Incidental Mutation 'R7569:Zfp507'
ID 585637
Institutional Source Beutler Lab
Gene Symbol Zfp507
Ensembl Gene ENSMUSG00000044452
Gene Name zinc finger protein 507
Synonyms A230056M16Rik, 1810022O10Rik
MMRRC Submission 045657-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.190) question?
Stock # R7569 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 35471768-35502428 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 35493969 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 358 (E358V)
Ref Sequence ENSEMBL: ENSMUSP00000058609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061586] [ENSMUST00000187282] [ENSMUST00000205670] [ENSMUST00000206615]
AlphaFold Q6ZPY5
Predicted Effect probably damaging
Transcript: ENSMUST00000061586
AA Change: E358V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000058609
Gene: ENSMUSG00000044452
AA Change: E358V

DomainStartEndE-ValueType
ZnF_C2H2 122 144 1.56e-2 SMART
ZnF_C2H2 152 175 2.49e-1 SMART
low complexity region 178 192 N/A INTRINSIC
ZnF_C2H2 237 259 8.52e0 SMART
ZnF_C2H2 630 652 2.75e-3 SMART
ZnF_C2H2 658 680 1.26e-2 SMART
ZnF_C2H2 686 709 5.42e-2 SMART
ZnF_C2H2 746 768 4.79e-3 SMART
ZnF_C2H2 774 796 1.45e-2 SMART
ZnF_C2H2 899 921 3.83e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187282
SMART Domains Protein: ENSMUSP00000140940
Gene: ENSMUSG00000044452

DomainStartEndE-ValueType
ZnF_C2H2 107 129 1.6e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000205670
Predicted Effect probably benign
Transcript: ENSMUST00000206615
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182O14Rik A T 15: 40,008,344 (GRCm39) T73S unknown Het
Acvrl1 A G 15: 101,033,636 (GRCm39) Q106R probably benign Het
Adgb A T 10: 10,306,996 (GRCm39) D329E probably benign Het
Ankrd12 A T 17: 66,289,900 (GRCm39) D1844E probably damaging Het
Ankub1 G A 3: 57,573,039 (GRCm39) R228* probably null Het
Apol6 A C 15: 76,934,898 (GRCm39) probably benign Het
Ascc2 G A 11: 4,629,506 (GRCm39) V618M probably damaging Het
Asic3 A G 5: 24,619,046 (GRCm39) T113A probably benign Het
BC034090 T A 1: 155,093,151 (GRCm39) H769L probably benign Het
Bcl11a G T 11: 24,035,458 (GRCm39) E65* probably null Het
Birc6 G T 17: 74,905,077 (GRCm39) R1290L possibly damaging Het
C6 A G 15: 4,819,063 (GRCm39) E465G probably benign Het
Cav2 T A 6: 17,282,078 (GRCm39) I112N probably damaging Het
Cep131 G A 11: 119,957,539 (GRCm39) A848V probably damaging Het
Col8a1 T A 16: 57,447,555 (GRCm39) I652F unknown Het
Cul4a A G 8: 13,173,493 (GRCm39) N180S probably benign Het
Dhx38 A G 8: 110,287,327 (GRCm39) S214P probably damaging Het
Dmxl2 A G 9: 54,323,271 (GRCm39) V1197A possibly damaging Het
Dynlt1f A G 17: 6,923,181 (GRCm39) S7P not run Het
Eef1ece2 T A 16: 20,461,237 (GRCm39) Y641* probably null Het
Epha1 T A 6: 42,342,356 (GRCm39) T331S possibly damaging Het
Hus1b A G 13: 31,130,847 (GRCm39) Y271H probably damaging Het
Kmt2b A G 7: 30,268,978 (GRCm39) V2610A possibly damaging Het
Lama2 A G 10: 27,141,046 (GRCm39) L651P probably damaging Het
Lgr5 T C 10: 115,298,661 (GRCm39) Y361C probably damaging Het
Map1s T C 8: 71,366,142 (GRCm39) V349A probably benign Het
Map3k6 A G 4: 132,977,388 (GRCm39) R912G probably benign Het
Mtarc2 A T 1: 184,573,622 (GRCm39) F92Y possibly damaging Het
Nampt T A 12: 32,900,433 (GRCm39) H459Q probably benign Het
Nlrp1a T C 11: 70,999,869 (GRCm39) M817V probably benign Het
Npsr1 A G 9: 24,225,026 (GRCm39) R345G probably benign Het
Nuak2 G A 1: 132,244,019 (GRCm39) A18T possibly damaging Het
Or4d6 T C 19: 12,086,385 (GRCm39) D175G possibly damaging Het
Or5ak23 A G 2: 85,244,479 (GRCm39) V248A probably damaging Het
Pierce1 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,356,122 (GRCm39) probably benign Het
Ppp4r3b T C 11: 29,138,540 (GRCm39) F296S possibly damaging Het
Pramel51 A T 12: 88,143,085 (GRCm39) Y373N probably benign Het
Pycr2 T C 1: 180,732,083 (GRCm39) F19L probably benign Het
Robo2 T A 16: 73,832,003 (GRCm39) T226S possibly damaging Het
Rock1 A T 18: 10,140,194 (GRCm39) N132K probably damaging Het
Rp1 A T 1: 4,355,063 (GRCm39) L379Q unknown Het
Sema6d A G 2: 124,499,892 (GRCm39) I323V possibly damaging Het
Slc12a4 A G 8: 106,672,479 (GRCm39) I814T probably damaging Het
Slc18a2 G A 19: 59,272,584 (GRCm39) G352R probably damaging Het
Slc39a14 T C 14: 70,547,276 (GRCm39) T357A possibly damaging Het
Smarcad1 T A 6: 65,029,695 (GRCm39) D94E probably benign Het
Sorcs2 A G 5: 36,183,220 (GRCm39) Y1018H probably benign Het
Srebf1 G T 11: 60,090,947 (GRCm39) T1069K possibly damaging Het
St3gal3 A G 4: 117,821,553 (GRCm39) V123A probably benign Het
Stradb A G 1: 59,030,310 (GRCm39) Y188C unknown Het
Styxl2 T C 1: 165,935,604 (GRCm39) D198G probably damaging Het
Sult2a2 T C 7: 13,513,430 (GRCm39) F186L probably benign Het
Syne2 A G 12: 75,974,164 (GRCm39) T1120A probably benign Het
Taok1 A T 11: 77,446,440 (GRCm39) S430T probably benign Het
Tmem62 A T 2: 120,837,411 (GRCm39) I573L probably benign Het
Trav9-1 T C 14: 53,725,581 (GRCm39) S7P probably benign Het
U2af1l4 A T 7: 30,262,982 (GRCm39) I24F probably damaging Het
Usp33 T A 3: 152,097,302 (GRCm39) I840N probably damaging Het
Vmn2r74 A C 7: 85,601,544 (GRCm39) I698S probably damaging Het
Zfp352 C T 4: 90,111,896 (GRCm39) P12L possibly damaging Het
Other mutations in Zfp507
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Zfp507 APN 7 35,494,137 (GRCm39) missense possibly damaging 0.93
IGL00835:Zfp507 APN 7 35,475,463 (GRCm39) missense probably damaging 1.00
IGL01083:Zfp507 APN 7 35,493,463 (GRCm39) missense probably benign 0.00
IGL01359:Zfp507 APN 7 35,493,927 (GRCm39) missense probably damaging 1.00
IGL01418:Zfp507 APN 7 35,493,237 (GRCm39) splice site probably null
IGL02122:Zfp507 APN 7 35,475,520 (GRCm39) missense probably damaging 1.00
IGL02506:Zfp507 APN 7 35,475,891 (GRCm39) missense probably damaging 1.00
IGL02601:Zfp507 APN 7 35,491,136 (GRCm39) missense probably damaging 1.00
IGL02643:Zfp507 APN 7 35,494,656 (GRCm39) missense probably damaging 0.99
IGL03129:Zfp507 APN 7 35,493,631 (GRCm39) missense probably damaging 1.00
R0400:Zfp507 UTSW 7 35,491,171 (GRCm39) missense probably damaging 1.00
R0812:Zfp507 UTSW 7 35,502,048 (GRCm39) intron probably benign
R1183:Zfp507 UTSW 7 35,494,315 (GRCm39) missense probably damaging 0.99
R1381:Zfp507 UTSW 7 35,475,435 (GRCm39) missense possibly damaging 0.91
R1542:Zfp507 UTSW 7 35,494,226 (GRCm39) missense possibly damaging 0.71
R1626:Zfp507 UTSW 7 35,494,858 (GRCm39) missense probably damaging 1.00
R1759:Zfp507 UTSW 7 35,475,403 (GRCm39) missense probably damaging 0.99
R1843:Zfp507 UTSW 7 35,493,150 (GRCm39) missense probably damaging 0.97
R1852:Zfp507 UTSW 7 35,487,176 (GRCm39) missense probably damaging 1.00
R1893:Zfp507 UTSW 7 35,502,052 (GRCm39) intron probably benign
R1923:Zfp507 UTSW 7 35,493,150 (GRCm39) missense probably damaging 0.97
R1925:Zfp507 UTSW 7 35,493,150 (GRCm39) missense probably damaging 0.97
R1927:Zfp507 UTSW 7 35,493,150 (GRCm39) missense probably damaging 0.97
R2139:Zfp507 UTSW 7 35,493,148 (GRCm39) missense probably damaging 1.00
R2191:Zfp507 UTSW 7 35,494,268 (GRCm39) missense probably damaging 1.00
R2431:Zfp507 UTSW 7 35,494,827 (GRCm39) missense probably benign 0.08
R2921:Zfp507 UTSW 7 35,494,224 (GRCm39) missense probably damaging 1.00
R2922:Zfp507 UTSW 7 35,494,224 (GRCm39) missense probably damaging 1.00
R3436:Zfp507 UTSW 7 35,487,195 (GRCm39) missense probably damaging 1.00
R4483:Zfp507 UTSW 7 35,487,141 (GRCm39) critical splice donor site probably null
R4751:Zfp507 UTSW 7 35,493,807 (GRCm39) missense probably damaging 0.99
R4852:Zfp507 UTSW 7 35,493,480 (GRCm39) missense probably benign 0.01
R5298:Zfp507 UTSW 7 35,475,421 (GRCm39) missense probably damaging 0.99
R5602:Zfp507 UTSW 7 35,475,663 (GRCm39) nonsense probably null
R5707:Zfp507 UTSW 7 35,493,588 (GRCm39) missense probably damaging 1.00
R5785:Zfp507 UTSW 7 35,487,167 (GRCm39) missense probably benign 0.20
R6140:Zfp507 UTSW 7 35,493,613 (GRCm39) missense probably damaging 1.00
R6674:Zfp507 UTSW 7 35,494,159 (GRCm39) missense probably damaging 0.98
R6714:Zfp507 UTSW 7 35,487,152 (GRCm39) missense probably damaging 0.99
R7045:Zfp507 UTSW 7 35,494,978 (GRCm39) missense possibly damaging 0.56
R7334:Zfp507 UTSW 7 35,475,505 (GRCm39) missense probably damaging 1.00
R7365:Zfp507 UTSW 7 35,475,843 (GRCm39) missense unknown
R7662:Zfp507 UTSW 7 35,487,229 (GRCm39) nonsense probably null
R7846:Zfp507 UTSW 7 35,493,963 (GRCm39) missense probably damaging 1.00
R9100:Zfp507 UTSW 7 35,494,446 (GRCm39) missense probably benign 0.39
R9136:Zfp507 UTSW 7 35,475,883 (GRCm39) missense probably damaging 0.96
R9513:Zfp507 UTSW 7 35,475,573 (GRCm39) missense probably benign 0.00
Z1088:Zfp507 UTSW 7 35,493,702 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGCTCCAGCCGATGATCAAC -3'
(R):5'- AGCTGAGCATCCACAATGGG -3'

Sequencing Primer
(F):5'- CAACAGTACATTTATCAGCATGGTAC -3'
(R):5'- ATGGGCCATCTGTACAAGTAC -3'
Posted On 2019-10-17