Mutagenetix > Incidental Mutation

Incidental Mutation 'R7570:Dnah6'

585702

Institutional Source

Beutler Lab

Gene Symbol

Dnah6

Ensembl Gene

ENSMUSG00000052861

Gene Name

dynein, axonemal, heavy chain 6

Synonyms

A730004I20Rik, Dnahc6

MMRRC Submission

045631-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.116) question?

Stock #

R7570 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

73017606-73221651 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 73149430 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1305 (T1305A)

Ref Sequence

ENSEMBL: ENSMUSP00000068758 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064948] [ENSMUST00000114040] [ENSMUST00000204053]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000064948
AA Change: T1305A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000068758
Gene: ENSMUSG00000052861
AA Change: T1305A

Domain	Start	End	E-Value	Type
coiled coil region	732	759	N/A	INTRINSIC
low complexity region	841	852	N/A	INTRINSIC
Pfam:DHC_N2	875	1298	4.3e-144	PFAM
AAA	1459	1562	2.76e-1	SMART
AAA	1740	1881	5.25e-1	SMART
low complexity region	1957	1967	N/A	INTRINSIC
AAA	2083	2236	1.01e-3	SMART
AAA	2434	2592	3.08e0	SMART
low complexity region	2607	2618	N/A	INTRINSIC
low complexity region	2645	2656	N/A	INTRINSIC
Pfam:MT	2685	3019	3.1e-53	PFAM
Pfam:AAA_9	3040	3265	3.6e-94	PFAM
Pfam:Dynein_heavy	3402	4140	1.2e-250	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000114040
AA Change: T1305A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000109674
Gene: ENSMUSG00000052861
AA Change: T1305A

Domain	Start	End	E-Value	Type
coiled coil region	732	759	N/A	INTRINSIC
low complexity region	841	852	N/A	INTRINSIC
Pfam:DHC_N2	873	1300	2.2e-135	PFAM
AAA	1407	1510	2.76e-1	SMART
AAA	1688	1829	5.25e-1	SMART
low complexity region	1905	1915	N/A	INTRINSIC
AAA	2031	2184	1.01e-3	SMART
AAA	2382	2540	3.08e0	SMART
low complexity region	2555	2566	N/A	INTRINSIC
low complexity region	2593	2604	N/A	INTRINSIC
Pfam:MT	2633	2967	1.1e-53	PFAM
Pfam:AAA_9	2984	3214	1e-58	PFAM
Pfam:Dynein_heavy	3344	4089	2.2e-213	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000204053
AA Change: T1305A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000144791
Gene: ENSMUSG00000052861
AA Change: T1305A

Domain	Start	End	E-Value	Type
coiled coil region	732	759	N/A	INTRINSIC
low complexity region	841	852	N/A	INTRINSIC
Pfam:DHC_N2	875	1298	4.3e-144	PFAM
AAA	1459	1562	2.76e-1	SMART
AAA	1740	1881	5.25e-1	SMART
low complexity region	1957	1967	N/A	INTRINSIC
AAA	2083	2236	1.01e-3	SMART
AAA	2434	2592	3.08e0	SMART
low complexity region	2607	2618	N/A	INTRINSIC
low complexity region	2645	2656	N/A	INTRINSIC
Pfam:MT	2685	3019	3.1e-53	PFAM
Pfam:AAA_9	3040	3265	3.6e-94	PFAM
Pfam:Dynein_heavy	3402	4140	1.2e-250	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

98% (104/106)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the dynein family, whose members encode large proteins that are constituents of the microtubule-associated motor protein complex. This complex is composed of dynein heavy, intermediate and light chains, which can be axonemal or cytoplasmic. This protein is an axonemal dynein heavy chain. It is involved in producing force for ciliary beating by using energy from ATP hydrolysis. Mutations in this gene may cause primary ciliary dyskinesia (PCD) as well as heterotaxy. [provided by RefSeq, Jun 2016]

Allele List at MGI

Other mutations in this stock

Total: 106 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930590J08Rik	C	T	6: 91,934,610	T613I	probably benign	Het
9130019O22Rik	T	A	7: 127,385,283	S216C	probably benign	Het
Ajuba	T	C	14: 54,576,402	E288G	probably damaging	Het
Ankrd12	C	T	17: 65,985,360	R1026K	probably benign	Het
Apol7b	T	C	15: 77,423,474	T274A	probably benign	Het
Arid4a	A	T	12: 71,063,142	R86*	probably null	Het
Asnsd1	C	T	1: 53,348,258	G70D	probably damaging	Het
Atg4c	T	A	4: 99,228,560	V313D	possibly damaging	Het
Atp13a5	A	C	16: 29,266,963	C885G	probably damaging	Het
Bpifb9a	A	T	2: 154,262,263	I209F	possibly damaging	Het
Bsn	T	C	9: 108,113,543	D1670G	probably damaging	Het
Cct8	T	A	16: 87,491,322	I121F	probably benign	Het
Cd209a	T	G	8: 3,744,151	D217A	probably damaging	Het
Cdk19	C	T	10: 40,477,958	S456L	possibly damaging	Het
Chd9	C	T	8: 90,994,580	H999Y	unknown	Het
Col5a1	G	A	2: 27,951,383	V339M	unknown	Het
Cr2	G	A	1: 195,169,340	R115*	probably null	Het
Cyb561	A	T	11: 105,937,644	F62I	probably damaging	Het
Cyp2c38	A	T	19: 39,404,743	N293K	possibly damaging	Het
Cyp2c69	A	T	19: 39,859,898	D293E	probably damaging	Het
Dcbld2	T	A	16: 58,424,569	C69S	possibly damaging	Het
Dcdc2a	T	C	13: 25,119,373	S296P	probably benign	Het
Dmxl1	T	A	18: 49,893,957	I2044K	possibly damaging	Het
Dnah5	A	G	15: 28,346,952	D2527G	probably damaging	Het
Dnajc9	A	G	14: 20,388,644	V47A	probably benign	Het
Dnmt3b	A	G	2: 153,676,699	Y594C	probably damaging	Het
Dph7	A	G	2: 24,965,630	D147G	probably damaging	Het
Drap1	T	C	19: 5,423,352	H164R	possibly damaging	Het
Dsg3	T	A	18: 20,527,780	V392E	possibly damaging	Het
Dxo	A	G	17: 34,837,640	D81G	probably benign	Het
E230025N22Rik	G	T	18: 36,695,592	T11K	probably benign	Het
Esyt1	A	G	10: 128,518,932	V533A	possibly damaging	Het
Etv3	T	A	3: 87,536,031	C307*	probably null	Het
Fam114a1	T	A	5: 65,030,059		probably null	Het
Fam208b	A	G	13: 3,573,621	Y2110H	probably damaging	Het
Fam3c	T	A	6: 22,326,405		probably benign	Het
Fbn1	G	T	2: 125,397,852	T305K	probably benign	Het
Ggt1	A	T	10: 75,585,594	I484F	probably damaging	Het
Gm10639	A	T	9: 78,304,469	D171V	possibly damaging	Het
Gpatch1	T	C	7: 35,293,812	D536G	probably damaging	Het
Gpx4	T	C	10: 80,055,041	I189T	probably damaging	Het
Gsr	T	A	8: 33,669,165	C85S	probably damaging	Het
Havcr1	T	A	11: 46,770,542		probably null	Het
Heatr4	T	C	12: 83,979,644	T280A	probably benign	Het
Hmcn2	A	T	2: 31,423,911	E3532D	probably benign	Het
Hnrnpc	T	C	14: 52,075,099	N308S	possibly damaging	Het
Ighv8-9	A	G	12: 115,468,738	V13A	probably benign	Het
Itgb2l	A	T	16: 96,426,239	F535I	probably benign	Het
Kdm5a	T	G	6: 120,427,842	D1348E	probably damaging	Het
Kndc1	CT	C	7: 139,923,775		probably null	Het
Ky	A	G	9: 102,542,329	I512V	probably benign	Het
Lamc1	A	T	1: 153,243,275	F866Y	possibly damaging	Het
Lbx1	C	A	19: 45,235,248		probably benign	Het
Magel2	A	G	7: 62,378,910	T521A	possibly damaging	Het
Mgam	A	T	6: 40,746,433	I491L	probably benign	Het
Mitd1	T	C	1: 37,890,192	E40G	probably damaging	Het
Mpzl3	A	G	9: 45,070,687	T218A	probably benign	Het
Mrpl42	A	G	10: 95,480,965	S77P	probably benign	Het
Mup5	C	T	4: 61,834,674	W37*	probably null	Het
Myh14	T	C	7: 44,632,426	I803V	probably benign	Het
Ncor2	T	A	5: 125,030,089	T744S		Het
Ndufv3	A	G	17: 31,527,622	D162G	probably damaging	Het
Nostrin	A	G	2: 69,175,806	E278G	probably damaging	Het
Nrxn1	T	G	17: 90,162,379	E1288A	probably benign	Het
Olfr1205	A	G	2: 88,831,128	N4D	possibly damaging	Het
Olfr623	C	A	7: 103,660,881	R123L	probably damaging	Het
Olfr648	T	A	7: 104,179,748	Y220F	probably damaging	Het
Olfr972	A	T	9: 39,873,455	Y60F	possibly damaging	Het
Patj	T	A	4: 98,424,500		probably null	Het
Pcm1	T	G	8: 41,267,344	I314R	possibly damaging	Het
Pcsk6	A	G	7: 66,033,898	T754A	probably benign	Het
Pde2a	A	T	7: 101,502,834	N326I	probably benign	Het
Plekhg4	T	C	8: 105,378,684	S594P	possibly damaging	Het
Plekhm3	T	C	1: 64,937,906	D135G	probably damaging	Het
Plin4	A	T	17: 56,106,776	M283K	probably benign	Het
Ppfia3	T	C	7: 45,340,748		probably null	Het
Prdm9	T	C	17: 15,555,652	N179S	probably benign	Het
Prrt3	T	C	6: 113,494,488	S908G	probably damaging	Het
Psg22	C	A	7: 18,722,735	S181Y	possibly damaging	Het
Rcor3	C	A	1: 192,137,876	G8V	probably damaging	Het
Rp1l1	T	A	14: 64,031,574	C1536*	probably null	Het
Rpp25l	T	C	4: 41,712,529	H82R	probably damaging	Het
Rps3a1	T	A	3: 86,139,089	M172L	probably benign	Het
Rtbdn	T	C	8: 84,952,927	L110P	probably damaging	Het
Ryr1	T	A	7: 29,078,585	Q2169L	probably damaging	Het
Scn4a	A	T	11: 106,320,473	C1573S	possibly damaging	Het
Sec16b	A	T	1: 157,531,395		probably null	Het
Serpina1a	A	T	12: 103,853,837	D383E	possibly damaging	Het
Sh3gl3	T	C	7: 82,285,077	M262T	probably benign	Het
Sos2	G	A	12: 69,590,880	T1052M	probably damaging	Het
Spag16	G	A	1: 69,996,841	V343I	probably benign	Het
Spocd1	T	G	4: 129,930,164	D251E		Het
Stc2	G	T	11: 31,367,798	N74K	probably damaging	Het
Thbs3	C	T	3: 89,219,052	Q227*	probably null	Het
Tmem92	A	C	11: 94,778,990	I105R	probably benign	Het
Tmod1	T	A	4: 46,083,632	N20K	probably benign	Het
Tns1	T	C	1: 73,953,479	D53G	probably damaging	Het
Tspan33	T	A	6: 29,717,338	L246Q	probably damaging	Het
Ttc16	A	G	2: 32,768,968	L392P	probably damaging	Het
Uggt1	T	A	1: 36,185,838	T572S	probably benign	Het
Usp17la	A	T	7: 104,860,397	T70S	probably damaging	Het
Usp31	C	T	7: 121,674,963	R370H	probably damaging	Het
Wdr83	C	T	8: 85,079,834	V112M	probably damaging	Het
Zbtb25	T	A	12: 76,369,592		probably benign	Het
Zfp110	T	A	7: 12,849,340	N638K	possibly damaging	Het
Zfp820	T	C	17: 21,819,013	T445A	probably benign	Het

Other mutations in Dnah6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00264:Dnah6	APN	6	73195737	missense	probably benign	0.00
IGL00488:Dnah6	APN	6	73086207	missense	possibly damaging	0.95
IGL00497:Dnah6	APN	6	73195761	missense	probably damaging	1.00
IGL00557:Dnah6	APN	6	73195620	missense	possibly damaging	0.47
IGL00561:Dnah6	APN	6	73195620	missense	possibly damaging	0.47
IGL00563:Dnah6	APN	6	73195620	missense	possibly damaging	0.47
IGL00755:Dnah6	APN	6	73212434	critical splice donor site	probably null
IGL00756:Dnah6	APN	6	73123771	missense	possibly damaging	0.76
IGL00764:Dnah6	APN	6	73195620	missense	possibly damaging	0.47
IGL00895:Dnah6	APN	6	73156350	missense	possibly damaging	0.67
IGL00922:Dnah6	APN	6	73033526	splice site	probably benign
IGL00972:Dnah6	APN	6	73083157	splice site	probably benign
IGL00975:Dnah6	APN	6	73173390	missense	possibly damaging	0.94
IGL01014:Dnah6	APN	6	73074781	splice site	probably benign
IGL01307:Dnah6	APN	6	73065725	missense	probably damaging	1.00
IGL01353:Dnah6	APN	6	73173456	missense	probably benign	0.01
IGL01362:Dnah6	APN	6	73092178	missense	probably damaging	1.00
IGL01373:Dnah6	APN	6	73074748	missense	probably benign	0.10
IGL01559:Dnah6	APN	6	73024252	critical splice donor site	probably null
IGL01622:Dnah6	APN	6	73144718	missense	probably damaging	1.00
IGL01623:Dnah6	APN	6	73144718	missense	probably damaging	1.00
IGL01682:Dnah6	APN	6	73075802	missense	probably damaging	1.00
IGL01735:Dnah6	APN	6	73076660	nonsense	probably null
IGL01736:Dnah6	APN	6	73188377	missense	probably benign	0.06
IGL01825:Dnah6	APN	6	73065776	missense	probably damaging	1.00
IGL01835:Dnah6	APN	6	73135801	missense	probably damaging	1.00
IGL01870:Dnah6	APN	6	73032569	missense	probably benign	0.04
IGL01935:Dnah6	APN	6	73060143	missense	probably benign
IGL02126:Dnah6	APN	6	73103166	missense	probably benign	0.01
IGL02191:Dnah6	APN	6	73017797	missense	probably benign	0.00
IGL02293:Dnah6	APN	6	73133650	splice site	probably benign
IGL02316:Dnah6	APN	6	73168911	missense	probably benign	0.19
IGL02339:Dnah6	APN	6	73101898	missense	probably benign	0.00
IGL02380:Dnah6	APN	6	73076640	missense	probably benign	0.12
IGL02458:Dnah6	APN	6	73027448	missense	probably benign	0.43
IGL02499:Dnah6	APN	6	73021227	missense	probably benign	0.12
IGL02652:Dnah6	APN	6	73095104	missense	probably damaging	1.00
IGL02668:Dnah6	APN	6	73121823	missense	possibly damaging	0.61
IGL02858:Dnah6	APN	6	73208599	missense	probably benign	0.03
IGL02875:Dnah6	APN	6	73138715	missense	probably damaging	0.99
IGL02878:Dnah6	APN	6	73032587	missense	probably benign	0.01
IGL02989:Dnah6	APN	6	73069420	missense	probably damaging	1.00
IGL03001:Dnah6	APN	6	73149140	missense	probably benign	0.19
IGL03135:Dnah6	APN	6	73145004	missense	probably benign	0.00
IGL03145:Dnah6	APN	6	73041054	missense	probably damaging	1.00
IGL03202:Dnah6	APN	6	73144700	missense	probably damaging	1.00
IGL03282:Dnah6	APN	6	73053647	splice site	probably benign
IGL03286:Dnah6	APN	6	73083085	missense	probably damaging	1.00
IGL03372:Dnah6	APN	6	73075850	missense	probably benign	0.15
P0025:Dnah6	UTSW	6	73163504	missense	probably benign	0.00
PIT4305001:Dnah6	UTSW	6	73065755	missense	probably benign	0.03
PIT4466001:Dnah6	UTSW	6	73208641	missense	probably benign	0.00
PIT4480001:Dnah6	UTSW	6	73101880	missense	probably benign	0.00
PIT4515001:Dnah6	UTSW	6	73114582	missense	probably damaging	1.00
PIT4651001:Dnah6	UTSW	6	73060260	missense	probably benign	0.02
R0103:Dnah6	UTSW	6	73092172	missense	probably damaging	1.00
R0103:Dnah6	UTSW	6	73092172	missense	probably damaging	1.00
R0105:Dnah6	UTSW	6	73155279	missense	probably damaging	0.99
R0105:Dnah6	UTSW	6	73155279	missense	probably damaging	0.99
R0127:Dnah6	UTSW	6	73038734	splice site	probably benign
R0164:Dnah6	UTSW	6	73188535	splice site	probably benign
R0165:Dnah6	UTSW	6	73021323	missense	probably benign	0.01
R0183:Dnah6	UTSW	6	73082923	missense	probably damaging	1.00
R0200:Dnah6	UTSW	6	73069420	missense	probably damaging	1.00
R0304:Dnah6	UTSW	6	73159115	missense	probably damaging	1.00
R0324:Dnah6	UTSW	6	73173558	missense	possibly damaging	0.86
R0335:Dnah6	UTSW	6	73069399	splice site	probably benign
R0345:Dnah6	UTSW	6	73021257	missense	probably benign	0.12
R0357:Dnah6	UTSW	6	73188359	missense	probably benign
R0362:Dnah6	UTSW	6	73208609	missense	probably benign	0.06
R0377:Dnah6	UTSW	6	73121992	missense	possibly damaging	0.93
R0386:Dnah6	UTSW	6	73083124	missense	probably damaging	0.99
R0547:Dnah6	UTSW	6	73044774	missense	probably benign	0.15
R0639:Dnah6	UTSW	6	73022412	missense	probably benign	0.02
R0673:Dnah6	UTSW	6	73123811	missense	probably benign	0.01
R0690:Dnah6	UTSW	6	73129474	missense	probably benign	0.01
R0708:Dnah6	UTSW	6	73212622	missense	probably benign	0.05
R0711:Dnah6	UTSW	6	73087602	missense	probably damaging	0.99
R0718:Dnah6	UTSW	6	73035293	missense	possibly damaging	0.80
R0894:Dnah6	UTSW	6	73124757	missense	probably benign	0.00
R0972:Dnah6	UTSW	6	73159193	missense	possibly damaging	0.94
R1263:Dnah6	UTSW	6	73144965	missense	probably damaging	0.99
R1298:Dnah6	UTSW	6	73159135	missense	probably damaging	1.00
R1300:Dnah6	UTSW	6	73124709	missense	probably benign	0.22
R1301:Dnah6	UTSW	6	73208545	critical splice donor site	probably null
R1341:Dnah6	UTSW	6	73191619	missense	probably benign	0.09
R1509:Dnah6	UTSW	6	73027442	missense	probably damaging	1.00
R1519:Dnah6	UTSW	6	73049048	missense	probably damaging	0.97
R1533:Dnah6	UTSW	6	73151553	missense	probably benign
R1557:Dnah6	UTSW	6	73049131	nonsense	probably null
R1591:Dnah6	UTSW	6	73076600	missense	probably benign	0.01
R1602:Dnah6	UTSW	6	73067469	missense	probably damaging	1.00
R1610:Dnah6	UTSW	6	73144963	missense	probably benign	0.09
R1616:Dnah6	UTSW	6	73100112	missense	probably benign	0.10
R1643:Dnah6	UTSW	6	73044752	missense	possibly damaging	0.85
R1644:Dnah6	UTSW	6	73155296	missense	probably benign	0.18
R1655:Dnah6	UTSW	6	73205732	missense	possibly damaging	0.88
R1661:Dnah6	UTSW	6	73124778	missense	probably benign	0.00
R1665:Dnah6	UTSW	6	73124778	missense	probably benign	0.00
R1675:Dnah6	UTSW	6	73129540	missense	probably damaging	1.00
R1734:Dnah6	UTSW	6	73044761	missense	probably damaging	0.98
R1757:Dnah6	UTSW	6	73160982	missense	probably damaging	1.00
R1794:Dnah6	UTSW	6	73024958	missense	probably damaging	0.99
R1831:Dnah6	UTSW	6	73181797	missense	possibly damaging	0.76
R1866:Dnah6	UTSW	6	73100088	missense	probably benign	0.00
R1897:Dnah6	UTSW	6	73181762	missense	probably benign	0.30
R1951:Dnah6	UTSW	6	73084721	nonsense	probably null
R1978:Dnah6	UTSW	6	73121970	missense	possibly damaging	0.51
R1987:Dnah6	UTSW	6	73095044	missense	probably damaging	0.96
R1988:Dnah6	UTSW	6	73092192	missense	probably damaging	1.00
R2012:Dnah6	UTSW	6	73067466	missense	probably damaging	1.00
R2014:Dnah6	UTSW	6	73173419	missense	probably damaging	0.98
R2022:Dnah6	UTSW	6	73027422	missense	probably benign
R2041:Dnah6	UTSW	6	73073439	missense	probably damaging	1.00
R2068:Dnah6	UTSW	6	73021182	missense	probably benign	0.23
R2114:Dnah6	UTSW	6	73144035	missense	probably damaging	1.00
R2152:Dnah6	UTSW	6	73049166	missense	probably benign	0.32
R2163:Dnah6	UTSW	6	73089746	splice site	probably null
R2193:Dnah6	UTSW	6	73138640	missense	probably damaging	1.00
R2235:Dnah6	UTSW	6	73100085	missense	probably damaging	0.96
R2276:Dnah6	UTSW	6	73113581	missense	probably benign	0.15
R2292:Dnah6	UTSW	6	73021109	missense	probably damaging	1.00
R2355:Dnah6	UTSW	6	73156421	missense	possibly damaging	0.95
R2395:Dnah6	UTSW	6	73091967	splice site	probably null
R2436:Dnah6	UTSW	6	73149173	missense	probably benign	0.05
R2847:Dnah6	UTSW	6	73129331	missense	probably benign	0.41
R2848:Dnah6	UTSW	6	73129331	missense	probably benign	0.41
R3033:Dnah6	UTSW	6	73173350	missense	probably benign	0.03
R3429:Dnah6	UTSW	6	73121814	missense	possibly damaging	0.95
R3430:Dnah6	UTSW	6	73121814	missense	possibly damaging	0.95
R3499:Dnah6	UTSW	6	73032633	missense	probably benign	0.21
R3811:Dnah6	UTSW	6	73191498	missense	probably benign	0.00
R3852:Dnah6	UTSW	6	73127927	missense	possibly damaging	0.82
R3975:Dnah6	UTSW	6	73121992	missense	possibly damaging	0.93
R4164:Dnah6	UTSW	6	73089592	nonsense	probably null
R4246:Dnah6	UTSW	6	73129448	missense	probably benign	0.00
R4367:Dnah6	UTSW	6	73149484	missense	possibly damaging	0.95
R4378:Dnah6	UTSW	6	73118026	missense	probably benign	0.01
R4405:Dnah6	UTSW	6	73129291	missense	probably benign	0.00
R4420:Dnah6	UTSW	6	73191479	missense	probably benign
R4486:Dnah6	UTSW	6	73038746	missense	probably damaging	1.00
R4512:Dnah6	UTSW	6	73178416	missense	probably damaging	1.00
R4547:Dnah6	UTSW	6	73192405	missense	probably benign
R4573:Dnah6	UTSW	6	73086181	missense	probably damaging	1.00
R4574:Dnah6	UTSW	6	73086181	missense	probably damaging	1.00
R4590:Dnah6	UTSW	6	73152712	missense	probably damaging	0.99
R4604:Dnah6	UTSW	6	73129660	missense	possibly damaging	0.92
R4652:Dnah6	UTSW	6	73070597	missense	probably benign
R4653:Dnah6	UTSW	6	73073457	missense	possibly damaging	0.76
R4669:Dnah6	UTSW	6	73037688	missense	probably damaging	1.00
R4674:Dnah6	UTSW	6	73192422	missense	probably benign	0.04
R4712:Dnah6	UTSW	6	73025012	critical splice acceptor site	probably null
R4788:Dnah6	UTSW	6	73129530	missense	probably damaging	1.00
R4791:Dnah6	UTSW	6	73095074	missense	probably benign	0.11
R4792:Dnah6	UTSW	6	73089668	missense	probably damaging	0.99
R4801:Dnah6	UTSW	6	73089698	missense	probably damaging	1.00
R4802:Dnah6	UTSW	6	73089698	missense	probably damaging	1.00
R4817:Dnah6	UTSW	6	73022424	missense	probably benign	0.02
R4830:Dnah6	UTSW	6	73044762	missense	possibly damaging	0.85
R4862:Dnah6	UTSW	6	73121788	missense	probably damaging	0.99
R4916:Dnah6	UTSW	6	73192676	intron	probably benign
R4948:Dnah6	UTSW	6	73053689	missense	probably benign	0.00
R4953:Dnah6	UTSW	6	73188383	missense	probably benign	0.19
R5000:Dnah6	UTSW	6	73144815	missense	probably benign	0.26
R5036:Dnah6	UTSW	6	73044691	missense	probably benign
R5044:Dnah6	UTSW	6	73037622	missense	probably benign	0.41
R5143:Dnah6	UTSW	6	73181761	missense	possibly damaging	0.91
R5157:Dnah6	UTSW	6	73195634	missense	probably benign
R5186:Dnah6	UTSW	6	73067427	missense	probably damaging	1.00
R5201:Dnah6	UTSW	6	73195732	missense	possibly damaging	0.82
R5249:Dnah6	UTSW	6	73113488	missense	probably damaging	1.00
R5272:Dnah6	UTSW	6	73127861	critical splice donor site	probably null
R5330:Dnah6	UTSW	6	73074590	missense	probably damaging	1.00
R5331:Dnah6	UTSW	6	73074590	missense	probably damaging	1.00
R5340:Dnah6	UTSW	6	73212620	missense	probably benign
R5343:Dnah6	UTSW	6	73212616	missense	probably benign
R5375:Dnah6	UTSW	6	73123855	missense	probably damaging	1.00
R5380:Dnah6	UTSW	6	73037615	missense	probably damaging	1.00
R5435:Dnah6	UTSW	6	73060138	missense	probably benign	0.00
R5455:Dnah6	UTSW	6	73075734	missense	probably benign	0.00
R5458:Dnah6	UTSW	6	73086185	missense	probably damaging	1.00
R5463:Dnah6	UTSW	6	73092157	missense	probably benign	0.04
R5484:Dnah6	UTSW	6	73092116	missense	possibly damaging	0.95
R5513:Dnah6	UTSW	6	73190419	missense	probably null	0.00
R5527:Dnah6	UTSW	6	73159229	missense	probably benign
R5541:Dnah6	UTSW	6	73192988	missense	possibly damaging	0.91
R5548:Dnah6	UTSW	6	73151689	missense	probably damaging	1.00
R5680:Dnah6	UTSW	6	73149525	missense	probably damaging	1.00
R5689:Dnah6	UTSW	6	73021227	missense	probably benign	0.12
R5966:Dnah6	UTSW	6	73060279	missense	probably benign	0.00
R5980:Dnah6	UTSW	6	73181722	missense	probably benign	0.01
R6049:Dnah6	UTSW	6	73086166	missense	probably benign	0.38
R6092:Dnah6	UTSW	6	73114697	missense	possibly damaging	0.61
R6130:Dnah6	UTSW	6	73188494	missense	probably benign	0.16
R6279:Dnah6	UTSW	6	73065815	missense	probably damaging	1.00
R6300:Dnah6	UTSW	6	73065815	missense	probably damaging	1.00
R6301:Dnah6	UTSW	6	73086217	missense	probably damaging	1.00
R6315:Dnah6	UTSW	6	73191605	missense	probably benign	0.02
R6394:Dnah6	UTSW	6	73155418	nonsense	probably null
R6470:Dnah6	UTSW	6	73074586	missense	probably damaging	1.00
R6526:Dnah6	UTSW	6	73074704	missense	probably benign	0.05
R6545:Dnah6	UTSW	6	73044732	missense	probably damaging	1.00
R6583:Dnah6	UTSW	6	73173533	missense	probably benign	0.02
R6609:Dnah6	UTSW	6	73053695	missense	possibly damaging	0.52
R6638:Dnah6	UTSW	6	73035280	splice site	probably null
R6640:Dnah6	UTSW	6	73024293	missense	probably damaging	1.00
R6647:Dnah6	UTSW	6	73138760	missense	probably damaging	1.00
R6744:Dnah6	UTSW	6	73037549	missense	probably damaging	0.97
R6767:Dnah6	UTSW	6	73133608	missense	probably benign	0.29
R6845:Dnah6	UTSW	6	73133542	missense	probably damaging	1.00
R6913:Dnah6	UTSW	6	73212522	missense	probably benign	0.00
R6918:Dnah6	UTSW	6	73181755	nonsense	probably null
R6929:Dnah6	UTSW	6	73044773	missense	probably damaging	0.96
R6981:Dnah6	UTSW	6	73021178	missense	probably benign	0.00
R7065:Dnah6	UTSW	6	73087562	missense	possibly damaging	0.87
R7139:Dnah6	UTSW	6	73135680	missense	probably damaging	1.00
R7169:Dnah6	UTSW	6	73038746	missense	probably damaging	1.00
R7202:Dnah6	UTSW	6	73181705	critical splice donor site	probably null
R7203:Dnah6	UTSW	6	73173545	missense	probably benign	0.00
R7315:Dnah6	UTSW	6	73084760	missense	probably damaging	1.00
R7329:Dnah6	UTSW	6	73144722	nonsense	probably null
R7387:Dnah6	UTSW	6	73212612	nonsense	probably null
R7388:Dnah6	UTSW	6	73192317	missense	possibly damaging	0.47
R7454:Dnah6	UTSW	6	73212492	missense	probably damaging	1.00
R7520:Dnah6	UTSW	6	73127904	missense	probably benign	0.04
R7524:Dnah6	UTSW	6	73118099	missense	probably damaging	1.00
R7548:Dnah6	UTSW	6	73027440	missense	probably damaging	1.00
R7604:Dnah6	UTSW	6	73092168	missense	probably damaging	1.00
R7615:Dnah6	UTSW	6	73095206	missense	possibly damaging	0.85
R7622:Dnah6	UTSW	6	73124759	missense	possibly damaging	0.94
R7690:Dnah6	UTSW	6	73169080	splice site	probably null
R7735:Dnah6	UTSW	6	73069429	missense	probably damaging	1.00
R7754:Dnah6	UTSW	6	73025720	missense	probably benign	0.41
R7829:Dnah6	UTSW	6	73127919	nonsense	probably null
R7904:Dnah6	UTSW	6	73135467	splice site	probably null
R8034:Dnah6	UTSW	6	73129225	missense	probably damaging	1.00
R8093:Dnah6	UTSW	6	73160913	missense	probably damaging	1.00
R8120:Dnah6	UTSW	6	73025786	missense	probably damaging	1.00
R8178:Dnah6	UTSW	6	73060225	missense	probably benign	0.16
R8206:Dnah6	UTSW	6	73037566	nonsense	probably null
R8214:Dnah6	UTSW	6	73044728	missense	probably damaging	1.00
R8269:Dnah6	UTSW	6	73168827	critical splice donor site	probably null
R8273:Dnah6	UTSW	6	73076599	missense	probably benign	0.31
R8273:Dnah6	UTSW	6	73195681	missense	probably benign	0.00
R8331:Dnah6	UTSW	6	73025000	missense	probably benign	0.10
R8350:Dnah6	UTSW	6	73195815	missense	probably benign	0.41
R8428:Dnah6	UTSW	6	73074651	missense	probably benign	0.15
R8447:Dnah6	UTSW	6	73138774	missense	probably damaging	0.99
R8450:Dnah6	UTSW	6	73195815	missense	probably benign	0.41
R8517:Dnah6	UTSW	6	73178457	missense	probably benign	0.16
R8523:Dnah6	UTSW	6	73095188	missense	probably damaging	1.00
R8691:Dnah6	UTSW	6	73168867	missense	probably damaging	1.00
R8700:Dnah6	UTSW	6	73075890	intron	probably benign
R8737:Dnah6	UTSW	6	73067445	missense	possibly damaging	0.83
R8762:Dnah6	UTSW	6	73179828	missense	possibly damaging	0.83
R8804:Dnah6	UTSW	6	73065773	missense	probably benign
R8809:Dnah6	UTSW	6	73032563	missense	possibly damaging	0.94
R8813:Dnah6	UTSW	6	73127954	missense	probably damaging	1.00
R8849:Dnah6	UTSW	6	73144173	critical splice acceptor site	probably null
R8867:Dnah6	UTSW	6	73021148	missense	probably damaging	1.00
R8882:Dnah6	UTSW	6	73178498	missense	probably benign	0.05
R8973:Dnah6	UTSW	6	73144751	missense	probably benign	0.39
R9049:Dnah6	UTSW	6	73142292	missense	probably damaging	1.00
R9053:Dnah6	UTSW	6	73084657	missense	possibly damaging	0.94
R9064:Dnah6	UTSW	6	73149173	missense	probably benign	0.00
R9077:Dnah6	UTSW	6	73144046	nonsense	probably null
R9102:Dnah6	UTSW	6	73067486	missense	probably benign
R9106:Dnah6	UTSW	6	73144769	missense	probably damaging	1.00
R9119:Dnah6	UTSW	6	73060203	missense	possibly damaging	0.95
R9124:Dnah6	UTSW	6	73121899	missense	possibly damaging	0.78
R9165:Dnah6	UTSW	6	73144941	missense	probably damaging	1.00
R9182:Dnah6	UTSW	6	73144705	nonsense	probably null
R9200:Dnah6	UTSW	6	73027514	missense	probably benign	0.06
R9265:Dnah6	UTSW	6	73083057	missense	probably benign	0.02
R9368:Dnah6	UTSW	6	73021278	missense	probably benign	0.22
R9378:Dnah6	UTSW	6	73212530	missense	probably benign
R9439:Dnah6	UTSW	6	73035347	missense	possibly damaging	0.66
R9506:Dnah6	UTSW	6	73142316	missense	probably damaging	1.00
R9645:Dnah6	UTSW	6	73138767	missense	possibly damaging	0.82
R9731:Dnah6	UTSW	6	73191606	missense	probably benign	0.00
RF002:Dnah6	UTSW	6	73101889	missense	probably benign
RF020:Dnah6	UTSW	6	73118057	missense	probably benign	0.00
W0251:Dnah6	UTSW	6	73178518	missense	possibly damaging	0.95
X0025:Dnah6	UTSW	6	73037673	missense	probably damaging	1.00
X0025:Dnah6	UTSW	6	73191500	missense	probably benign	0.01
Z1176:Dnah6	UTSW	6	73087783	missense	possibly damaging	0.79
Z1176:Dnah6	UTSW	6	73133559	missense	probably benign
Z1177:Dnah6	UTSW	6	73021237	missense	probably benign	0.13
Z1177:Dnah6	UTSW	6	73032526	missense	probably damaging	0.99
Z1177:Dnah6	UTSW	6	73041138	missense	probably damaging	1.00
Z1177:Dnah6	UTSW	6	73155272	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- ACATGGGCTGTATGGGCTTC -3'
(R):5'- AAAGGCCTCCCTGTTTACAAG -3'

Sequencing Primer
(F):5'- GGGCTTCATACATCACCTCATACATG -3'
(R):5'- GGATAGTTTGCAAGTCCCACCTAAG -3'

Posted On

2019-10-17