Incidental Mutation 'R7569:Sema6d'
ID585622
Institutional Source Beutler Lab
Gene Symbol Sema6d
Ensembl Gene ENSMUSG00000027200
Gene Namesema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D
SynonymsSema6D-6, 1110067B02Rik, Sema6D-1, Sema6D-2, Sema6D-4, Sema6D-5
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7569 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location124089969-124667770 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124657972 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 323 (I323V)
Ref Sequence ENSEMBL: ENSMUSP00000061123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051419] [ENSMUST00000076335] [ENSMUST00000077847] [ENSMUST00000078621] [ENSMUST00000103238] [ENSMUST00000103239] [ENSMUST00000103240] [ENSMUST00000103241]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051419
AA Change: I323V

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000061123
Gene: ENSMUSG00000027200
AA Change: I323V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 582 4.57e-1 SMART
transmembrane domain 602 624 N/A INTRINSIC
low complexity region 743 764 N/A INTRINSIC
internal_repeat_1 797 898 7.43e-5 PROSPERO
internal_repeat_1 892 1004 7.43e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000076335
AA Change: I323V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000075674
Gene: ENSMUSG00000027200
AA Change: I323V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
transmembrane domain 589 611 N/A INTRINSIC
low complexity region 730 751 N/A INTRINSIC
internal_repeat_1 784 885 7.28e-5 PROSPERO
internal_repeat_1 879 991 7.28e-5 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000077847
AA Change: I323V

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000077014
Gene: ENSMUSG00000027200
AA Change: I323V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
low complexity region 573 584 N/A INTRINSIC
transmembrane domain 645 667 N/A INTRINSIC
low complexity region 786 807 N/A INTRINSIC
internal_repeat_1 840 941 5.95e-5 PROSPERO
internal_repeat_1 935 1047 5.95e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000078621
AA Change: I323V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077691
Gene: ENSMUSG00000027200
AA Change: I323V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 582 4.57e-1 SMART
transmembrane domain 621 643 N/A INTRINSIC
low complexity region 762 783 N/A INTRINSIC
internal_repeat_1 816 917 8.83e-5 PROSPERO
internal_repeat_1 911 1023 8.83e-5 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000103238
AA Change: I323V

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099528
Gene: ENSMUSG00000027200
AA Change: I323V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
low complexity region 573 584 N/A INTRINSIC
transmembrane domain 645 667 N/A INTRINSIC
low complexity region 786 807 N/A INTRINSIC
internal_repeat_1 840 941 5.95e-5 PROSPERO
internal_repeat_1 935 1047 5.95e-5 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000103239
AA Change: I323V

PolyPhen 2 Score 0.825 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099529
Gene: ENSMUSG00000027200
AA Change: I323V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
low complexity region 587 603 N/A INTRINSIC
transmembrane domain 664 686 N/A INTRINSIC
low complexity region 805 826 N/A INTRINSIC
internal_repeat_1 859 960 5.78e-5 PROSPERO
internal_repeat_1 954 1066 5.78e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000103240
AA Change: I323V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099530
Gene: ENSMUSG00000027200
AA Change: I323V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
low complexity region 587 603 N/A INTRINSIC
transmembrane domain 660 682 N/A INTRINSIC
low complexity region 801 822 N/A INTRINSIC
internal_repeat_1 855 956 5.63e-5 PROSPERO
internal_repeat_1 950 1062 5.63e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000103241
AA Change: I323V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099531
Gene: ENSMUSG00000027200
AA Change: I323V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
transmembrane domain 589 611 N/A INTRINSIC
low complexity region 730 751 N/A INTRINSIC
internal_repeat_1 784 885 7.28e-5 PROSPERO
internal_repeat_1 879 991 7.28e-5 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Semaphorins are a large family, including both secreted and membrane associated proteins, many of which have been implicated as inhibitors or chemorepellents in axon pathfinding, fasciculation and branching, and target selection. All semaphorins possess a semaphorin (Sema) domain and a PSI domain (found in plexins, semaphorins and integrins) in the N-terminal extracellular portion. Additional sequence motifs C-terminal to the semaphorin domain allow classification into distinct subfamilies. Results demonstrate that transmembrane semaphorins, like the secreted ones, can act as repulsive axon guidance cues. This gene encodes a class 6 vertebrate transmembrane semaphorin that demonstrates alternative splicing. Several transcript variants have been identified and expression of the distinct encoded isoforms is thought to be regulated in a tissue- and development-dependent manner. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal dendritic cell trafficking and antigen-specific T cell priming. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
9330182O14Rik A T 15: 40,144,948 T73S unknown Het
Acvrl1 A G 15: 101,135,755 Q106R probably benign Het
Adgb A T 10: 10,431,252 D329E probably benign Het
Ankrd12 A T 17: 65,982,905 D1844E probably damaging Het
Ankub1 G A 3: 57,665,618 R228* probably null Het
Ascc2 G A 11: 4,679,506 V618M probably damaging Het
Asic3 A G 5: 24,414,048 T113A probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC034090 T A 1: 155,217,405 H769L probably benign Het
Bcl11a G T 11: 24,085,458 E65* probably null Het
Birc6 G T 17: 74,598,082 R1290L possibly damaging Het
C6 A G 15: 4,789,581 E465G probably benign Het
Cav2 T A 6: 17,282,079 I112N probably damaging Het
Cep131 G A 11: 120,066,713 A848V probably damaging Het
Col8a1 T A 16: 57,627,192 I652F unknown Het
Cul4a A G 8: 13,123,493 N180S probably benign Het
Dhx38 A G 8: 109,560,695 S214P probably damaging Het
Dmxl2 A G 9: 54,415,987 V1197A possibly damaging Het
Dusp27 T C 1: 166,108,035 D198G probably damaging Het
Dynlt1f A G 17: 6,655,782 S7P not run Het
Epha1 T A 6: 42,365,422 T331S possibly damaging Het
Gm10436 A T 12: 88,176,315 Y373N probably benign Het
Gm49333 T A 16: 20,642,487 Y641* probably null Het
Hus1b A G 13: 30,946,864 Y271H probably damaging Het
Kmt2b A G 7: 30,569,553 V2610A possibly damaging Het
Lama2 A G 10: 27,265,050 L651P probably damaging Het
Lgr5 T C 10: 115,462,756 Y361C probably damaging Het
Map1s T C 8: 70,913,498 V349A probably benign Het
Map3k6 A G 4: 133,250,077 R912G probably benign Het
Marc2 A T 1: 184,841,425 F92Y possibly damaging Het
Nampt T A 12: 32,850,434 H459Q probably benign Het
Nlrp1a T C 11: 71,109,043 M817V probably benign Het
Npsr1 A G 9: 24,313,730 R345G probably benign Het
Nuak2 G A 1: 132,316,281 A18T possibly damaging Het
Olfr1428 T C 19: 12,109,021 D175G possibly damaging Het
Olfr993 A G 2: 85,414,135 V248A probably damaging Het
Ppp4r3b T C 11: 29,188,540 F296S possibly damaging Het
Pycr2 T C 1: 180,904,518 F19L probably benign Het
Robo2 T A 16: 74,035,115 T226S possibly damaging Het
Rock1 A T 18: 10,140,194 N132K probably damaging Het
Rp1 A T 1: 4,284,840 L379Q unknown Het
Slc12a4 A G 8: 105,945,847 I814T probably damaging Het
Slc18a2 G A 19: 59,284,152 G352R probably damaging Het
Slc39a14 T C 14: 70,309,827 T357A possibly damaging Het
Smarcad1 T A 6: 65,052,711 D94E probably benign Het
Sorcs2 A G 5: 36,025,876 Y1018H probably benign Het
Srebf1 G T 11: 60,200,121 T1069K possibly damaging Het
St3gal3 A G 4: 117,964,356 V123A probably benign Het
Stradb A G 1: 58,991,151 Y188C unknown Het
Sult2a2 T C 7: 13,779,505 F186L probably benign Het
Syne2 A G 12: 75,927,390 T1120A probably benign Het
Taok1 A T 11: 77,555,614 S430T probably benign Het
Tmem62 A T 2: 121,006,930 I573L probably benign Het
Trav9-1 T C 14: 53,488,124 S7P probably benign Het
U2af1l4 A T 7: 30,563,557 I24F probably damaging Het
Usp33 T A 3: 152,391,665 I840N probably damaging Het
Vmn2r74 A C 7: 85,952,336 I698S probably damaging Het
Zfp352 C T 4: 90,223,659 P12L possibly damaging Het
Zfp507 T A 7: 35,794,544 E358V probably damaging Het
Other mutations in Sema6d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Sema6d APN 2 124659865 missense possibly damaging 0.91
IGL00508:Sema6d APN 2 124656924 splice site probably benign
IGL00710:Sema6d APN 2 124662288 missense probably benign 0.00
IGL00811:Sema6d APN 2 124658469 missense probably damaging 1.00
IGL01457:Sema6d APN 2 124653642 missense unknown
IGL01524:Sema6d APN 2 124664075 missense possibly damaging 0.86
IGL01598:Sema6d APN 2 124665098 missense probably damaging 1.00
IGL01915:Sema6d APN 2 124658571 splice site probably benign
IGL02365:Sema6d APN 2 124656868 missense probably benign 0.14
IGL02698:Sema6d APN 2 124653723 missense possibly damaging 0.95
IGL02865:Sema6d APN 2 124664073 missense probably damaging 1.00
IGL03018:Sema6d APN 2 124659600 missense possibly damaging 0.95
IGL03333:Sema6d APN 2 124664370 missense possibly damaging 0.83
R0269:Sema6d UTSW 2 124660745 missense possibly damaging 0.63
R0390:Sema6d UTSW 2 124658490 missense probably damaging 1.00
R0541:Sema6d UTSW 2 124665277 missense probably damaging 1.00
R0615:Sema6d UTSW 2 124654135 splice site probably benign
R0617:Sema6d UTSW 2 124660745 missense possibly damaging 0.63
R0694:Sema6d UTSW 2 124664041 missense probably damaging 1.00
R0854:Sema6d UTSW 2 124665302 missense probably damaging 0.97
R1630:Sema6d UTSW 2 124664345 missense possibly damaging 0.89
R1682:Sema6d UTSW 2 124665149 missense probably benign 0.21
R1823:Sema6d UTSW 2 124659556 splice site probably null
R1932:Sema6d UTSW 2 124659886 critical splice donor site probably null
R2249:Sema6d UTSW 2 124659588 missense possibly damaging 0.54
R2256:Sema6d UTSW 2 124664150 missense probably damaging 1.00
R2331:Sema6d UTSW 2 124658063 missense probably damaging 1.00
R2910:Sema6d UTSW 2 124665037 missense probably damaging 1.00
R3683:Sema6d UTSW 2 124654226 missense possibly damaging 0.88
R3937:Sema6d UTSW 2 124656850 missense probably benign 0.00
R4135:Sema6d UTSW 2 124664120 missense probably damaging 0.96
R4446:Sema6d UTSW 2 124664059 missense probably damaging 0.98
R4583:Sema6d UTSW 2 124664162 missense probably damaging 1.00
R4599:Sema6d UTSW 2 124654231 missense probably damaging 1.00
R4822:Sema6d UTSW 2 124662294 missense possibly damaging 0.79
R4884:Sema6d UTSW 2 124656818 splice site probably null
R5288:Sema6d UTSW 2 124664246 missense probably damaging 1.00
R5443:Sema6d UTSW 2 124656836 missense probably damaging 1.00
R5504:Sema6d UTSW 2 124658021 missense probably damaging 1.00
R5534:Sema6d UTSW 2 124659815 missense possibly damaging 0.75
R5615:Sema6d UTSW 2 124656901 missense probably damaging 0.97
R5747:Sema6d UTSW 2 124664947 missense probably damaging 0.99
R5866:Sema6d UTSW 2 124664342 missense probably benign 0.26
R5980:Sema6d UTSW 2 124664708 missense probably damaging 1.00
R6670:Sema6d UTSW 2 124654842 small deletion probably benign
R6803:Sema6d UTSW 2 124664050 missense probably damaging 0.96
R7023:Sema6d UTSW 2 124664911 missense probably damaging 1.00
R7068:Sema6d UTSW 2 124657821 missense probably benign
R7426:Sema6d UTSW 2 124654158 missense probably damaging 1.00
R7556:Sema6d UTSW 2 124654189 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGACGTCCTGCAGTCTATAAC -3'
(R):5'- AACATGTATTGGCCTCGGAGG -3'

Sequencing Primer
(F):5'- CAGACATAATCCAAATCAATGGCATC -3'
(R):5'- TGACAGATATTAAGATGGTCCTGATG -3'
Posted On2019-10-17