Incidental Mutation 'R7570:Spocd1'
ID 585698
Institutional Source Beutler Lab
Gene Symbol Spocd1
Ensembl Gene ENSMUSG00000028784
Gene Name SPOC domain containing 1
Synonyms OTTMUSG00000009522
MMRRC Submission 045631-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R7570 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 129823042-129850908 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 129823957 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 251 (D251E)
Ref Sequence ENSEMBL: ENSMUSP00000081284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084263]
AlphaFold B1ASB6
Predicted Effect
SMART Domains Protein: ENSMUSP00000081284
Gene: ENSMUSG00000028784
AA Change: D251E

DomainStartEndE-ValueType
Pfam:TFIIS_M 1 105 1.7e-24 PFAM
Blast:PAC 123 163 4e-7 BLAST
Pfam:SPOC 247 350 1e-22 PFAM
low complexity region 454 467 N/A INTRINSIC
low complexity region 559 571 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (104/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the TFIIS family of transcription factors. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik C T 6: 91,911,591 (GRCm39) T613I probably benign Het
Ajuba T C 14: 54,813,859 (GRCm39) E288G probably damaging Het
Ankrd12 C T 17: 66,292,355 (GRCm39) R1026K probably benign Het
Apol7b T C 15: 77,307,674 (GRCm39) T274A probably benign Het
Arid4a A T 12: 71,109,916 (GRCm39) R86* probably null Het
Asnsd1 C T 1: 53,387,417 (GRCm39) G70D probably damaging Het
Atg4c T A 4: 99,116,797 (GRCm39) V313D possibly damaging Het
Atp13a5 A C 16: 29,085,715 (GRCm39) C885G probably damaging Het
Bpifb9a A T 2: 154,104,183 (GRCm39) I209F possibly damaging Het
Bsn T C 9: 107,990,742 (GRCm39) D1670G probably damaging Het
Cct8 T A 16: 87,288,210 (GRCm39) I121F probably benign Het
Cd209a T G 8: 3,794,151 (GRCm39) D217A probably damaging Het
Cdk19 C T 10: 40,353,954 (GRCm39) S456L possibly damaging Het
Chd9 C T 8: 91,721,208 (GRCm39) H999Y unknown Het
Col5a1 G A 2: 27,841,395 (GRCm39) V339M unknown Het
Cr2 G A 1: 194,851,648 (GRCm39) R115* probably null Het
Cyb561 A T 11: 105,828,470 (GRCm39) F62I probably damaging Het
Cyp2c38 A T 19: 39,393,187 (GRCm39) N293K possibly damaging Het
Cyp2c69 A T 19: 39,848,342 (GRCm39) D293E probably damaging Het
Dcbld2 T A 16: 58,244,932 (GRCm39) C69S possibly damaging Het
Dcdc2a T C 13: 25,303,356 (GRCm39) S296P probably benign Het
Dmxl1 T A 18: 50,027,024 (GRCm39) I2044K possibly damaging Het
Dnah5 A G 15: 28,347,098 (GRCm39) D2527G probably damaging Het
Dnah6 T C 6: 73,126,413 (GRCm39) T1305A probably benign Het
Dnajc9 A G 14: 20,438,712 (GRCm39) V47A probably benign Het
Dnmt3b A G 2: 153,518,619 (GRCm39) Y594C probably damaging Het
Dph7 A G 2: 24,855,642 (GRCm39) D147G probably damaging Het
Drap1 T C 19: 5,473,380 (GRCm39) H164R possibly damaging Het
Dsg3 T A 18: 20,660,837 (GRCm39) V392E possibly damaging Het
Dxo A G 17: 35,056,616 (GRCm39) D81G probably benign Het
E230025N22Rik G T 18: 36,828,645 (GRCm39) T11K probably benign Het
Esyt1 A G 10: 128,354,801 (GRCm39) V533A possibly damaging Het
Etv3 T A 3: 87,443,338 (GRCm39) C307* probably null Het
Fam114a1 T A 5: 65,187,402 (GRCm39) probably null Het
Fam3c T A 6: 22,326,404 (GRCm39) probably benign Het
Fbn1 G T 2: 125,239,772 (GRCm39) T305K probably benign Het
Ggt1 A T 10: 75,421,428 (GRCm39) I484F probably damaging Het
Gpatch1 T C 7: 34,993,237 (GRCm39) D536G probably damaging Het
Gpx4 T C 10: 79,890,875 (GRCm39) I189T probably damaging Het
Gsr T A 8: 34,159,193 (GRCm39) C85S probably damaging Het
Gsta5 A T 9: 78,211,751 (GRCm39) D171V possibly damaging Het
Havcr1 T A 11: 46,661,369 (GRCm39) probably null Het
Heatr4 T C 12: 84,026,418 (GRCm39) T280A probably benign Het
Hmcn2 A T 2: 31,313,923 (GRCm39) E3532D probably benign Het
Hnrnpc T C 14: 52,312,556 (GRCm39) N308S possibly damaging Het
Ighv8-9 A G 12: 115,432,358 (GRCm39) V13A probably benign Het
Itgb2l A T 16: 96,227,439 (GRCm39) F535I probably benign Het
Kdm5a T G 6: 120,404,803 (GRCm39) D1348E probably damaging Het
Kndc1 CT C 7: 139,503,691 (GRCm39) probably null Het
Ky A G 9: 102,419,528 (GRCm39) I512V probably benign Het
Lamc1 A T 1: 153,119,021 (GRCm39) F866Y possibly damaging Het
Lbx1 C A 19: 45,223,687 (GRCm39) probably benign Het
Magel2 A G 7: 62,028,658 (GRCm39) T521A possibly damaging Het
Mgam A T 6: 40,723,367 (GRCm39) I491L probably benign Het
Mitd1 T C 1: 37,929,273 (GRCm39) E40G probably damaging Het
Mpzl3 A G 9: 44,981,985 (GRCm39) T218A probably benign Het
Mrpl42 A G 10: 95,316,827 (GRCm39) S77P probably benign Het
Mup5 C T 4: 61,752,911 (GRCm39) W37* probably null Het
Myh14 T C 7: 44,281,850 (GRCm39) I803V probably benign Het
Ncor2 T A 5: 125,107,153 (GRCm39) T744S Het
Ndufv3 A G 17: 31,746,596 (GRCm39) D162G probably damaging Het
Nostrin A G 2: 69,006,150 (GRCm39) E278G probably damaging Het
Nrxn1 T G 17: 90,469,807 (GRCm39) E1288A probably benign Het
Or4c11c A G 2: 88,661,472 (GRCm39) N4D possibly damaging Het
Or51b6b C A 7: 103,310,088 (GRCm39) R123L probably damaging Het
Or52h1 T A 7: 103,828,955 (GRCm39) Y220F probably damaging Het
Or8g55 A T 9: 39,784,751 (GRCm39) Y60F possibly damaging Het
Patj T A 4: 98,312,737 (GRCm39) probably null Het
Pcm1 T G 8: 41,720,381 (GRCm39) I314R possibly damaging Het
Pcsk6 A G 7: 65,683,646 (GRCm39) T754A probably benign Het
Pde2a A T 7: 101,152,041 (GRCm39) N326I probably benign Het
Plekhg4 T C 8: 106,105,316 (GRCm39) S594P possibly damaging Het
Plekhm3 T C 1: 64,977,065 (GRCm39) D135G probably damaging Het
Plin4 A T 17: 56,413,776 (GRCm39) M283K probably benign Het
Ppfia3 T C 7: 44,990,172 (GRCm39) probably null Het
Prdm9 T C 17: 15,775,914 (GRCm39) N179S probably benign Het
Prrt3 T C 6: 113,471,449 (GRCm39) S908G probably damaging Het
Psg22 C A 7: 18,456,660 (GRCm39) S181Y possibly damaging Het
Rcor3 C A 1: 191,822,173 (GRCm39) G8V probably damaging Het
Rp1l1 T A 14: 64,269,023 (GRCm39) C1536* probably null Het
Rpp25l T C 4: 41,712,529 (GRCm39) H82R probably damaging Het
Rps3a1 T A 3: 86,046,396 (GRCm39) M172L probably benign Het
Rtbdn T C 8: 85,679,556 (GRCm39) L110P probably damaging Het
Ryr1 T A 7: 28,778,010 (GRCm39) Q2169L probably damaging Het
Scn4a A T 11: 106,211,299 (GRCm39) C1573S possibly damaging Het
Sec16b A T 1: 157,358,965 (GRCm39) probably null Het
Serpina1a A T 12: 103,820,096 (GRCm39) D383E possibly damaging Het
Sh3gl3 T C 7: 81,934,285 (GRCm39) M262T probably benign Het
Sos2 G A 12: 69,637,654 (GRCm39) T1052M probably damaging Het
Spag16 G A 1: 70,036,000 (GRCm39) V343I probably benign Het
Stc2 G T 11: 31,317,798 (GRCm39) N74K probably damaging Het
Tasor2 A G 13: 3,623,621 (GRCm39) Y2110H probably damaging Het
Thbs3 C T 3: 89,126,359 (GRCm39) Q227* probably null Het
Tmem92 A C 11: 94,669,816 (GRCm39) I105R probably benign Het
Tmod1 T A 4: 46,083,632 (GRCm39) N20K probably benign Het
Tns1 T C 1: 73,992,638 (GRCm39) D53G probably damaging Het
Tspan33 T A 6: 29,717,337 (GRCm39) L246Q probably damaging Het
Ttc16 A G 2: 32,658,980 (GRCm39) L392P probably damaging Het
Uggt1 T A 1: 36,224,919 (GRCm39) T572S probably benign Het
Usp17la A T 7: 104,509,604 (GRCm39) T70S probably damaging Het
Usp31 C T 7: 121,274,186 (GRCm39) R370H probably damaging Het
Wdr83 C T 8: 85,806,463 (GRCm39) V112M probably damaging Het
Zbtb25 T A 12: 76,416,366 (GRCm39) probably benign Het
Zfp110 T A 7: 12,583,267 (GRCm39) N638K possibly damaging Het
Zfp747l1 T A 7: 126,984,455 (GRCm39) S216C probably benign Het
Zfp820 T C 17: 22,037,994 (GRCm39) T445A probably benign Het
Other mutations in Spocd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02191:Spocd1 APN 4 129,847,380 (GRCm39) missense probably damaging 0.99
IGL02332:Spocd1 APN 4 129,842,885 (GRCm39) missense probably damaging 1.00
IGL02796:Spocd1 APN 4 129,841,548 (GRCm39) intron probably benign
R0005:Spocd1 UTSW 4 129,850,571 (GRCm39) missense possibly damaging 0.73
R0499:Spocd1 UTSW 4 129,849,263 (GRCm39) missense possibly damaging 0.56
R0939:Spocd1 UTSW 4 129,842,663 (GRCm39) missense possibly damaging 0.93
R1128:Spocd1 UTSW 4 129,850,599 (GRCm39) missense possibly damaging 0.57
R5747:Spocd1 UTSW 4 129,848,738 (GRCm39) missense probably damaging 1.00
R5774:Spocd1 UTSW 4 129,845,579 (GRCm39) missense probably benign 0.04
R5872:Spocd1 UTSW 4 129,850,254 (GRCm39) missense probably damaging 0.99
R5887:Spocd1 UTSW 4 129,842,752 (GRCm39) missense probably damaging 1.00
R6185:Spocd1 UTSW 4 129,850,242 (GRCm39) missense probably benign 0.02
R6198:Spocd1 UTSW 4 129,849,208 (GRCm39) missense probably damaging 1.00
R6245:Spocd1 UTSW 4 129,850,901 (GRCm39) splice site probably null
R6412:Spocd1 UTSW 4 129,847,365 (GRCm39) missense probably benign 0.44
R6804:Spocd1 UTSW 4 129,847,423 (GRCm39) nonsense probably null
R6884:Spocd1 UTSW 4 129,849,197 (GRCm39) unclassified probably benign
R6898:Spocd1 UTSW 4 129,850,305 (GRCm39) unclassified probably benign
R7090:Spocd1 UTSW 4 129,847,691 (GRCm39) missense
R7548:Spocd1 UTSW 4 129,823,602 (GRCm39) missense
R7657:Spocd1 UTSW 4 129,823,535 (GRCm39) missense
R7910:Spocd1 UTSW 4 129,823,893 (GRCm39) missense
R8141:Spocd1 UTSW 4 129,823,497 (GRCm39) missense
R8557:Spocd1 UTSW 4 129,842,761 (GRCm39) missense probably damaging 1.00
R8798:Spocd1 UTSW 4 129,823,997 (GRCm39) critical splice donor site probably null
R8886:Spocd1 UTSW 4 129,845,631 (GRCm39) missense
R9463:Spocd1 UTSW 4 129,847,398 (GRCm39) missense
R9633:Spocd1 UTSW 4 129,850,463 (GRCm39) missense unknown
R9730:Spocd1 UTSW 4 129,850,305 (GRCm39) unclassified probably benign
Z1177:Spocd1 UTSW 4 129,849,306 (GRCm39) missense unknown
Z1177:Spocd1 UTSW 4 129,823,770 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- AAGTACAGCCCGCGTTTGTG -3'
(R):5'- CCCTCACAGGAACTCAGTAATGTC -3'

Sequencing Primer
(F):5'- CAGAGGACAAGGCCCAGTC -3'
(R):5'- TGAGTTCAAAGCCAGCCTAG -3'
Posted On 2019-10-17