Incidental Mutation 'R7569:St3gal3'
ID585627
Institutional Source Beutler Lab
Gene Symbol St3gal3
Ensembl Gene ENSMUSG00000028538
Gene NameST3 beta-galactoside alpha-2,3-sialyltransferase 3
SynonymsSiat6, Siat3, ST3Gal III
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7569 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location117932154-118134914 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117964356 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 123 (V123A)
Ref Sequence ENSEMBL: ENSMUSP00000030263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030263] [ENSMUST00000097912] [ENSMUST00000106410] [ENSMUST00000126336]
Predicted Effect probably benign
Transcript: ENSMUST00000030263
AA Change: V123A

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000030263
Gene: ENSMUSG00000028538
AA Change: V123A

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 37 47 N/A INTRINSIC
Pfam:Glyco_transf_29 102 373 5.7e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097912
AA Change: V107A

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000095525
Gene: ENSMUSG00000028538
AA Change: V107A

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_transf_29 86 357 5.4e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106410
AA Change: V123A

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000102018
Gene: ENSMUSG00000028538
AA Change: V123A

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 37 47 N/A INTRINSIC
Pfam:Glyco_transf_29 106 372 4.7e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126336
AA Change: V17A

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000121051
Gene: ENSMUSG00000028538
AA Change: V17A

DomainStartEndE-ValueType
Pfam:Glyco_transf_29 1 159 4.9e-44 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000114444
Gene: ENSMUSG00000028538
AA Change: V68A

DomainStartEndE-ValueType
Pfam:Glyco_transf_29 52 264 4.8e-38 PFAM
Meta Mutation Damage Score 0.1206 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to galactose-containing substrates. The encoded protein is normally found in the Golgi apparatus but can be proteolytically processed to a soluble form. This protein is a member of glycosyltransferase family 29. Mutations in this gene have been associated with autosomal recessive nonsymdromic mental retardation-12 (MRT12). Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene show an apparently normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
9330182O14Rik A T 15: 40,144,948 T73S unknown Het
Acvrl1 A G 15: 101,135,755 Q106R probably benign Het
Adgb A T 10: 10,431,252 D329E probably benign Het
Ankrd12 A T 17: 65,982,905 D1844E probably damaging Het
Ankub1 G A 3: 57,665,618 R228* probably null Het
Apol6 A C 15: 77,050,698 probably benign Het
Ascc2 G A 11: 4,679,506 V618M probably damaging Het
Asic3 A G 5: 24,414,048 T113A probably benign Het
BC034090 T A 1: 155,217,405 H769L probably benign Het
Bcl11a G T 11: 24,085,458 E65* probably null Het
Birc6 G T 17: 74,598,082 R1290L possibly damaging Het
C6 A G 15: 4,789,581 E465G probably benign Het
Cav2 T A 6: 17,282,079 I112N probably damaging Het
Cep131 G A 11: 120,066,713 A848V probably damaging Het
Col8a1 T A 16: 57,627,192 I652F unknown Het
Cul4a A G 8: 13,123,493 N180S probably benign Het
Dhx38 A G 8: 109,560,695 S214P probably damaging Het
Dmxl2 A G 9: 54,415,987 V1197A possibly damaging Het
Dusp27 T C 1: 166,108,035 D198G probably damaging Het
Dynlt1f A G 17: 6,655,782 S7P not run Het
Epha1 T A 6: 42,365,422 T331S possibly damaging Het
Gm10436 A T 12: 88,176,315 Y373N probably benign Het
Gm49333 T A 16: 20,642,487 Y641* probably null Het
Hus1b A G 13: 30,946,864 Y271H probably damaging Het
Kmt2b A G 7: 30,569,553 V2610A possibly damaging Het
Lama2 A G 10: 27,265,050 L651P probably damaging Het
Lgr5 T C 10: 115,462,756 Y361C probably damaging Het
Map1s T C 8: 70,913,498 V349A probably benign Het
Map3k6 A G 4: 133,250,077 R912G probably benign Het
Marc2 A T 1: 184,841,425 F92Y possibly damaging Het
Nampt T A 12: 32,850,434 H459Q probably benign Het
Nlrp1a T C 11: 71,109,043 M817V probably benign Het
Npsr1 A G 9: 24,313,730 R345G probably benign Het
Nuak2 G A 1: 132,316,281 A18T possibly damaging Het
Olfr1428 T C 19: 12,109,021 D175G possibly damaging Het
Olfr993 A G 2: 85,414,135 V248A probably damaging Het
Ppp4r3b T C 11: 29,188,540 F296S possibly damaging Het
Pycr2 T C 1: 180,904,518 F19L probably benign Het
Robo2 T A 16: 74,035,115 T226S possibly damaging Het
Rock1 A T 18: 10,140,194 N132K probably damaging Het
Rp1 A T 1: 4,284,840 L379Q unknown Het
Sema6d A G 2: 124,657,972 I323V possibly damaging Het
Slc12a4 A G 8: 105,945,847 I814T probably damaging Het
Slc18a2 G A 19: 59,284,152 G352R probably damaging Het
Slc39a14 T C 14: 70,309,827 T357A possibly damaging Het
Smarcad1 T A 6: 65,052,711 D94E probably benign Het
Sorcs2 A G 5: 36,025,876 Y1018H probably benign Het
Srebf1 G T 11: 60,200,121 T1069K possibly damaging Het
Stradb A G 1: 58,991,151 Y188C unknown Het
Sult2a2 T C 7: 13,779,505 F186L probably benign Het
Syne2 A G 12: 75,927,390 T1120A probably benign Het
Taok1 A T 11: 77,555,614 S430T probably benign Het
Tmem62 A T 2: 121,006,930 I573L probably benign Het
Trav9-1 T C 14: 53,488,124 S7P probably benign Het
U2af1l4 A T 7: 30,563,557 I24F probably damaging Het
Usp33 T A 3: 152,391,665 I840N probably damaging Het
Vmn2r74 A C 7: 85,952,336 I698S probably damaging Het
Zfp352 C T 4: 90,223,659 P12L possibly damaging Het
Zfp507 T A 7: 35,794,544 E358V probably damaging Het
Other mutations in St3gal3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:St3gal3 APN 4 118031875 missense probably damaging 1.00
IGL02004:St3gal3 APN 4 117960039 missense possibly damaging 0.90
IGL02339:St3gal3 APN 4 117958562 missense probably damaging 1.00
IGL03186:St3gal3 APN 4 117940054 missense possibly damaging 0.93
giovanni UTSW 4 117960007 missense possibly damaging 0.84
Leporello UTSW 4 117957436 missense
R0598:St3gal3 UTSW 4 118107632 missense probably benign 0.38
R1466:St3gal3 UTSW 4 118107662 start codon destroyed probably null
R1466:St3gal3 UTSW 4 118107662 start codon destroyed probably null
R1474:St3gal3 UTSW 4 118014786 missense probably damaging 1.00
R1584:St3gal3 UTSW 4 118107662 start codon destroyed probably null
R1585:St3gal3 UTSW 4 117960007 missense possibly damaging 0.84
R1696:St3gal3 UTSW 4 117940392 missense possibly damaging 0.52
R1735:St3gal3 UTSW 4 118014774 missense probably damaging 1.00
R1958:St3gal3 UTSW 4 117940071 missense probably damaging 0.96
R4008:St3gal3 UTSW 4 117940440 missense probably benign 0.34
R4700:St3gal3 UTSW 4 117960035 missense probably benign 0.01
R5434:St3gal3 UTSW 4 117940050 missense probably damaging 1.00
R6257:St3gal3 UTSW 4 118107678 start gained probably benign
R6854:St3gal3 UTSW 4 117958530 missense probably benign 0.00
R7218:St3gal3 UTSW 4 117957442 missense
R7304:St3gal3 UTSW 4 117957436 missense
R7783:St3gal3 UTSW 4 117940123 missense probably benign 0.07
R8202:St3gal3 UTSW 4 118107671 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGCTCTGGGAAGTGCAAGAC -3'
(R):5'- AGCTACCCAGTTAACAGGCTG -3'

Sequencing Primer
(F):5'- GAGACAGGGTTCCATCATGTAACTC -3'
(R):5'- CCAGTTAACAGGCTGGTGGG -3'
Posted On2019-10-17