Incidental Mutation 'R7569:Nuak2'
ID585614
Institutional Source Beutler Lab
Gene Symbol Nuak2
Ensembl Gene ENSMUSG00000009772
Gene NameNUAK family, SNF1-like kinase, 2
SynonymsSnark, 1200013B22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R7569 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location132316126-132333488 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 132316281 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 18 (A18T)
Ref Sequence ENSEMBL: ENSMUSP00000072039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072177] [ENSMUST00000082125]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072177
AA Change: A18T

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000072039
Gene: ENSMUSG00000009772
AA Change: A18T

DomainStartEndE-ValueType
low complexity region 7 28 N/A INTRINSIC
low complexity region 45 56 N/A INTRINSIC
S_TKc 57 315 5.53e-99 SMART
low complexity region 471 485 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000082125
AA Change: A18T
SMART Domains Protein: ENSMUSP00000080769
Gene: ENSMUSG00000009772
AA Change: A18T

DomainStartEndE-ValueType
low complexity region 7 28 N/A INTRINSIC
low complexity region 45 56 N/A INTRINSIC
S_TKc 57 307 6.1e-106 SMART
low complexity region 463 477 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (58/59)
MGI Phenotype PHENOTYPE: Most homozygous null mice are exencephalic and die at E16.5 while survivors show a higher number of azoxymethane (AOM)-induced aberrant crypt foci (ACF) in colon. Heterozygotes show increased susceptibility to AOM-induced ACF formation and colon tumors, mature-onset obesity and metabolic disorders. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
9330182O14Rik A T 15: 40,144,948 T73S unknown Het
Acvrl1 A G 15: 101,135,755 Q106R probably benign Het
Adgb A T 10: 10,431,252 D329E probably benign Het
Ankrd12 A T 17: 65,982,905 D1844E probably damaging Het
Ankub1 G A 3: 57,665,618 R228* probably null Het
Apol6 A C 15: 77,050,698 probably benign Het
Ascc2 G A 11: 4,679,506 V618M probably damaging Het
Asic3 A G 5: 24,414,048 T113A probably benign Het
BC034090 T A 1: 155,217,405 H769L probably benign Het
Bcl11a G T 11: 24,085,458 E65* probably null Het
Birc6 G T 17: 74,598,082 R1290L possibly damaging Het
C6 A G 15: 4,789,581 E465G probably benign Het
Cav2 T A 6: 17,282,079 I112N probably damaging Het
Cep131 G A 11: 120,066,713 A848V probably damaging Het
Col8a1 T A 16: 57,627,192 I652F unknown Het
Cul4a A G 8: 13,123,493 N180S probably benign Het
Dhx38 A G 8: 109,560,695 S214P probably damaging Het
Dmxl2 A G 9: 54,415,987 V1197A possibly damaging Het
Dusp27 T C 1: 166,108,035 D198G probably damaging Het
Dynlt1f A G 17: 6,655,782 S7P not run Het
Epha1 T A 6: 42,365,422 T331S possibly damaging Het
Gm10436 A T 12: 88,176,315 Y373N probably benign Het
Gm49333 T A 16: 20,642,487 Y641* probably null Het
Hus1b A G 13: 30,946,864 Y271H probably damaging Het
Kmt2b A G 7: 30,569,553 V2610A possibly damaging Het
Lama2 A G 10: 27,265,050 L651P probably damaging Het
Lgr5 T C 10: 115,462,756 Y361C probably damaging Het
Map1s T C 8: 70,913,498 V349A probably benign Het
Map3k6 A G 4: 133,250,077 R912G probably benign Het
Marc2 A T 1: 184,841,425 F92Y possibly damaging Het
Nampt T A 12: 32,850,434 H459Q probably benign Het
Nlrp1a T C 11: 71,109,043 M817V probably benign Het
Npsr1 A G 9: 24,313,730 R345G probably benign Het
Olfr1428 T C 19: 12,109,021 D175G possibly damaging Het
Olfr993 A G 2: 85,414,135 V248A probably damaging Het
Ppp4r3b T C 11: 29,188,540 F296S possibly damaging Het
Pycr2 T C 1: 180,904,518 F19L probably benign Het
Robo2 T A 16: 74,035,115 T226S possibly damaging Het
Rock1 A T 18: 10,140,194 N132K probably damaging Het
Rp1 A T 1: 4,284,840 L379Q unknown Het
Sema6d A G 2: 124,657,972 I323V possibly damaging Het
Slc12a4 A G 8: 105,945,847 I814T probably damaging Het
Slc18a2 G A 19: 59,284,152 G352R probably damaging Het
Slc39a14 T C 14: 70,309,827 T357A possibly damaging Het
Smarcad1 T A 6: 65,052,711 D94E probably benign Het
Sorcs2 A G 5: 36,025,876 Y1018H probably benign Het
Srebf1 G T 11: 60,200,121 T1069K possibly damaging Het
St3gal3 A G 4: 117,964,356 V123A probably benign Het
Stradb A G 1: 58,991,151 Y188C unknown Het
Sult2a2 T C 7: 13,779,505 F186L probably benign Het
Syne2 A G 12: 75,927,390 T1120A probably benign Het
Taok1 A T 11: 77,555,614 S430T probably benign Het
Tmem62 A T 2: 121,006,930 I573L probably benign Het
Trav9-1 T C 14: 53,488,124 S7P probably benign Het
U2af1l4 A T 7: 30,563,557 I24F probably damaging Het
Usp33 T A 3: 152,391,665 I840N probably damaging Het
Vmn2r74 A C 7: 85,952,336 I698S probably damaging Het
Zfp352 C T 4: 90,223,659 P12L possibly damaging Het
Zfp507 T A 7: 35,794,544 E358V probably damaging Het
Other mutations in Nuak2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01607:Nuak2 APN 1 132328140 missense probably damaging 1.00
IGL01660:Nuak2 APN 1 132331570 missense probably benign 0.12
IGL02093:Nuak2 APN 1 132332112 missense probably benign
IGL02731:Nuak2 APN 1 132316357 missense probably damaging 1.00
IGL03231:Nuak2 APN 1 132328177 missense probably damaging 1.00
R0547:Nuak2 UTSW 1 132332203 missense probably benign 0.09
R1972:Nuak2 UTSW 1 132330602 missense probably damaging 0.98
R1973:Nuak2 UTSW 1 132330602 missense probably damaging 0.98
R2897:Nuak2 UTSW 1 132325053 missense probably damaging 1.00
R3420:Nuak2 UTSW 1 132332080 missense probably benign 0.00
R3421:Nuak2 UTSW 1 132332080 missense probably benign 0.00
R3422:Nuak2 UTSW 1 132332080 missense probably benign 0.00
R3890:Nuak2 UTSW 1 132331485 missense possibly damaging 0.79
R3891:Nuak2 UTSW 1 132331485 missense possibly damaging 0.79
R3892:Nuak2 UTSW 1 132331485 missense possibly damaging 0.79
R4899:Nuak2 UTSW 1 132324986 nonsense probably null
R5068:Nuak2 UTSW 1 132331771 missense probably benign 0.04
R6243:Nuak2 UTSW 1 132332367 missense probably benign 0.01
R6310:Nuak2 UTSW 1 132329961 missense probably damaging 1.00
R6505:Nuak2 UTSW 1 132316394 missense probably damaging 1.00
R6694:Nuak2 UTSW 1 132332310 missense probably damaging 1.00
R6966:Nuak2 UTSW 1 132325032 missense possibly damaging 0.95
R7708:Nuak2 UTSW 1 132325032 missense possibly damaging 0.95
R7879:Nuak2 UTSW 1 132331957 missense probably benign
R7962:Nuak2 UTSW 1 132331957 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCCTCGAAACGTTTTATAGC -3'
(R):5'- GACACATCTAAAATGCGCGC -3'

Sequencing Primer
(F):5'- CCTCGAAACGTTTTATAGCAATTCGG -3'
(R):5'- ATCTAAAATGCGCGCGCCTG -3'
Posted On2019-10-17