Incidental Mutation 'R7569:BC034090'
ID585615
Institutional Source Beutler Lab
Gene Symbol BC034090
Ensembl Gene ENSMUSG00000033722
Gene NamecDNA sequence BC034090
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R7569 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location155212471-155244444 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 155217405 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 769 (H769L)
Ref Sequence ENSEMBL: ENSMUSP00000037456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035914] [ENSMUST00000186156]
Predicted Effect probably benign
Transcript: ENSMUST00000035914
AA Change: H769L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000037456
Gene: ENSMUSG00000033722
AA Change: H769L

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:DUF4685 44 168 6.6e-57 PFAM
low complexity region 486 500 N/A INTRINSIC
low complexity region 562 568 N/A INTRINSIC
low complexity region 640 652 N/A INTRINSIC
PDZ 830 905 4.8e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186156
AA Change: H1131L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000139623
Gene: ENSMUSG00000033722
AA Change: H1131L

DomainStartEndE-ValueType
low complexity region 446 463 N/A INTRINSIC
low complexity region 779 793 N/A INTRINSIC
low complexity region 855 861 N/A INTRINSIC
low complexity region 933 945 N/A INTRINSIC
PDZ 1123 1198 2.2e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
9330182O14Rik A T 15: 40,144,948 T73S unknown Het
Acvrl1 A G 15: 101,135,755 Q106R probably benign Het
Adgb A T 10: 10,431,252 D329E probably benign Het
Ankrd12 A T 17: 65,982,905 D1844E probably damaging Het
Ankub1 G A 3: 57,665,618 R228* probably null Het
Ascc2 G A 11: 4,679,506 V618M probably damaging Het
Asic3 A G 5: 24,414,048 T113A probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
Bcl11a G T 11: 24,085,458 E65* probably null Het
Birc6 G T 17: 74,598,082 R1290L possibly damaging Het
C6 A G 15: 4,789,581 E465G probably benign Het
Cav2 T A 6: 17,282,079 I112N probably damaging Het
Cep131 G A 11: 120,066,713 A848V probably damaging Het
Col8a1 T A 16: 57,627,192 I652F unknown Het
Cul4a A G 8: 13,123,493 N180S probably benign Het
Dhx38 A G 8: 109,560,695 S214P probably damaging Het
Dmxl2 A G 9: 54,415,987 V1197A possibly damaging Het
Dusp27 T C 1: 166,108,035 D198G probably damaging Het
Dynlt1f A G 17: 6,655,782 S7P not run Het
Epha1 T A 6: 42,365,422 T331S possibly damaging Het
Gm10436 A T 12: 88,176,315 Y373N probably benign Het
Gm49333 T A 16: 20,642,487 Y641* probably null Het
Hus1b A G 13: 30,946,864 Y271H probably damaging Het
Kmt2b A G 7: 30,569,553 V2610A possibly damaging Het
Lama2 A G 10: 27,265,050 L651P probably damaging Het
Lgr5 T C 10: 115,462,756 Y361C probably damaging Het
Map1s T C 8: 70,913,498 V349A probably benign Het
Map3k6 A G 4: 133,250,077 R912G probably benign Het
Marc2 A T 1: 184,841,425 F92Y possibly damaging Het
Nampt T A 12: 32,850,434 H459Q probably benign Het
Nlrp1a T C 11: 71,109,043 M817V probably benign Het
Npsr1 A G 9: 24,313,730 R345G probably benign Het
Nuak2 G A 1: 132,316,281 A18T possibly damaging Het
Olfr1428 T C 19: 12,109,021 D175G possibly damaging Het
Olfr993 A G 2: 85,414,135 V248A probably damaging Het
Ppp4r3b T C 11: 29,188,540 F296S possibly damaging Het
Pycr2 T C 1: 180,904,518 F19L probably benign Het
Robo2 T A 16: 74,035,115 T226S possibly damaging Het
Rock1 A T 18: 10,140,194 N132K probably damaging Het
Rp1 A T 1: 4,284,840 L379Q unknown Het
Sema6d A G 2: 124,657,972 I323V possibly damaging Het
Slc12a4 A G 8: 105,945,847 I814T probably damaging Het
Slc18a2 G A 19: 59,284,152 G352R probably damaging Het
Slc39a14 T C 14: 70,309,827 T357A possibly damaging Het
Smarcad1 T A 6: 65,052,711 D94E probably benign Het
Sorcs2 A G 5: 36,025,876 Y1018H probably benign Het
Srebf1 G T 11: 60,200,121 T1069K possibly damaging Het
St3gal3 A G 4: 117,964,356 V123A probably benign Het
Stradb A G 1: 58,991,151 Y188C unknown Het
Sult2a2 T C 7: 13,779,505 F186L probably benign Het
Syne2 A G 12: 75,927,390 T1120A probably benign Het
Taok1 A T 11: 77,555,614 S430T probably benign Het
Tmem62 A T 2: 121,006,930 I573L probably benign Het
Trav9-1 T C 14: 53,488,124 S7P probably benign Het
U2af1l4 A T 7: 30,563,557 I24F probably damaging Het
Usp33 T A 3: 152,391,665 I840N probably damaging Het
Vmn2r74 A C 7: 85,952,336 I698S probably damaging Het
Zfp352 C T 4: 90,223,659 P12L possibly damaging Het
Zfp507 T A 7: 35,794,544 E358V probably damaging Het
Other mutations in BC034090
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:BC034090 APN 1 155225447 missense possibly damaging 0.95
IGL00159:BC034090 APN 1 155225451 nonsense probably null
IGL00481:BC034090 APN 1 155232521 missense probably benign 0.04
IGL01309:BC034090 APN 1 155226384 missense probably damaging 0.98
IGL01813:BC034090 APN 1 155226339 nonsense probably null
IGL01938:BC034090 APN 1 155232592 splice site probably null
IGL01982:BC034090 APN 1 155223332 missense probably damaging 1.00
IGL02115:BC034090 APN 1 155232651 intron probably benign
IGL02338:BC034090 APN 1 155217471 missense probably damaging 1.00
IGL02406:BC034090 APN 1 155225153 missense probably benign 0.00
IGL03243:BC034090 APN 1 155225655 missense possibly damaging 0.71
IGL03290:BC034090 APN 1 155226110 missense probably damaging 1.00
R0055:BC034090 UTSW 1 155241658 missense probably damaging 1.00
R1436:BC034090 UTSW 1 155225916 missense probably benign 0.04
R1649:BC034090 UTSW 1 155225573 missense possibly damaging 0.72
R1710:BC034090 UTSW 1 155225864 missense possibly damaging 0.82
R1819:BC034090 UTSW 1 155225829 missense possibly damaging 0.58
R1969:BC034090 UTSW 1 155225226 missense possibly damaging 0.90
R1996:BC034090 UTSW 1 155221594 unclassified probably benign
R2012:BC034090 UTSW 1 155221432 missense probably damaging 0.98
R2133:BC034090 UTSW 1 155225786 missense probably benign 0.27
R3426:BC034090 UTSW 1 155241498 missense probably benign 0.00
R3427:BC034090 UTSW 1 155241498 missense probably benign 0.00
R3428:BC034090 UTSW 1 155241498 missense probably benign 0.00
R3782:BC034090 UTSW 1 155226278 missense probably damaging 1.00
R3792:BC034090 UTSW 1 155241797 missense probably damaging 0.98
R4234:BC034090 UTSW 1 155241580 missense probably benign
R4373:BC034090 UTSW 1 155226158 missense probably benign 0.22
R4377:BC034090 UTSW 1 155232450 missense probably benign 0.00
R4661:BC034090 UTSW 1 155232475 missense probably damaging 0.98
R4676:BC034090 UTSW 1 155226264 missense possibly damaging 0.60
R4729:BC034090 UTSW 1 155225090 missense probably damaging 1.00
R5170:BC034090 UTSW 1 155213650 missense probably damaging 1.00
R5340:BC034090 UTSW 1 155226414 missense possibly damaging 0.74
R5382:BC034090 UTSW 1 155225603 missense probably benign 0.09
R5384:BC034090 UTSW 1 155242027 missense possibly damaging 0.68
R5576:BC034090 UTSW 1 155241468 missense probably benign 0.01
R5891:BC034090 UTSW 1 155233047 unclassified probably benign
R6060:BC034090 UTSW 1 155241499 missense probably benign 0.00
R6092:BC034090 UTSW 1 155224913 missense probably damaging 0.99
R6662:BC034090 UTSW 1 155226339 missense possibly damaging 0.92
R6736:BC034090 UTSW 1 155241930 missense possibly damaging 0.92
R6903:BC034090 UTSW 1 155221385 missense probably benign 0.03
R6970:BC034090 UTSW 1 155241439 missense probably damaging 1.00
R7144:BC034090 UTSW 1 155242031 missense probably damaging 1.00
R7201:BC034090 UTSW 1 155241934 missense probably damaging 0.98
R7265:BC034090 UTSW 1 155225327 missense probably damaging 0.96
R7380:BC034090 UTSW 1 155232483 missense probably damaging 1.00
R7436:BC034090 UTSW 1 155226381 missense probably damaging 1.00
R7587:BC034090 UTSW 1 155217486 missense probably damaging 1.00
R7664:BC034090 UTSW 1 155241631 missense probably damaging 1.00
R7737:BC034090 UTSW 1 155241673 missense possibly damaging 0.66
R7782:BC034090 UTSW 1 155232664 intron probably benign
X0002:BC034090 UTSW 1 155226279 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTGGAGTCAAATCGGCCAG -3'
(R):5'- GGCTGTGATACCTAACCCTACC -3'

Sequencing Primer
(F):5'- GAGTCAAATCGGCCAGCTCTAC -3'
(R):5'- GTGATACCTAACCCTACCGTTACTG -3'
Posted On2019-10-17