Incidental Mutation 'R7570:Psg22'
ID 585707
Institutional Source Beutler Lab
Gene Symbol Psg22
Ensembl Gene ENSMUSG00000044903
Gene Name pregnancy-specific beta-1-glycoprotein 22
Synonyms cea9
MMRRC Submission 045631-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.052) question?
Stock # R7570 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 18452015-18461173 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 18456660 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Tyrosine at position 181 (S181Y)
Ref Sequence ENSEMBL: ENSMUSP00000104121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051973] [ENSMUST00000108481] [ENSMUST00000208221]
AlphaFold Q810J1
Predicted Effect possibly damaging
Transcript: ENSMUST00000051973
AA Change: S142Y

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000050633
Gene: ENSMUSG00000044903
AA Change: S142Y

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
IG 40 141 7.59e-4 SMART
IG 160 261 1.13e-2 SMART
IG 280 381 3.74e-3 SMART
IGc2 397 461 7.35e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108481
AA Change: S181Y

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104121
Gene: ENSMUSG00000044903
AA Change: S181Y

DomainStartEndE-ValueType
low complexity region 58 69 N/A INTRINSIC
IG 79 180 7.59e-4 SMART
IG 199 300 1.13e-2 SMART
IG 319 420 3.74e-3 SMART
IGc2 436 500 7.35e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000208221
AA Change: S142Y

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (104/106)
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik C T 6: 91,911,591 (GRCm39) T613I probably benign Het
Ajuba T C 14: 54,813,859 (GRCm39) E288G probably damaging Het
Ankrd12 C T 17: 66,292,355 (GRCm39) R1026K probably benign Het
Apol7b T C 15: 77,307,674 (GRCm39) T274A probably benign Het
Arid4a A T 12: 71,109,916 (GRCm39) R86* probably null Het
Asnsd1 C T 1: 53,387,417 (GRCm39) G70D probably damaging Het
Atg4c T A 4: 99,116,797 (GRCm39) V313D possibly damaging Het
Atp13a5 A C 16: 29,085,715 (GRCm39) C885G probably damaging Het
Bpifb9a A T 2: 154,104,183 (GRCm39) I209F possibly damaging Het
Bsn T C 9: 107,990,742 (GRCm39) D1670G probably damaging Het
Cct8 T A 16: 87,288,210 (GRCm39) I121F probably benign Het
Cd209a T G 8: 3,794,151 (GRCm39) D217A probably damaging Het
Cdk19 C T 10: 40,353,954 (GRCm39) S456L possibly damaging Het
Chd9 C T 8: 91,721,208 (GRCm39) H999Y unknown Het
Col5a1 G A 2: 27,841,395 (GRCm39) V339M unknown Het
Cr2 G A 1: 194,851,648 (GRCm39) R115* probably null Het
Cyb561 A T 11: 105,828,470 (GRCm39) F62I probably damaging Het
Cyp2c38 A T 19: 39,393,187 (GRCm39) N293K possibly damaging Het
Cyp2c69 A T 19: 39,848,342 (GRCm39) D293E probably damaging Het
Dcbld2 T A 16: 58,244,932 (GRCm39) C69S possibly damaging Het
Dcdc2a T C 13: 25,303,356 (GRCm39) S296P probably benign Het
Dmxl1 T A 18: 50,027,024 (GRCm39) I2044K possibly damaging Het
Dnah5 A G 15: 28,347,098 (GRCm39) D2527G probably damaging Het
Dnah6 T C 6: 73,126,413 (GRCm39) T1305A probably benign Het
Dnajc9 A G 14: 20,438,712 (GRCm39) V47A probably benign Het
Dnmt3b A G 2: 153,518,619 (GRCm39) Y594C probably damaging Het
Dph7 A G 2: 24,855,642 (GRCm39) D147G probably damaging Het
Drap1 T C 19: 5,473,380 (GRCm39) H164R possibly damaging Het
Dsg3 T A 18: 20,660,837 (GRCm39) V392E possibly damaging Het
Dxo A G 17: 35,056,616 (GRCm39) D81G probably benign Het
E230025N22Rik G T 18: 36,828,645 (GRCm39) T11K probably benign Het
Esyt1 A G 10: 128,354,801 (GRCm39) V533A possibly damaging Het
Etv3 T A 3: 87,443,338 (GRCm39) C307* probably null Het
Fam114a1 T A 5: 65,187,402 (GRCm39) probably null Het
Fam3c T A 6: 22,326,404 (GRCm39) probably benign Het
Fbn1 G T 2: 125,239,772 (GRCm39) T305K probably benign Het
Ggt1 A T 10: 75,421,428 (GRCm39) I484F probably damaging Het
Gpatch1 T C 7: 34,993,237 (GRCm39) D536G probably damaging Het
Gpx4 T C 10: 79,890,875 (GRCm39) I189T probably damaging Het
Gsr T A 8: 34,159,193 (GRCm39) C85S probably damaging Het
Gsta5 A T 9: 78,211,751 (GRCm39) D171V possibly damaging Het
Havcr1 T A 11: 46,661,369 (GRCm39) probably null Het
Heatr4 T C 12: 84,026,418 (GRCm39) T280A probably benign Het
Hmcn2 A T 2: 31,313,923 (GRCm39) E3532D probably benign Het
Hnrnpc T C 14: 52,312,556 (GRCm39) N308S possibly damaging Het
Ighv8-9 A G 12: 115,432,358 (GRCm39) V13A probably benign Het
Itgb2l A T 16: 96,227,439 (GRCm39) F535I probably benign Het
Kdm5a T G 6: 120,404,803 (GRCm39) D1348E probably damaging Het
Kndc1 CT C 7: 139,503,691 (GRCm39) probably null Het
Ky A G 9: 102,419,528 (GRCm39) I512V probably benign Het
Lamc1 A T 1: 153,119,021 (GRCm39) F866Y possibly damaging Het
Lbx1 C A 19: 45,223,687 (GRCm39) probably benign Het
Magel2 A G 7: 62,028,658 (GRCm39) T521A possibly damaging Het
Mgam A T 6: 40,723,367 (GRCm39) I491L probably benign Het
Mitd1 T C 1: 37,929,273 (GRCm39) E40G probably damaging Het
Mpzl3 A G 9: 44,981,985 (GRCm39) T218A probably benign Het
Mrpl42 A G 10: 95,316,827 (GRCm39) S77P probably benign Het
Mup5 C T 4: 61,752,911 (GRCm39) W37* probably null Het
Myh14 T C 7: 44,281,850 (GRCm39) I803V probably benign Het
Ncor2 T A 5: 125,107,153 (GRCm39) T744S Het
Ndufv3 A G 17: 31,746,596 (GRCm39) D162G probably damaging Het
Nostrin A G 2: 69,006,150 (GRCm39) E278G probably damaging Het
Nrxn1 T G 17: 90,469,807 (GRCm39) E1288A probably benign Het
Or4c11c A G 2: 88,661,472 (GRCm39) N4D possibly damaging Het
Or51b6b C A 7: 103,310,088 (GRCm39) R123L probably damaging Het
Or52h1 T A 7: 103,828,955 (GRCm39) Y220F probably damaging Het
Or8g55 A T 9: 39,784,751 (GRCm39) Y60F possibly damaging Het
Patj T A 4: 98,312,737 (GRCm39) probably null Het
Pcm1 T G 8: 41,720,381 (GRCm39) I314R possibly damaging Het
Pcsk6 A G 7: 65,683,646 (GRCm39) T754A probably benign Het
Pde2a A T 7: 101,152,041 (GRCm39) N326I probably benign Het
Plekhg4 T C 8: 106,105,316 (GRCm39) S594P possibly damaging Het
Plekhm3 T C 1: 64,977,065 (GRCm39) D135G probably damaging Het
Plin4 A T 17: 56,413,776 (GRCm39) M283K probably benign Het
Ppfia3 T C 7: 44,990,172 (GRCm39) probably null Het
Prdm9 T C 17: 15,775,914 (GRCm39) N179S probably benign Het
Prrt3 T C 6: 113,471,449 (GRCm39) S908G probably damaging Het
Rcor3 C A 1: 191,822,173 (GRCm39) G8V probably damaging Het
Rp1l1 T A 14: 64,269,023 (GRCm39) C1536* probably null Het
Rpp25l T C 4: 41,712,529 (GRCm39) H82R probably damaging Het
Rps3a1 T A 3: 86,046,396 (GRCm39) M172L probably benign Het
Rtbdn T C 8: 85,679,556 (GRCm39) L110P probably damaging Het
Ryr1 T A 7: 28,778,010 (GRCm39) Q2169L probably damaging Het
Scn4a A T 11: 106,211,299 (GRCm39) C1573S possibly damaging Het
Sec16b A T 1: 157,358,965 (GRCm39) probably null Het
Serpina1a A T 12: 103,820,096 (GRCm39) D383E possibly damaging Het
Sh3gl3 T C 7: 81,934,285 (GRCm39) M262T probably benign Het
Sos2 G A 12: 69,637,654 (GRCm39) T1052M probably damaging Het
Spag16 G A 1: 70,036,000 (GRCm39) V343I probably benign Het
Spocd1 T G 4: 129,823,957 (GRCm39) D251E Het
Stc2 G T 11: 31,317,798 (GRCm39) N74K probably damaging Het
Tasor2 A G 13: 3,623,621 (GRCm39) Y2110H probably damaging Het
Thbs3 C T 3: 89,126,359 (GRCm39) Q227* probably null Het
Tmem92 A C 11: 94,669,816 (GRCm39) I105R probably benign Het
Tmod1 T A 4: 46,083,632 (GRCm39) N20K probably benign Het
Tns1 T C 1: 73,992,638 (GRCm39) D53G probably damaging Het
Tspan33 T A 6: 29,717,337 (GRCm39) L246Q probably damaging Het
Ttc16 A G 2: 32,658,980 (GRCm39) L392P probably damaging Het
Uggt1 T A 1: 36,224,919 (GRCm39) T572S probably benign Het
Usp17la A T 7: 104,509,604 (GRCm39) T70S probably damaging Het
Usp31 C T 7: 121,274,186 (GRCm39) R370H probably damaging Het
Wdr83 C T 8: 85,806,463 (GRCm39) V112M probably damaging Het
Zbtb25 T A 12: 76,416,366 (GRCm39) probably benign Het
Zfp110 T A 7: 12,583,267 (GRCm39) N638K possibly damaging Het
Zfp747l1 T A 7: 126,984,455 (GRCm39) S216C probably benign Het
Zfp820 T C 17: 22,037,994 (GRCm39) T445A probably benign Het
Other mutations in Psg22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00797:Psg22 APN 7 18,452,200 (GRCm39) missense probably benign 0.00
IGL00839:Psg22 APN 7 18,456,893 (GRCm39) missense probably benign 0.01
IGL00898:Psg22 APN 7 18,458,392 (GRCm39) missense probably damaging 1.00
IGL02262:Psg22 APN 7 18,458,496 (GRCm39) missense probably damaging 0.98
IGL02678:Psg22 APN 7 18,453,418 (GRCm39) missense probably damaging 0.99
IGL02749:Psg22 APN 7 18,456,944 (GRCm39) missense possibly damaging 0.50
IGL02928:Psg22 APN 7 18,453,458 (GRCm39) missense probably damaging 0.98
IGL02977:Psg22 APN 7 18,453,524 (GRCm39) missense probably benign 0.20
R0470:Psg22 UTSW 7 18,453,589 (GRCm39) missense probably damaging 0.99
R1902:Psg22 UTSW 7 18,458,363 (GRCm39) nonsense probably null
R1935:Psg22 UTSW 7 18,453,635 (GRCm39) missense probably damaging 0.99
R1936:Psg22 UTSW 7 18,453,635 (GRCm39) missense probably damaging 0.99
R2013:Psg22 UTSW 7 18,453,560 (GRCm39) missense possibly damaging 0.93
R2278:Psg22 UTSW 7 18,460,762 (GRCm39) missense possibly damaging 0.80
R4258:Psg22 UTSW 7 18,458,554 (GRCm39) missense probably damaging 1.00
R5029:Psg22 UTSW 7 18,453,662 (GRCm39) missense probably damaging 1.00
R5885:Psg22 UTSW 7 18,452,257 (GRCm39) missense probably damaging 0.98
R6084:Psg22 UTSW 7 18,453,705 (GRCm39) missense probably benign 0.01
R6143:Psg22 UTSW 7 18,456,723 (GRCm39) missense probably benign 0.03
R6209:Psg22 UTSW 7 18,453,599 (GRCm39) missense probably damaging 1.00
R7017:Psg22 UTSW 7 18,458,366 (GRCm39) missense probably benign 0.01
R7337:Psg22 UTSW 7 18,453,499 (GRCm39) missense probably benign 0.20
R7417:Psg22 UTSW 7 18,456,891 (GRCm39) missense probably damaging 1.00
R7460:Psg22 UTSW 7 18,458,329 (GRCm39) missense probably benign 0.03
R7650:Psg22 UTSW 7 18,460,684 (GRCm39) missense possibly damaging 0.66
R7711:Psg22 UTSW 7 18,452,267 (GRCm39) critical splice donor site probably null
R7991:Psg22 UTSW 7 18,460,861 (GRCm39) missense probably damaging 1.00
R8001:Psg22 UTSW 7 18,453,671 (GRCm39) missense possibly damaging 0.79
R8003:Psg22 UTSW 7 18,458,350 (GRCm39) missense probably damaging 1.00
R8066:Psg22 UTSW 7 18,452,218 (GRCm39) missense possibly damaging 0.88
R8113:Psg22 UTSW 7 18,456,987 (GRCm39) missense probably benign 0.00
R9136:Psg22 UTSW 7 18,460,811 (GRCm39) missense probably damaging 1.00
R9148:Psg22 UTSW 7 18,460,682 (GRCm39) missense probably benign 0.09
R9152:Psg22 UTSW 7 18,460,646 (GRCm39) missense probably damaging 0.97
R9344:Psg22 UTSW 7 18,460,816 (GRCm39) missense possibly damaging 0.69
R9666:Psg22 UTSW 7 18,458,248 (GRCm39) missense probably benign
R9801:Psg22 UTSW 7 18,456,899 (GRCm39) missense probably benign 0.11
X0064:Psg22 UTSW 7 18,452,106 (GRCm39) missense probably benign 0.01
Z1177:Psg22 UTSW 7 18,453,602 (GRCm39) missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- AAATGACAACCGAGGGTCAC -3'
(R):5'- ATCTCTCTACCGCTGTAGGC -3'

Sequencing Primer
(F):5'- AACCGAGGGTCACTGAGCAC -3'
(R):5'- GACTGTTCTGTGCCGAGCAATC -3'
Posted On 2019-10-17