Incidental Mutation 'R7570:Thbs3'
ID585693
Institutional Source Beutler Lab
Gene Symbol Thbs3
Ensembl Gene ENSMUSG00000028047
Gene Namethrombospondin 3
SynonymsThbs-3, TSP3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.628) question?
Stock #R7570 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location89215180-89226837 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 89219052 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 227 (Q227*)
Ref Sequence ENSEMBL: ENSMUSP00000029682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029682] [ENSMUST00000073572] [ENSMUST00000118964] [ENSMUST00000119084] [ENSMUST00000142051] [ENSMUST00000174126]
Predicted Effect probably null
Transcript: ENSMUST00000029682
AA Change: Q227*
SMART Domains Protein: ENSMUSP00000029682
Gene: ENSMUSG00000028047
AA Change: Q227*

DomainStartEndE-ValueType
TSPN 21 193 4.71e-56 SMART
Pfam:COMP 226 270 2.5e-22 PFAM
EGF 277 315 8.19e-2 SMART
EGF_CA 316 369 6.91e-9 SMART
EGF_CA 370 413 1.38e-8 SMART
EGF 417 456 1.99e0 SMART
Pfam:TSP_3 492 527 1e-12 PFAM
Pfam:TSP_3 551 586 2.2e-16 PFAM
Pfam:TSP_3 586 609 6.6e-7 PFAM
Pfam:TSP_3 610 647 2.6e-14 PFAM
Pfam:TSP_3 648 687 2.4e-10 PFAM
Pfam:TSP_3 688 723 4.2e-15 PFAM
Pfam:TSP_C 741 938 3.3e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073572
SMART Domains Protein: ENSMUSP00000073261
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
low complexity region 94 109 N/A INTRINSIC
Pfam:Tom37 151 219 4.2e-21 PFAM
Pfam:Tom37_C 239 317 8.1e-24 PFAM
Pfam:GST_C_3 267 383 1.7e-11 PFAM
Pfam:GST_C_2 270 377 2.7e-8 PFAM
Pfam:Tom37_C 300 369 1.1e-14 PFAM
low complexity region 396 415 N/A INTRINSIC
transmembrane domain 416 438 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118964
SMART Domains Protein: ENSMUSP00000114009
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
low complexity region 94 109 N/A INTRINSIC
Pfam:Tom37 151 219 5.9e-21 PFAM
Pfam:Tom37_C 216 287 6.3e-19 PFAM
Pfam:GST_C_3 216 352 5.1e-11 PFAM
Pfam:GST_C_2 238 344 1.9e-8 PFAM
Pfam:Tom37_C 269 338 9.5e-15 PFAM
low complexity region 365 384 N/A INTRINSIC
transmembrane domain 385 407 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119084
AA Change: Q227*
SMART Domains Protein: ENSMUSP00000112912
Gene: ENSMUSG00000028047
AA Change: Q227*

DomainStartEndE-ValueType
TSPN 21 193 4.71e-56 SMART
Pfam:COMP 226 270 8.2e-26 PFAM
EGF 277 315 8.19e-2 SMART
EGF_CA 316 369 6.91e-9 SMART
EGF_CA 370 413 1.38e-8 SMART
Pfam:TSP_3 455 490 4.4e-13 PFAM
Pfam:TSP_3 514 549 9.3e-17 PFAM
Pfam:TSP_3 549 572 2.8e-7 PFAM
Pfam:TSP_3 573 610 1.1e-14 PFAM
Pfam:TSP_3 611 650 1e-10 PFAM
Pfam:TSP_3 651 686 1.8e-15 PFAM
Pfam:TSP_C 704 904 7.9e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142051
SMART Domains Protein: ENSMUSP00000116136
Gene: ENSMUSG00000028047

DomainStartEndE-ValueType
TSPN 1 124 2.52e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174126
SMART Domains Protein: ENSMUSP00000133291
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
Pfam:Tom37_C 1 74 7.6e-23 PFAM
Pfam:GST_C_3 7 143 7.3e-12 PFAM
Pfam:GST_C_2 26 137 2.8e-9 PFAM
Pfam:Tom37_C 61 129 6.2e-15 PFAM
low complexity region 159 169 N/A INTRINSIC
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (104/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin family. Thrombospondin family members are adhesive glycoproteins that mediate cell-to-cell and cell-to-matrix interactions. This protein forms a pentameric molecule linked by a single disulfide bond. This gene shares a common promoter with metaxin 1. Alternate splicing results in coding and non-coding transcript variants. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous null mice at a young age are heavier and exhibit femurs with increased periosteal and endocortical diameters, greater moments of inertia and increased bending strength and failure loads, with these defects no longer detected in older mice. Femoral heads show accelerated bone ossification. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik C T 6: 91,934,610 T613I probably benign Het
9130019O22Rik T A 7: 127,385,283 S216C probably benign Het
Ajuba T C 14: 54,576,402 E288G probably damaging Het
Ankrd12 C T 17: 65,985,360 R1026K probably benign Het
Apol7b T C 15: 77,423,474 T274A probably benign Het
Arid4a A T 12: 71,063,142 R86* probably null Het
Asnsd1 C T 1: 53,348,258 G70D probably damaging Het
Atg4c T A 4: 99,228,560 V313D possibly damaging Het
Atp13a5 A C 16: 29,266,963 C885G probably damaging Het
Bpifb9a A T 2: 154,262,263 I209F possibly damaging Het
Bsn T C 9: 108,113,543 D1670G probably damaging Het
Cct8 T A 16: 87,491,322 I121F probably benign Het
Cd209a T G 8: 3,744,151 D217A probably damaging Het
Cdk19 C T 10: 40,477,958 S456L possibly damaging Het
Chd9 C T 8: 90,994,580 H999Y unknown Het
Col5a1 G A 2: 27,951,383 V339M unknown Het
Cr2 G A 1: 195,169,340 R115* probably null Het
Cyb561 A T 11: 105,937,644 F62I probably damaging Het
Cyp2c38 A T 19: 39,404,743 N293K possibly damaging Het
Cyp2c69 A T 19: 39,859,898 D293E probably damaging Het
Dcbld2 T A 16: 58,424,569 C69S possibly damaging Het
Dcdc2a T C 13: 25,119,373 S296P probably benign Het
Dmxl1 T A 18: 49,893,957 I2044K possibly damaging Het
Dnah5 A G 15: 28,346,952 D2527G probably damaging Het
Dnah6 T C 6: 73,149,430 T1305A probably benign Het
Dnajc9 A G 14: 20,388,644 V47A probably benign Het
Dnmt3b A G 2: 153,676,699 Y594C probably damaging Het
Dph7 A G 2: 24,965,630 D147G probably damaging Het
Drap1 T C 19: 5,423,352 H164R possibly damaging Het
Dsg3 T A 18: 20,527,780 V392E possibly damaging Het
Dxo A G 17: 34,837,640 D81G probably benign Het
E230025N22Rik G T 18: 36,695,592 T11K probably benign Het
Esyt1 A G 10: 128,518,932 V533A possibly damaging Het
Etv3 T A 3: 87,536,031 C307* probably null Het
Fam114a1 T A 5: 65,030,059 probably null Het
Fam208b A G 13: 3,573,621 Y2110H probably damaging Het
Fam3c T A 6: 22,326,405 probably benign Het
Fbn1 G T 2: 125,397,852 T305K probably benign Het
Ggt1 A T 10: 75,585,594 I484F probably damaging Het
Gm10639 A T 9: 78,304,469 D171V possibly damaging Het
Gpatch1 T C 7: 35,293,812 D536G probably damaging Het
Gpx4 T C 10: 80,055,041 I189T probably damaging Het
Gsr T A 8: 33,669,165 C85S probably damaging Het
Havcr1 T A 11: 46,770,542 probably null Het
Heatr4 T C 12: 83,979,644 T280A probably benign Het
Hmcn2 A T 2: 31,423,911 E3532D probably benign Het
Hnrnpc T C 14: 52,075,099 N308S possibly damaging Het
Ighv8-9 A G 12: 115,468,738 V13A probably benign Het
Itgb2l A T 16: 96,426,239 F535I probably benign Het
Kdm5a T G 6: 120,427,842 D1348E probably damaging Het
Kndc1 CT C 7: 139,923,775 probably null Het
Ky A G 9: 102,542,329 I512V probably benign Het
Lamc1 A T 1: 153,243,275 F866Y possibly damaging Het
Lbx1 C A 19: 45,235,248 probably benign Het
Magel2 A G 7: 62,378,910 T521A possibly damaging Het
Mgam A T 6: 40,746,433 I491L probably benign Het
Mitd1 T C 1: 37,890,192 E40G probably damaging Het
Mpzl3 A G 9: 45,070,687 T218A probably benign Het
Mrpl42 A G 10: 95,480,965 S77P probably benign Het
Mup5 C T 4: 61,834,674 W37* probably null Het
Myh14 T C 7: 44,632,426 I803V probably benign Het
Ncor2 T A 5: 125,030,089 T744S Het
Ndufv3 A G 17: 31,527,622 D162G probably damaging Het
Nostrin A G 2: 69,175,806 E278G probably damaging Het
Nrxn1 T G 17: 90,162,379 E1288A probably benign Het
Olfr1205 A G 2: 88,831,128 N4D possibly damaging Het
Olfr623 C A 7: 103,660,881 R123L probably damaging Het
Olfr648 T A 7: 104,179,748 Y220F probably damaging Het
Olfr972 A T 9: 39,873,455 Y60F possibly damaging Het
Patj T A 4: 98,424,500 probably null Het
Pcm1 T G 8: 41,267,344 I314R possibly damaging Het
Pcsk6 A G 7: 66,033,898 T754A probably benign Het
Pde2a A T 7: 101,502,834 N326I probably benign Het
Plekhg4 T C 8: 105,378,684 S594P possibly damaging Het
Plekhm3 T C 1: 64,937,906 D135G probably damaging Het
Plin4 A T 17: 56,106,776 M283K probably benign Het
Ppfia3 T C 7: 45,340,748 probably null Het
Prdm9 T C 17: 15,555,652 N179S probably benign Het
Prrt3 T C 6: 113,494,488 S908G probably damaging Het
Psg22 C A 7: 18,722,735 S181Y possibly damaging Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rp1l1 T A 14: 64,031,574 C1536* probably null Het
Rpp25l T C 4: 41,712,529 H82R probably damaging Het
Rps3a1 T A 3: 86,139,089 M172L probably benign Het
Rtbdn T C 8: 84,952,927 L110P probably damaging Het
Ryr1 T A 7: 29,078,585 Q2169L probably damaging Het
Scn4a A T 11: 106,320,473 C1573S possibly damaging Het
Sec16b A T 1: 157,531,395 probably null Het
Serpina1a A T 12: 103,853,837 D383E possibly damaging Het
Sh3gl3 T C 7: 82,285,077 M262T probably benign Het
Sos2 G A 12: 69,590,880 T1052M probably damaging Het
Spag16 G A 1: 69,996,841 V343I probably benign Het
Spocd1 T G 4: 129,930,164 D251E Het
Stc2 G T 11: 31,367,798 N74K probably damaging Het
Tmem92 A C 11: 94,778,990 I105R probably benign Het
Tmod1 T A 4: 46,083,632 N20K probably benign Het
Tns1 T C 1: 73,953,479 D53G probably damaging Het
Tspan33 T A 6: 29,717,338 L246Q probably damaging Het
Ttc16 A G 2: 32,768,968 L392P probably damaging Het
Uggt1 T A 1: 36,185,838 T572S probably benign Het
Usp17la A T 7: 104,860,397 T70S probably damaging Het
Usp31 C T 7: 121,674,963 R370H probably damaging Het
Wdr83 C T 8: 85,079,834 V112M probably damaging Het
Zbtb25 T A 12: 76,369,592 probably benign Het
Zfp110 T A 7: 12,849,340 N638K possibly damaging Het
Zfp820 T C 17: 21,819,013 T445A probably benign Het
Other mutations in Thbs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01838:Thbs3 APN 3 89219058 nonsense probably null
IGL02927:Thbs3 APN 3 89220207 missense probably damaging 0.98
IGL02980:Thbs3 UTSW 3 89223144 missense probably benign
R0648:Thbs3 UTSW 3 89216665 splice site probably null
R0690:Thbs3 UTSW 3 89220165 missense possibly damaging 0.50
R1856:Thbs3 UTSW 3 89226406 missense probably damaging 1.00
R1928:Thbs3 UTSW 3 89217760 missense probably damaging 1.00
R2116:Thbs3 UTSW 3 89219392 missense probably damaging 1.00
R4600:Thbs3 UTSW 3 89224590 missense probably damaging 0.97
R4719:Thbs3 UTSW 3 89216840 missense probably damaging 1.00
R4947:Thbs3 UTSW 3 89226431 missense probably damaging 1.00
R4989:Thbs3 UTSW 3 89223102 intron probably benign
R5134:Thbs3 UTSW 3 89223102 intron probably benign
R5217:Thbs3 UTSW 3 89223164 critical splice donor site probably null
R5305:Thbs3 UTSW 3 89217976 intron probably benign
R5354:Thbs3 UTSW 3 89221377 missense probably damaging 1.00
R5444:Thbs3 UTSW 3 89223385 intron probably benign
R5569:Thbs3 UTSW 3 89219463 missense probably damaging 1.00
R5646:Thbs3 UTSW 3 89219098 missense probably damaging 1.00
R5801:Thbs3 UTSW 3 89224397 missense probably benign 0.15
R5886:Thbs3 UTSW 3 89220163 missense probably damaging 1.00
R6031:Thbs3 UTSW 3 89218094 missense probably damaging 0.99
R6031:Thbs3 UTSW 3 89218094 missense probably damaging 0.99
R6943:Thbs3 UTSW 3 89224864 missense probably benign 0.01
R7017:Thbs3 UTSW 3 89224415 missense probably damaging 1.00
R7352:Thbs3 UTSW 3 89225280 missense probably benign 0.03
R7671:Thbs3 UTSW 3 89216707 missense probably benign 0.01
R7707:Thbs3 UTSW 3 89224900 missense possibly damaging 0.88
R8255:Thbs3 UTSW 3 89225258 missense probably benign
R8341:Thbs3 UTSW 3 89225391 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCTCCTCTAGTGACCAGCG -3'
(R):5'- CTCCATGATGGTGTTCCGGATG -3'

Sequencing Primer
(F):5'- GCACTGCAATCCATTCTAGGTGAG -3'
(R):5'- GGATGAGTGACATTTCCTTCAC -3'
Posted On2019-10-17