Incidental Mutation 'R7569:Dusp27'
ID585616
Institutional Source Beutler Lab
Gene Symbol Dusp27
Ensembl Gene ENSMUSG00000026564
Gene Namedual specificity phosphatase 27 (putative)
SynonymsC130085G02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7569 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location166098148-166127922 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 166108035 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 198 (D198G)
Ref Sequence ENSEMBL: ENSMUSP00000083155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085992] [ENSMUST00000192369]
Predicted Effect probably damaging
Transcript: ENSMUST00000085992
AA Change: D198G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000083155
Gene: ENSMUSG00000026564
AA Change: D198G

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
DSPc 133 277 2.45e-30 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 404 425 N/A INTRINSIC
low complexity region 429 439 N/A INTRINSIC
low complexity region 618 635 N/A INTRINSIC
low complexity region 655 666 N/A INTRINSIC
low complexity region 773 788 N/A INTRINSIC
coiled coil region 813 839 N/A INTRINSIC
low complexity region 851 860 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1001 1019 N/A INTRINSIC
low complexity region 1026 1040 N/A INTRINSIC
low complexity region 1074 1091 N/A INTRINSIC
low complexity region 1108 1120 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192369
AA Change: D198G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141564
Gene: ENSMUSG00000026564
AA Change: D198G

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
DSPc 133 277 2.45e-30 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 404 425 N/A INTRINSIC
low complexity region 429 439 N/A INTRINSIC
low complexity region 618 635 N/A INTRINSIC
low complexity region 655 666 N/A INTRINSIC
low complexity region 773 788 N/A INTRINSIC
coiled coil region 813 839 N/A INTRINSIC
low complexity region 851 860 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1001 1019 N/A INTRINSIC
low complexity region 1026 1040 N/A INTRINSIC
low complexity region 1074 1091 N/A INTRINSIC
low complexity region 1108 1120 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
9330182O14Rik A T 15: 40,144,948 T73S unknown Het
Acvrl1 A G 15: 101,135,755 Q106R probably benign Het
Adgb A T 10: 10,431,252 D329E probably benign Het
Ankrd12 A T 17: 65,982,905 D1844E probably damaging Het
Ankub1 G A 3: 57,665,618 R228* probably null Het
Apol6 A C 15: 77,050,698 probably benign Het
Ascc2 G A 11: 4,679,506 V618M probably damaging Het
Asic3 A G 5: 24,414,048 T113A probably benign Het
BC034090 T A 1: 155,217,405 H769L probably benign Het
Bcl11a G T 11: 24,085,458 E65* probably null Het
Birc6 G T 17: 74,598,082 R1290L possibly damaging Het
C6 A G 15: 4,789,581 E465G probably benign Het
Cav2 T A 6: 17,282,079 I112N probably damaging Het
Cep131 G A 11: 120,066,713 A848V probably damaging Het
Col8a1 T A 16: 57,627,192 I652F unknown Het
Cul4a A G 8: 13,123,493 N180S probably benign Het
Dhx38 A G 8: 109,560,695 S214P probably damaging Het
Dmxl2 A G 9: 54,415,987 V1197A possibly damaging Het
Dynlt1f A G 17: 6,655,782 S7P not run Het
Epha1 T A 6: 42,365,422 T331S possibly damaging Het
Gm10436 A T 12: 88,176,315 Y373N probably benign Het
Gm49333 T A 16: 20,642,487 Y641* probably null Het
Hus1b A G 13: 30,946,864 Y271H probably damaging Het
Kmt2b A G 7: 30,569,553 V2610A possibly damaging Het
Lama2 A G 10: 27,265,050 L651P probably damaging Het
Lgr5 T C 10: 115,462,756 Y361C probably damaging Het
Map1s T C 8: 70,913,498 V349A probably benign Het
Map3k6 A G 4: 133,250,077 R912G probably benign Het
Marc2 A T 1: 184,841,425 F92Y possibly damaging Het
Nampt T A 12: 32,850,434 H459Q probably benign Het
Nlrp1a T C 11: 71,109,043 M817V probably benign Het
Npsr1 A G 9: 24,313,730 R345G probably benign Het
Nuak2 G A 1: 132,316,281 A18T possibly damaging Het
Olfr1428 T C 19: 12,109,021 D175G possibly damaging Het
Olfr993 A G 2: 85,414,135 V248A probably damaging Het
Ppp4r3b T C 11: 29,188,540 F296S possibly damaging Het
Pycr2 T C 1: 180,904,518 F19L probably benign Het
Robo2 T A 16: 74,035,115 T226S possibly damaging Het
Rock1 A T 18: 10,140,194 N132K probably damaging Het
Rp1 A T 1: 4,284,840 L379Q unknown Het
Sema6d A G 2: 124,657,972 I323V possibly damaging Het
Slc12a4 A G 8: 105,945,847 I814T probably damaging Het
Slc18a2 G A 19: 59,284,152 G352R probably damaging Het
Slc39a14 T C 14: 70,309,827 T357A possibly damaging Het
Smarcad1 T A 6: 65,052,711 D94E probably benign Het
Sorcs2 A G 5: 36,025,876 Y1018H probably benign Het
Srebf1 G T 11: 60,200,121 T1069K possibly damaging Het
St3gal3 A G 4: 117,964,356 V123A probably benign Het
Stradb A G 1: 58,991,151 Y188C unknown Het
Sult2a2 T C 7: 13,779,505 F186L probably benign Het
Syne2 A G 12: 75,927,390 T1120A probably benign Het
Taok1 A T 11: 77,555,614 S430T probably benign Het
Tmem62 A T 2: 121,006,930 I573L probably benign Het
Trav9-1 T C 14: 53,488,124 S7P probably benign Het
U2af1l4 A T 7: 30,563,557 I24F probably damaging Het
Usp33 T A 3: 152,391,665 I840N probably damaging Het
Vmn2r74 A C 7: 85,952,336 I698S probably damaging Het
Zfp352 C T 4: 90,223,659 P12L possibly damaging Het
Zfp507 T A 7: 35,794,544 E358V probably damaging Het
Other mutations in Dusp27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Dusp27 APN 1 166100552 missense probably benign 0.00
IGL00973:Dusp27 APN 1 166099458 missense probably benign
IGL01331:Dusp27 APN 1 166108180 missense probably damaging 1.00
IGL01466:Dusp27 APN 1 166100504 missense probably damaging 1.00
IGL01572:Dusp27 APN 1 166100372 missense probably benign 0.18
IGL01906:Dusp27 APN 1 166099523 missense probably damaging 1.00
IGL01974:Dusp27 APN 1 166100536 nonsense probably null
IGL02112:Dusp27 APN 1 166099671 nonsense probably null
IGL02805:Dusp27 APN 1 166099061 missense probably damaging 1.00
IGL03343:Dusp27 APN 1 166099448 missense probably benign 0.00
R0116:Dusp27 UTSW 1 166099701 missense probably benign 0.19
R0367:Dusp27 UTSW 1 166100763 missense probably benign 0.05
R0499:Dusp27 UTSW 1 166099101 missense probably benign 0.00
R0542:Dusp27 UTSW 1 166101284 missense possibly damaging 0.90
R1312:Dusp27 UTSW 1 166099291 missense possibly damaging 0.46
R1572:Dusp27 UTSW 1 166099455 missense possibly damaging 0.68
R1598:Dusp27 UTSW 1 166110259 missense probably benign 0.10
R1858:Dusp27 UTSW 1 166100846 missense possibly damaging 0.87
R2021:Dusp27 UTSW 1 166100823 missense probably benign 0.00
R2970:Dusp27 UTSW 1 166099229 missense probably benign 0.04
R3727:Dusp27 UTSW 1 166099506 missense probably damaging 1.00
R4041:Dusp27 UTSW 1 166100111 missense probably benign 0.01
R4245:Dusp27 UTSW 1 166101116 missense probably damaging 1.00
R4955:Dusp27 UTSW 1 166108092 missense probably damaging 1.00
R4967:Dusp27 UTSW 1 166127106 missense probably damaging 1.00
R5040:Dusp27 UTSW 1 166100345 missense probably benign 0.17
R5342:Dusp27 UTSW 1 166110250 missense probably benign 0.01
R5467:Dusp27 UTSW 1 166112030 critical splice donor site probably null
R5742:Dusp27 UTSW 1 166099454 missense probably benign 0.00
R6222:Dusp27 UTSW 1 166098645 missense probably benign 0.26
R6239:Dusp27 UTSW 1 166098819 missense probably damaging 1.00
R6531:Dusp27 UTSW 1 166110046 splice site probably null
R6586:Dusp27 UTSW 1 166100885 missense possibly damaging 0.79
R6958:Dusp27 UTSW 1 166107996 missense probably damaging 1.00
R7006:Dusp27 UTSW 1 166099094 missense probably benign
R7111:Dusp27 UTSW 1 166127154 missense possibly damaging 0.66
R7310:Dusp27 UTSW 1 166098731 missense possibly damaging 0.46
R7312:Dusp27 UTSW 1 166127107 missense probably damaging 0.99
R7378:Dusp27 UTSW 1 166112063 nonsense probably null
R7398:Dusp27 UTSW 1 166100475 missense probably damaging 1.00
R7442:Dusp27 UTSW 1 166101015 missense probably benign 0.01
R7920:Dusp27 UTSW 1 166099896 missense possibly damaging 0.72
R7954:Dusp27 UTSW 1 166099280 missense probably benign 0.05
R7972:Dusp27 UTSW 1 166099139 missense probably damaging 1.00
R8186:Dusp27 UTSW 1 166100079 missense probably damaging 1.00
R8354:Dusp27 UTSW 1 166108133 missense probably damaging 1.00
R8454:Dusp27 UTSW 1 166108133 missense probably damaging 1.00
Z1088:Dusp27 UTSW 1 166099283 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTGCCCTTAATAGTGGC -3'
(R):5'- TGCCTCTTGTTCCAGAAGCG -3'

Sequencing Primer
(F):5'- CCTTAATAGTGGCCCACAGAGTG -3'
(R):5'- TTCCAGAAGCGTGGCTG -3'
Posted On2019-10-17