Incidental Mutation 'R7569:Npsr1'
ID585643
Institutional Source Beutler Lab
Gene Symbol Npsr1
Ensembl Gene ENSMUSG00000043659
Gene Nameneuropeptide S receptor 1
SynonymsVRR1, PGR14, 9330128H10Rik, Gpr154
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R7569 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location24097996-24316398 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24313730 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 345 (R345G)
Ref Sequence ENSEMBL: ENSMUSP00000056432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059650] [ENSMUST00000154644]
Predicted Effect probably benign
Transcript: ENSMUST00000059650
AA Change: R345G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000056432
Gene: ENSMUSG00000043659
AA Change: R345G

DomainStartEndE-ValueType
Pfam:7tm_1 66 330 1.4e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154644
SMART Domains Protein: ENSMUSP00000115126
Gene: ENSMUSG00000043659

DomainStartEndE-ValueType
Pfam:7tm_1 2 177 2.7e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vasopressin/oxytocin subfamily of G protein-coupled receptors. The encoded membrane protein acts as a receptor for neuropeptide S and affects a variety of cellular processes through its signaling. Increased expression of this gene in ciliated cells of the respiratory epithelium and in bronchial smooth muscle cells is associated with asthma. Polymorphisms in this gene have also been associated with asthma susceptibility, panic disorders, inflammatory bowel disease, and rheumatoid arthritis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased airway resistance when treated with high concentrations of U-46619. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
9330182O14Rik A T 15: 40,144,948 T73S unknown Het
Acvrl1 A G 15: 101,135,755 Q106R probably benign Het
Adgb A T 10: 10,431,252 D329E probably benign Het
Ankrd12 A T 17: 65,982,905 D1844E probably damaging Het
Ankub1 G A 3: 57,665,618 R228* probably null Het
Apol6 A C 15: 77,050,698 probably benign Het
Ascc2 G A 11: 4,679,506 V618M probably damaging Het
Asic3 A G 5: 24,414,048 T113A probably benign Het
BC034090 T A 1: 155,217,405 H769L probably benign Het
Bcl11a G T 11: 24,085,458 E65* probably null Het
Birc6 G T 17: 74,598,082 R1290L possibly damaging Het
C6 A G 15: 4,789,581 E465G probably benign Het
Cav2 T A 6: 17,282,079 I112N probably damaging Het
Cep131 G A 11: 120,066,713 A848V probably damaging Het
Col8a1 T A 16: 57,627,192 I652F unknown Het
Cul4a A G 8: 13,123,493 N180S probably benign Het
Dhx38 A G 8: 109,560,695 S214P probably damaging Het
Dmxl2 A G 9: 54,415,987 V1197A possibly damaging Het
Dusp27 T C 1: 166,108,035 D198G probably damaging Het
Dynlt1f A G 17: 6,655,782 S7P not run Het
Epha1 T A 6: 42,365,422 T331S possibly damaging Het
Gm10436 A T 12: 88,176,315 Y373N probably benign Het
Gm49333 T A 16: 20,642,487 Y641* probably null Het
Hus1b A G 13: 30,946,864 Y271H probably damaging Het
Kmt2b A G 7: 30,569,553 V2610A possibly damaging Het
Lama2 A G 10: 27,265,050 L651P probably damaging Het
Lgr5 T C 10: 115,462,756 Y361C probably damaging Het
Map1s T C 8: 70,913,498 V349A probably benign Het
Map3k6 A G 4: 133,250,077 R912G probably benign Het
Marc2 A T 1: 184,841,425 F92Y possibly damaging Het
Nampt T A 12: 32,850,434 H459Q probably benign Het
Nlrp1a T C 11: 71,109,043 M817V probably benign Het
Nuak2 G A 1: 132,316,281 A18T possibly damaging Het
Olfr1428 T C 19: 12,109,021 D175G possibly damaging Het
Olfr993 A G 2: 85,414,135 V248A probably damaging Het
Ppp4r3b T C 11: 29,188,540 F296S possibly damaging Het
Pycr2 T C 1: 180,904,518 F19L probably benign Het
Robo2 T A 16: 74,035,115 T226S possibly damaging Het
Rock1 A T 18: 10,140,194 N132K probably damaging Het
Rp1 A T 1: 4,284,840 L379Q unknown Het
Sema6d A G 2: 124,657,972 I323V possibly damaging Het
Slc12a4 A G 8: 105,945,847 I814T probably damaging Het
Slc18a2 G A 19: 59,284,152 G352R probably damaging Het
Slc39a14 T C 14: 70,309,827 T357A possibly damaging Het
Smarcad1 T A 6: 65,052,711 D94E probably benign Het
Sorcs2 A G 5: 36,025,876 Y1018H probably benign Het
Srebf1 G T 11: 60,200,121 T1069K possibly damaging Het
St3gal3 A G 4: 117,964,356 V123A probably benign Het
Stradb A G 1: 58,991,151 Y188C unknown Het
Sult2a2 T C 7: 13,779,505 F186L probably benign Het
Syne2 A G 12: 75,927,390 T1120A probably benign Het
Taok1 A T 11: 77,555,614 S430T probably benign Het
Tmem62 A T 2: 121,006,930 I573L probably benign Het
Trav9-1 T C 14: 53,488,124 S7P probably benign Het
U2af1l4 A T 7: 30,563,557 I24F probably damaging Het
Usp33 T A 3: 152,391,665 I840N probably damaging Het
Vmn2r74 A C 7: 85,952,336 I698S probably damaging Het
Zfp352 C T 4: 90,223,659 P12L possibly damaging Het
Zfp507 T A 7: 35,794,544 E358V probably damaging Het
Other mutations in Npsr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Npsr1 APN 9 24254693 missense probably damaging 1.00
IGL02505:Npsr1 APN 9 24098282 missense probably benign
IGL03306:Npsr1 APN 9 24313239 missense probably benign 0.41
IGL03350:Npsr1 APN 9 24098309 missense probably benign
R0057:Npsr1 UTSW 9 24300427 missense probably damaging 1.00
R0385:Npsr1 UTSW 9 24313277 missense probably damaging 0.99
R1432:Npsr1 UTSW 9 24310075 missense probably damaging 1.00
R2033:Npsr1 UTSW 9 24313352 missense probably benign
R2323:Npsr1 UTSW 9 24300436 missense probably damaging 1.00
R2851:Npsr1 UTSW 9 24310005 splice site probably benign
R2852:Npsr1 UTSW 9 24310005 splice site probably benign
R4088:Npsr1 UTSW 9 24313769 missense possibly damaging 0.56
R4757:Npsr1 UTSW 9 24134768 missense probably benign 0.00
R4812:Npsr1 UTSW 9 24289956 missense probably damaging 0.98
R5175:Npsr1 UTSW 9 24134815 missense probably benign 0.11
R5475:Npsr1 UTSW 9 24300419 missense probably damaging 1.00
R5568:Npsr1 UTSW 9 24313214 missense probably damaging 1.00
R5722:Npsr1 UTSW 9 24313800 missense probably damaging 1.00
R6778:Npsr1 UTSW 9 24254618 missense possibly damaging 0.96
R6811:Npsr1 UTSW 9 24134809 missense probably benign 0.03
R6931:Npsr1 UTSW 9 24289997 missense probably benign 0.27
R7356:Npsr1 UTSW 9 24098261 missense probably benign 0.29
R7908:Npsr1 UTSW 9 24289800 missense probably damaging 1.00
R8287:Npsr1 UTSW 9 24289962 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTCTGCATGTGGAAAGTAGG -3'
(R):5'- ACTGGCTCAGGATTCAAGCG -3'

Sequencing Primer
(F):5'- AGATGATGTCACTGTCCACTAGGC -3'
(R):5'- GGCTCAGGATTCAAGCGCATAC -3'
Posted On2019-10-17