology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik T C 16: 38,828,447 E100G possibly damaging Het
Actbl2 T A 13: 111,255,422 V97E possibly damaging Het
Actl7a A T 4: 56,744,498 T342S probably damaging Het
Alcam A G 16: 52,268,386 S554P probably damaging Het
Ano3 T C 2: 110,950,293 probably benign Het
Atad2b T A 12: 5,010,390 probably null Het
Baz2a T C 10: 128,125,270 S1621P possibly damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 GTCACTGGTTCTGTGGTCACTGGTTCTGTG GTCACTGGTTCTGTGATCACTGGTTCTGTGGTCACTGGTTCTGTG 3: 95,888,151 probably benign Het
BC028528 GGTTCTGTGGTCACT GGTTCTGTGGTCACTAGTTCTGTGGTCACT 3: 95,888,172 probably benign Het
Catip G T 1: 74,368,930 E474* probably null Het
Comp A G 8: 70,373,859 D28G probably benign Het
Crebbp G A 16: 4,126,489 R600W probably benign Het
Cyfip1 A G 7: 55,872,249 probably null Het
Ddr1 A G 17: 35,684,282 S675P probably damaging Het
Dhtkd1 A T 2: 5,922,087 probably null Het
F2rl1 G A 13: 95,514,014 A120V probably damaging Het
Fam136a A G 6: 86,365,802 N24D probably benign Het
Fbxw10 C A 11: 62,875,168 Q755K probably benign Het
Fbxw16 C A 9: 109,439,589 Q244H possibly damaging Het
Gabrg2 T C 11: 41,916,292 K373E probably benign Het
Herc3 G A 6: 58,843,810 V60I probably benign Het
Igkv19-93 T A 6: 68,736,493 K51* probably null Het
Krt23 T A 11: 99,492,800 K89* probably null Het
Mavs A G 2: 131,245,475 T298A probably benign Het
Mlec T C 5: 115,150,122 Y198C probably damaging Het
Ncam2 C A 16: 81,589,801 N689K probably benign Het
Nfkbia A G 12: 55,491,761 I82T probably damaging Het
Olfr104-ps A G 17: 37,362,605 I163V probably benign Het
Olfr1351 A T 10: 79,017,507 I62F probably benign Het
Olfr527 A G 7: 140,335,982 N40S probably damaging Het
Olfr902 A G 9: 38,449,646 Y258C probably damaging Het
Pom121l2 A T 13: 21,982,626 I356F probably benign Het
Ppip5k1 A T 2: 121,337,615 L719Q probably damaging Het
Satb1 A T 17: 51,782,724 V365D possibly damaging Het
Scrn2 T C 11: 97,030,886 Y61H probably damaging Het
Siglec1 C T 2: 131,072,682 V1505M probably damaging Het
Slc2a10 A G 2: 165,514,882 N154S probably damaging Het
Slc39a10 A T 1: 46,835,130 H337Q probably benign Het
Slc39a12 T A 2: 14,400,128 probably null Het
Slc6a6 T G 6: 91,724,851 L80R probably damaging Het
Slit1 T C 19: 41,601,635 Y1404C probably damaging Het
Sowahc A G 10: 59,223,299 E419G probably damaging Het
Ssh1 T C 5: 113,957,380 probably null Het
Stab1 C A 14: 31,152,595 C952F probably damaging Het
Stat5a T C 11: 100,875,024 M312T possibly damaging Het
Tex2 A G 11: 106,548,736 I606T unknown Het
Vmn1r19 A G 6: 57,404,828 H122R possibly damaging Het
Zfp959 A G 17: 55,897,886 I308V probably benign Het
Other mutations in Best1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01563:Best1 APN 19 9986735 missense probably benign 0.22
IGL02129:Best1 APN 19 9992921 missense probably benign
IGL02310:Best1 APN 19 9989152 missense probably benign 0.00
IGL02470:Best1 APN 19 9992976 missense probably benign 0.43
IGL02505:Best1 APN 19 9989150 missense probably damaging 1.00
R0366:Best1 UTSW 19 9992053 splice site probably null
R1476:Best1 UTSW 19 9990489 nonsense probably null
R1674:Best1 UTSW 19 9993226 critical splice donor site probably null
R2091:Best1 UTSW 19 9992079 missense probably benign 0.27
R2516:Best1 UTSW 19 9993311 nonsense probably null
R2866:Best1 UTSW 19 9986221 missense probably benign
R4693:Best1 UTSW 19 9997135 missense probably damaging 1.00
R4851:Best1 UTSW 19 9991698 missense probably damaging 1.00
R4895:Best1 UTSW 19 9992771 missense probably benign 0.00
R5633:Best1 UTSW 19 9992103 missense probably benign 0.29
R5700:Best1 UTSW 19 9997199 unclassified probably benign
R5837:Best1 UTSW 19 9989119 splice site probably null
R6893:Best1 UTSW 19 9997082 missense probably damaging 1.00
R7021:Best1 UTSW 19 9986779 missense probably benign
R7220:Best1 UTSW 19 9992115 missense probably benign 0.31
R7267:Best1 UTSW 19 9986813 missense probably benign 0.00
R7284:Best1 UTSW 19 9986373 critical splice acceptor site probably null
R7489:Best1 UTSW 19 9997046 missense possibly damaging 0.68
R7798:Best1 UTSW 19 9991671 missense probably damaging 1.00
R8192:Best1 UTSW 19 9986300 missense possibly damaging 0.52
X0065:Best1 UTSW 19 9986975 missense probably benign 0.03
Z1177:Best1 UTSW 19 9993239 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGTGTAGTAATAAGAGCTGTTCC -3'
(R):5'- TCACCTCGACTTTGGAGACTG -3'

Sequencing Primer
(F):5'- GAGCTGTTCCAAATTGCTTACAC -3'
(R):5'- CTTTGGAGACTGCATCAAGC -3'
Posted On2019-10-17