Incidental Mutation 'R7569:Cul4a'
ID585639
Institutional Source Beutler Lab
Gene Symbol Cul4a
Ensembl Gene ENSMUSG00000031446
Gene Namecullin 4A
Synonyms2810470J21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.618) question?
Stock #R7569 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location13105621-13147940 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13123493 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 180 (N180S)
Ref Sequence ENSEMBL: ENSMUSP00000016680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016680] [ENSMUST00000121426] [ENSMUST00000125514]
Predicted Effect probably benign
Transcript: ENSMUST00000016680
AA Change: N180S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000016680
Gene: ENSMUSG00000031446
AA Change: N180S

DomainStartEndE-ValueType
low complexity region 20 39 N/A INTRINSIC
SCOP:d1ldja2 61 401 1e-118 SMART
Blast:CULLIN 83 151 5e-9 BLAST
CULLIN 434 582 1.6e-76 SMART
Blast:CULLIN 585 640 7e-28 BLAST
Cullin_Nedd8 688 753 8.29e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121426
AA Change: N180S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112525
Gene: ENSMUSG00000031446
AA Change: N180S

DomainStartEndE-ValueType
low complexity region 20 39 N/A INTRINSIC
Pfam:Cullin 63 259 3.1e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125514
SMART Domains Protein: ENSMUSP00000123074
Gene: ENSMUSG00000031446

DomainStartEndE-ValueType
Pfam:Cullin 1 68 5.6e-13 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CUL4A is the ubiquitin ligase component of a multimeric complex involved in the degradation of DNA damage-response proteins (Liu et al., 2009 [PubMed 19481525]).[supplied by OMIM, Oct 2009]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit reduced female fertility, male infertility, impaired spermatogenesis, and impaired DNA repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
9330182O14Rik A T 15: 40,144,948 T73S unknown Het
Acvrl1 A G 15: 101,135,755 Q106R probably benign Het
Adgb A T 10: 10,431,252 D329E probably benign Het
Ankrd12 A T 17: 65,982,905 D1844E probably damaging Het
Ankub1 G A 3: 57,665,618 R228* probably null Het
Apol6 A C 15: 77,050,698 probably benign Het
Ascc2 G A 11: 4,679,506 V618M probably damaging Het
Asic3 A G 5: 24,414,048 T113A probably benign Het
BC034090 T A 1: 155,217,405 H769L probably benign Het
Bcl11a G T 11: 24,085,458 E65* probably null Het
Birc6 G T 17: 74,598,082 R1290L possibly damaging Het
C6 A G 15: 4,789,581 E465G probably benign Het
Cav2 T A 6: 17,282,079 I112N probably damaging Het
Cep131 G A 11: 120,066,713 A848V probably damaging Het
Col8a1 T A 16: 57,627,192 I652F unknown Het
Dhx38 A G 8: 109,560,695 S214P probably damaging Het
Dmxl2 A G 9: 54,415,987 V1197A possibly damaging Het
Dusp27 T C 1: 166,108,035 D198G probably damaging Het
Dynlt1f A G 17: 6,655,782 S7P not run Het
Epha1 T A 6: 42,365,422 T331S possibly damaging Het
Gm10436 A T 12: 88,176,315 Y373N probably benign Het
Gm49333 T A 16: 20,642,487 Y641* probably null Het
Hus1b A G 13: 30,946,864 Y271H probably damaging Het
Kmt2b A G 7: 30,569,553 V2610A possibly damaging Het
Lama2 A G 10: 27,265,050 L651P probably damaging Het
Lgr5 T C 10: 115,462,756 Y361C probably damaging Het
Map1s T C 8: 70,913,498 V349A probably benign Het
Map3k6 A G 4: 133,250,077 R912G probably benign Het
Marc2 A T 1: 184,841,425 F92Y possibly damaging Het
Nampt T A 12: 32,850,434 H459Q probably benign Het
Nlrp1a T C 11: 71,109,043 M817V probably benign Het
Npsr1 A G 9: 24,313,730 R345G probably benign Het
Nuak2 G A 1: 132,316,281 A18T possibly damaging Het
Olfr1428 T C 19: 12,109,021 D175G possibly damaging Het
Olfr993 A G 2: 85,414,135 V248A probably damaging Het
Ppp4r3b T C 11: 29,188,540 F296S possibly damaging Het
Pycr2 T C 1: 180,904,518 F19L probably benign Het
Robo2 T A 16: 74,035,115 T226S possibly damaging Het
Rock1 A T 18: 10,140,194 N132K probably damaging Het
Rp1 A T 1: 4,284,840 L379Q unknown Het
Sema6d A G 2: 124,657,972 I323V possibly damaging Het
Slc12a4 A G 8: 105,945,847 I814T probably damaging Het
Slc18a2 G A 19: 59,284,152 G352R probably damaging Het
Slc39a14 T C 14: 70,309,827 T357A possibly damaging Het
Smarcad1 T A 6: 65,052,711 D94E probably benign Het
Sorcs2 A G 5: 36,025,876 Y1018H probably benign Het
Srebf1 G T 11: 60,200,121 T1069K possibly damaging Het
St3gal3 A G 4: 117,964,356 V123A probably benign Het
Stradb A G 1: 58,991,151 Y188C unknown Het
Sult2a2 T C 7: 13,779,505 F186L probably benign Het
Syne2 A G 12: 75,927,390 T1120A probably benign Het
Taok1 A T 11: 77,555,614 S430T probably benign Het
Tmem62 A T 2: 121,006,930 I573L probably benign Het
Trav9-1 T C 14: 53,488,124 S7P probably benign Het
U2af1l4 A T 7: 30,563,557 I24F probably damaging Het
Usp33 T A 3: 152,391,665 I840N probably damaging Het
Vmn2r74 A C 7: 85,952,336 I698S probably damaging Het
Zfp352 C T 4: 90,223,659 P12L possibly damaging Het
Zfp507 T A 7: 35,794,544 E358V probably damaging Het
Other mutations in Cul4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00720:Cul4a APN 8 13127735 missense probably benign 0.18
IGL00952:Cul4a APN 8 13146562 missense probably damaging 1.00
IGL01604:Cul4a APN 8 13133843 critical splice donor site probably null
IGL01688:Cul4a APN 8 13146571 nonsense probably null
IGL02167:Cul4a APN 8 13122826 missense probably damaging 1.00
IGL02927:Cul4a APN 8 13124861 missense possibly damaging 0.55
IGL03066:Cul4a APN 8 13133776 missense probably benign 0.22
R0183:Cul4a UTSW 8 13133790 missense probably damaging 0.98
R1600:Cul4a UTSW 8 13123954 missense probably damaging 1.00
R1860:Cul4a UTSW 8 13123565 missense probably damaging 1.00
R1865:Cul4a UTSW 8 13142589 missense possibly damaging 0.94
R1905:Cul4a UTSW 8 13133171 missense probably benign 0.06
R1964:Cul4a UTSW 8 13136406 missense possibly damaging 0.62
R1964:Cul4a UTSW 8 13136854 missense probably benign 0.00
R2381:Cul4a UTSW 8 13136887 missense probably benign 0.45
R3787:Cul4a UTSW 8 13133668 missense probably damaging 0.99
R4006:Cul4a UTSW 8 13122859 missense probably benign 0.04
R4007:Cul4a UTSW 8 13122859 missense probably benign 0.04
R4748:Cul4a UTSW 8 13123526 missense probably benign 0.06
R5244:Cul4a UTSW 8 13146566 missense probably damaging 1.00
R6389:Cul4a UTSW 8 13140278 missense probably benign
R6736:Cul4a UTSW 8 13136219 missense probably benign 0.00
R7201:Cul4a UTSW 8 13142991 missense probably damaging 0.98
R7313:Cul4a UTSW 8 13121676 critical splice acceptor site probably benign
R7446:Cul4a UTSW 8 13136874 missense probably benign
R7485:Cul4a UTSW 8 13140279 missense possibly damaging 0.68
R8219:Cul4a UTSW 8 13146540 missense possibly damaging 0.91
R8304:Cul4a UTSW 8 13127727 missense possibly damaging 0.88
X0026:Cul4a UTSW 8 13105871 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- GTAGAGGCATAAACATCCTGGAC -3'
(R):5'- AGTCCCCACTTACAGCTCTG -3'

Sequencing Primer
(F):5'- GCATAAACATCCTGGACTGGCC -3'
(R):5'- GCCTTTACTTTGGCGCAAG -3'
Posted On2019-10-17