Incidental Mutation 'R7569:Zfp507'
ID585637
Institutional Source Beutler Lab
Gene Symbol Zfp507
Ensembl Gene ENSMUSG00000044452
Gene Namezinc finger protein 507
Synonyms1810022O10Rik, A230056M16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.345) question?
Stock #R7569 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location35772343-35803003 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35794544 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 358 (E358V)
Ref Sequence ENSEMBL: ENSMUSP00000058609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061586] [ENSMUST00000187282] [ENSMUST00000205670] [ENSMUST00000206615]
Predicted Effect probably damaging
Transcript: ENSMUST00000061586
AA Change: E358V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000058609
Gene: ENSMUSG00000044452
AA Change: E358V

DomainStartEndE-ValueType
ZnF_C2H2 122 144 1.56e-2 SMART
ZnF_C2H2 152 175 2.49e-1 SMART
low complexity region 178 192 N/A INTRINSIC
ZnF_C2H2 237 259 8.52e0 SMART
ZnF_C2H2 630 652 2.75e-3 SMART
ZnF_C2H2 658 680 1.26e-2 SMART
ZnF_C2H2 686 709 5.42e-2 SMART
ZnF_C2H2 746 768 4.79e-3 SMART
ZnF_C2H2 774 796 1.45e-2 SMART
ZnF_C2H2 899 921 3.83e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187282
SMART Domains Protein: ENSMUSP00000140940
Gene: ENSMUSG00000044452

DomainStartEndE-ValueType
ZnF_C2H2 107 129 1.6e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000205670
Predicted Effect probably benign
Transcript: ENSMUST00000206615
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
9330182O14Rik A T 15: 40,144,948 T73S unknown Het
Acvrl1 A G 15: 101,135,755 Q106R probably benign Het
Adgb A T 10: 10,431,252 D329E probably benign Het
Ankrd12 A T 17: 65,982,905 D1844E probably damaging Het
Ankub1 G A 3: 57,665,618 R228* probably null Het
Apol6 A C 15: 77,050,698 probably benign Het
Ascc2 G A 11: 4,679,506 V618M probably damaging Het
Asic3 A G 5: 24,414,048 T113A probably benign Het
BC034090 T A 1: 155,217,405 H769L probably benign Het
Bcl11a G T 11: 24,085,458 E65* probably null Het
Birc6 G T 17: 74,598,082 R1290L possibly damaging Het
C6 A G 15: 4,789,581 E465G probably benign Het
Cav2 T A 6: 17,282,079 I112N probably damaging Het
Cep131 G A 11: 120,066,713 A848V probably damaging Het
Col8a1 T A 16: 57,627,192 I652F unknown Het
Cul4a A G 8: 13,123,493 N180S probably benign Het
Dhx38 A G 8: 109,560,695 S214P probably damaging Het
Dmxl2 A G 9: 54,415,987 V1197A possibly damaging Het
Dusp27 T C 1: 166,108,035 D198G probably damaging Het
Dynlt1f A G 17: 6,655,782 S7P not run Het
Epha1 T A 6: 42,365,422 T331S possibly damaging Het
Gm10436 A T 12: 88,176,315 Y373N probably benign Het
Gm49333 T A 16: 20,642,487 Y641* probably null Het
Hus1b A G 13: 30,946,864 Y271H probably damaging Het
Kmt2b A G 7: 30,569,553 V2610A possibly damaging Het
Lama2 A G 10: 27,265,050 L651P probably damaging Het
Lgr5 T C 10: 115,462,756 Y361C probably damaging Het
Map1s T C 8: 70,913,498 V349A probably benign Het
Map3k6 A G 4: 133,250,077 R912G probably benign Het
Marc2 A T 1: 184,841,425 F92Y possibly damaging Het
Nampt T A 12: 32,850,434 H459Q probably benign Het
Nlrp1a T C 11: 71,109,043 M817V probably benign Het
Npsr1 A G 9: 24,313,730 R345G probably benign Het
Nuak2 G A 1: 132,316,281 A18T possibly damaging Het
Olfr1428 T C 19: 12,109,021 D175G possibly damaging Het
Olfr993 A G 2: 85,414,135 V248A probably damaging Het
Ppp4r3b T C 11: 29,188,540 F296S possibly damaging Het
Pycr2 T C 1: 180,904,518 F19L probably benign Het
Robo2 T A 16: 74,035,115 T226S possibly damaging Het
Rock1 A T 18: 10,140,194 N132K probably damaging Het
Rp1 A T 1: 4,284,840 L379Q unknown Het
Sema6d A G 2: 124,657,972 I323V possibly damaging Het
Slc12a4 A G 8: 105,945,847 I814T probably damaging Het
Slc18a2 G A 19: 59,284,152 G352R probably damaging Het
Slc39a14 T C 14: 70,309,827 T357A possibly damaging Het
Smarcad1 T A 6: 65,052,711 D94E probably benign Het
Sorcs2 A G 5: 36,025,876 Y1018H probably benign Het
Srebf1 G T 11: 60,200,121 T1069K possibly damaging Het
St3gal3 A G 4: 117,964,356 V123A probably benign Het
Stradb A G 1: 58,991,151 Y188C unknown Het
Sult2a2 T C 7: 13,779,505 F186L probably benign Het
Syne2 A G 12: 75,927,390 T1120A probably benign Het
Taok1 A T 11: 77,555,614 S430T probably benign Het
Tmem62 A T 2: 121,006,930 I573L probably benign Het
Trav9-1 T C 14: 53,488,124 S7P probably benign Het
U2af1l4 A T 7: 30,563,557 I24F probably damaging Het
Usp33 T A 3: 152,391,665 I840N probably damaging Het
Vmn2r74 A C 7: 85,952,336 I698S probably damaging Het
Zfp352 C T 4: 90,223,659 P12L possibly damaging Het
Other mutations in Zfp507
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Zfp507 APN 7 35794712 missense possibly damaging 0.93
IGL00835:Zfp507 APN 7 35776038 missense probably damaging 1.00
IGL01083:Zfp507 APN 7 35794038 missense probably benign 0.00
IGL01359:Zfp507 APN 7 35794502 missense probably damaging 1.00
IGL01418:Zfp507 APN 7 35793812 intron probably null
IGL02122:Zfp507 APN 7 35776095 missense probably damaging 1.00
IGL02506:Zfp507 APN 7 35776466 missense probably damaging 1.00
IGL02601:Zfp507 APN 7 35791711 missense probably damaging 1.00
IGL02643:Zfp507 APN 7 35795231 missense probably damaging 0.99
IGL03129:Zfp507 APN 7 35794206 missense probably damaging 1.00
R0400:Zfp507 UTSW 7 35791746 missense probably damaging 1.00
R0812:Zfp507 UTSW 7 35802623 intron probably benign
R1183:Zfp507 UTSW 7 35794890 missense probably damaging 0.99
R1381:Zfp507 UTSW 7 35776010 missense possibly damaging 0.91
R1542:Zfp507 UTSW 7 35794801 missense possibly damaging 0.71
R1626:Zfp507 UTSW 7 35795433 missense probably damaging 1.00
R1759:Zfp507 UTSW 7 35775978 missense probably damaging 0.99
R1843:Zfp507 UTSW 7 35793725 missense probably damaging 0.97
R1852:Zfp507 UTSW 7 35787751 missense probably damaging 1.00
R1893:Zfp507 UTSW 7 35802627 intron probably benign
R1923:Zfp507 UTSW 7 35793725 missense probably damaging 0.97
R1925:Zfp507 UTSW 7 35793725 missense probably damaging 0.97
R1927:Zfp507 UTSW 7 35793725 missense probably damaging 0.97
R2139:Zfp507 UTSW 7 35793723 missense probably damaging 1.00
R2191:Zfp507 UTSW 7 35794843 missense probably damaging 1.00
R2431:Zfp507 UTSW 7 35795402 missense probably benign 0.08
R2921:Zfp507 UTSW 7 35794799 missense probably damaging 1.00
R2922:Zfp507 UTSW 7 35794799 missense probably damaging 1.00
R3436:Zfp507 UTSW 7 35787770 missense probably damaging 1.00
R4483:Zfp507 UTSW 7 35787716 critical splice donor site probably null
R4751:Zfp507 UTSW 7 35794382 missense probably damaging 0.99
R4852:Zfp507 UTSW 7 35794055 missense probably benign 0.01
R5298:Zfp507 UTSW 7 35775996 missense probably damaging 0.99
R5602:Zfp507 UTSW 7 35776238 nonsense probably null
R5707:Zfp507 UTSW 7 35794163 missense probably damaging 1.00
R5785:Zfp507 UTSW 7 35787742 missense probably benign 0.20
R6140:Zfp507 UTSW 7 35794188 missense probably damaging 1.00
R6674:Zfp507 UTSW 7 35794734 missense probably damaging 0.98
R6714:Zfp507 UTSW 7 35787727 missense probably damaging 0.99
R7045:Zfp507 UTSW 7 35795553 missense possibly damaging 0.56
R7334:Zfp507 UTSW 7 35776080 missense probably damaging 1.00
R7365:Zfp507 UTSW 7 35776418 missense unknown
R7662:Zfp507 UTSW 7 35787804 nonsense probably null
R7846:Zfp507 UTSW 7 35794538 missense probably damaging 1.00
R7929:Zfp507 UTSW 7 35794538 missense probably damaging 1.00
Z1088:Zfp507 UTSW 7 35794277 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGCTCCAGCCGATGATCAAC -3'
(R):5'- AGCTGAGCATCCACAATGGG -3'

Sequencing Primer
(F):5'- CAACAGTACATTTATCAGCATGGTAC -3'
(R):5'- ATGGGCCATCTGTACAAGTAC -3'
Posted On2019-10-17