Incidental Mutation 'R7570:Ryr1'
ID585708
Institutional Source Beutler Lab
Gene Symbol Ryr1
Ensembl Gene ENSMUSG00000030592
Gene Nameryanodine receptor 1, skeletal muscle
Synonymsskrr, calcium release channel isoform 1, Ryr
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7570 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location29003344-29125179 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29078585 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 2169 (Q2169L)
Ref Sequence ENSEMBL: ENSMUSP00000149042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032813] [ENSMUST00000179893] [ENSMUST00000214374]
Predicted Effect probably damaging
Transcript: ENSMUST00000032813
AA Change: Q2162L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000032813
Gene: ENSMUSG00000030592
AA Change: Q2162L

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
MIR 99 154 7.52e-4 SMART
MIR 161 206 1.11e-6 SMART
MIR 212 266 1.23e-8 SMART
MIR 272 362 1.05e-25 SMART
Pfam:RYDR_ITPR 441 645 1.2e-73 PFAM
SPRY 660 798 2.79e-27 SMART
Pfam:RyR 851 945 6.5e-33 PFAM
Pfam:RyR 965 1059 1.5e-30 PFAM
SPRY 1086 1209 8.62e-42 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1340 1349 N/A INTRINSIC
SPRY 1431 1571 3.05e-33 SMART
low complexity region 1787 1798 N/A INTRINSIC
coiled coil region 1871 1932 N/A INTRINSIC
low complexity region 1989 1998 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2069 2092 N/A INTRINSIC
Pfam:RYDR_ITPR 2158 2366 7e-66 PFAM
low complexity region 2390 2404 N/A INTRINSIC
Pfam:RyR 2735 2829 9.7e-34 PFAM
Pfam:RyR 2855 2943 5.7e-32 PFAM
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3290 3304 N/A INTRINSIC
low complexity region 3375 3394 N/A INTRINSIC
PDB:2BCX|B 3613 3642 2e-13 PDB
low complexity region 3681 3691 N/A INTRINSIC
low complexity region 3735 3760 N/A INTRINSIC
Pfam:RIH_assoc 3872 4004 1.9e-41 PFAM
low complexity region 4010 4023 N/A INTRINSIC
Pfam:EF-hand_8 4085 4136 9.8e-8 PFAM
transmembrane domain 4283 4305 N/A INTRINSIC
transmembrane domain 4318 4336 N/A INTRINSIC
transmembrane domain 4341 4363 N/A INTRINSIC
Pfam:RR_TM4-6 4377 4666 2e-86 PFAM
Pfam:Ion_trans 4761 4932 3.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179893
AA Change: Q2162L

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000137123
Gene: ENSMUSG00000030592
AA Change: Q2162L

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
MIR 99 154 7.52e-4 SMART
MIR 161 206 1.11e-6 SMART
MIR 212 266 1.23e-8 SMART
MIR 272 362 1.05e-25 SMART
Pfam:RYDR_ITPR 443 638 4.5e-63 PFAM
SPRY 660 798 2.79e-27 SMART
Pfam:RyR 852 942 1.3e-37 PFAM
Pfam:RyR 966 1056 1.6e-28 PFAM
SPRY 1086 1209 8.62e-42 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1340 1349 N/A INTRINSIC
SPRY 1431 1571 3.05e-33 SMART
low complexity region 1787 1798 N/A INTRINSIC
coiled coil region 1871 1932 N/A INTRINSIC
low complexity region 1989 1998 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2069 2092 N/A INTRINSIC
Pfam:RYDR_ITPR 2160 2366 2.2e-68 PFAM
low complexity region 2390 2404 N/A INTRINSIC
Pfam:RyR 2736 2826 7.2e-31 PFAM
Pfam:RyR 2856 2940 5.6e-27 PFAM
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3290 3304 N/A INTRINSIC
low complexity region 3375 3394 N/A INTRINSIC
PDB:2BCX|B 3615 3644 2e-13 PDB
low complexity region 3683 3693 N/A INTRINSIC
low complexity region 3737 3762 N/A INTRINSIC
Pfam:RIH_assoc 3878 3996 6.2e-35 PFAM
low complexity region 4012 4025 N/A INTRINSIC
Pfam:EF-hand_8 4087 4137 1.8e-8 PFAM
transmembrane domain 4285 4307 N/A INTRINSIC
transmembrane domain 4320 4338 N/A INTRINSIC
transmembrane domain 4343 4365 N/A INTRINSIC
Pfam:RR_TM4-6 4379 4668 8.4e-76 PFAM
Pfam:Ion_trans 4763 4946 2.8e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214374
AA Change: Q2169L

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in skeletal muscle. The encoded protein functions as a calcium release channel in the sarcoplasmic reticulum but also serves to connect the sarcoplasmic reticulum and transverse tubule. Mutations in this gene are associated with malignant hyperthermia susceptibility, central core disease, and minicore myopathy with external ophthalmoplegia. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation and a similar ENU-induced mutation are born with a rounded body shape, edema, thin and misshapened ribs, and abnormal muscle fibers. Mutants die perinatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik C T 6: 91,934,610 T613I probably benign Het
9130019O22Rik T A 7: 127,385,283 S216C probably benign Het
Ajuba T C 14: 54,576,402 E288G probably damaging Het
Ankrd12 C T 17: 65,985,360 R1026K probably benign Het
Apol7b T C 15: 77,423,474 T274A probably benign Het
Arid4a A T 12: 71,063,142 R86* probably null Het
Asnsd1 C T 1: 53,348,258 G70D probably damaging Het
Atg4c T A 4: 99,228,560 V313D possibly damaging Het
Atp13a5 A C 16: 29,266,963 C885G probably damaging Het
Bpifb9a A T 2: 154,262,263 I209F possibly damaging Het
Bsn T C 9: 108,113,543 D1670G probably damaging Het
Cct8 T A 16: 87,491,322 I121F probably benign Het
Cd209a T G 8: 3,744,151 D217A probably damaging Het
Cdk19 C T 10: 40,477,958 S456L possibly damaging Het
Chd9 C T 8: 90,994,580 H999Y unknown Het
Col5a1 G A 2: 27,951,383 V339M unknown Het
Cr2 G A 1: 195,169,340 R115* probably null Het
Cyb561 A T 11: 105,937,644 F62I probably damaging Het
Cyp2c38 A T 19: 39,404,743 N293K possibly damaging Het
Cyp2c69 A T 19: 39,859,898 D293E probably damaging Het
Dcbld2 T A 16: 58,424,569 C69S possibly damaging Het
Dcdc2a T C 13: 25,119,373 S296P probably benign Het
Dmxl1 T A 18: 49,893,957 I2044K possibly damaging Het
Dnah5 A G 15: 28,346,952 D2527G probably damaging Het
Dnah6 T C 6: 73,149,430 T1305A probably benign Het
Dnajc9 A G 14: 20,388,644 V47A probably benign Het
Dnmt3b A G 2: 153,676,699 Y594C probably damaging Het
Dph7 A G 2: 24,965,630 D147G probably damaging Het
Drap1 T C 19: 5,423,352 H164R possibly damaging Het
Dsg3 T A 18: 20,527,780 V392E possibly damaging Het
Dxo A G 17: 34,837,640 D81G probably benign Het
E230025N22Rik G T 18: 36,695,592 T11K probably benign Het
Esyt1 A G 10: 128,518,932 V533A possibly damaging Het
Etv3 T A 3: 87,536,031 C307* probably null Het
Fam114a1 T A 5: 65,030,059 probably null Het
Fam208b A G 13: 3,573,621 Y2110H probably damaging Het
Fbn1 G T 2: 125,397,852 T305K probably benign Het
Ggt1 A T 10: 75,585,594 I484F probably damaging Het
Gm10639 A T 9: 78,304,469 D171V possibly damaging Het
Gpatch1 T C 7: 35,293,812 D536G probably damaging Het
Gpx4 T C 10: 80,055,041 I189T probably damaging Het
Gsr T A 8: 33,669,165 C85S probably damaging Het
Havcr1 T A 11: 46,770,542 probably null Het
Heatr4 T C 12: 83,979,644 T280A probably benign Het
Hmcn2 A T 2: 31,423,911 E3532D probably benign Het
Hnrnpc T C 14: 52,075,099 N308S possibly damaging Het
Ighv8-9 A G 12: 115,468,738 V13A probably benign Het
Itgb2l A T 16: 96,426,239 F535I probably benign Het
Kdm5a T G 6: 120,427,842 D1348E probably damaging Het
Kndc1 CT C 7: 139,923,775 probably null Het
Ky A G 9: 102,542,329 I512V probably benign Het
Lamc1 A T 1: 153,243,275 F866Y possibly damaging Het
Lbx1 C A 19: 45,235,248 probably benign Het
Magel2 A G 7: 62,378,910 T521A possibly damaging Het
Mgam A T 6: 40,746,433 I491L probably benign Het
Mitd1 T C 1: 37,890,192 E40G probably damaging Het
Mpzl3 A G 9: 45,070,687 T218A probably benign Het
Mrpl42 A G 10: 95,480,965 S77P probably benign Het
Mup5 C T 4: 61,834,674 W37* probably null Het
Myh14 T C 7: 44,632,426 I803V probably benign Het
Ncor2 T A 5: 125,030,089 T744S Het
Ndufv3 A G 17: 31,527,622 D162G probably damaging Het
Nostrin A G 2: 69,175,806 E278G probably damaging Het
Nrxn1 T G 17: 90,162,379 E1288A probably benign Het
Olfr1205 A G 2: 88,831,128 N4D possibly damaging Het
Olfr623 C A 7: 103,660,881 R123L probably damaging Het
Olfr648 T A 7: 104,179,748 Y220F probably damaging Het
Olfr972 A T 9: 39,873,455 Y60F possibly damaging Het
Patj T A 4: 98,424,500 probably null Het
Pcm1 T G 8: 41,267,344 I314R possibly damaging Het
Pcsk6 A G 7: 66,033,898 T754A probably benign Het
Pde2a A T 7: 101,502,834 N326I probably benign Het
Plekhg4 T C 8: 105,378,684 S594P possibly damaging Het
Plekhm3 T C 1: 64,937,906 D135G probably damaging Het
Plin4 A T 17: 56,106,776 M283K probably benign Het
Ppfia3 T C 7: 45,340,748 probably null Het
Prdm9 T C 17: 15,555,652 N179S probably benign Het
Prrt3 T C 6: 113,494,488 S908G probably damaging Het
Psg22 C A 7: 18,722,735 S181Y possibly damaging Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rp1l1 T A 14: 64,031,574 C1536* probably null Het
Rpp25l T C 4: 41,712,529 H82R probably damaging Het
Rps3a1 T A 3: 86,139,089 M172L probably benign Het
Rtbdn T C 8: 84,952,927 L110P probably damaging Het
Scn4a A T 11: 106,320,473 C1573S possibly damaging Het
Sec16b A T 1: 157,531,395 probably null Het
Serpina1a A T 12: 103,853,837 D383E possibly damaging Het
Sh3gl3 T C 7: 82,285,077 M262T probably benign Het
Sos2 G A 12: 69,590,880 T1052M probably damaging Het
Spag16 G A 1: 69,996,841 V343I probably benign Het
Spocd1 T G 4: 129,930,164 D251E Het
Stc2 G T 11: 31,367,798 N74K probably damaging Het
Thbs3 C T 3: 89,219,052 Q227* probably null Het
Tmem92 A C 11: 94,778,990 I105R probably benign Het
Tmod1 T A 4: 46,083,632 N20K probably benign Het
Tns1 T C 1: 73,953,479 D53G probably damaging Het
Tspan33 T A 6: 29,717,338 L246Q probably damaging Het
Ttc16 A G 2: 32,768,968 L392P probably damaging Het
Uggt1 T A 1: 36,185,838 T572S probably benign Het
Usp17la A T 7: 104,860,397 T70S probably damaging Het
Usp31 C T 7: 121,674,963 R370H probably damaging Het
Wdr83 C T 8: 85,079,834 V112M probably damaging Het
Zbtb25 T A 12: 76,369,592 probably benign Het
Zfp110 T A 7: 12,849,340 N638K possibly damaging Het
Zfp820 T C 17: 21,819,013 T445A probably benign Het
Other mutations in Ryr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ryr1 APN 7 29102810 missense probably damaging 1.00
IGL00335:Ryr1 APN 7 29124960 splice site probably null
IGL00427:Ryr1 APN 7 29104737 splice site probably benign
IGL00559:Ryr1 APN 7 29012242 splice site probably benign
IGL00803:Ryr1 APN 7 29069645 missense possibly damaging 0.95
IGL00886:Ryr1 APN 7 29024229 missense probably damaging 1.00
IGL00948:Ryr1 APN 7 29020195 missense possibly damaging 0.78
IGL01017:Ryr1 APN 7 29082543 missense probably damaging 0.99
IGL01116:Ryr1 APN 7 29100202 splice site probably benign
IGL01385:Ryr1 APN 7 29056985 missense probably damaging 1.00
IGL01482:Ryr1 APN 7 29052337 missense probably damaging 1.00
IGL01529:Ryr1 APN 7 29075227 missense probably damaging 1.00
IGL01543:Ryr1 APN 7 29091076 missense probably damaging 1.00
IGL01653:Ryr1 APN 7 29078597 missense probably damaging 0.99
IGL01701:Ryr1 APN 7 29059810 missense probably damaging 0.98
IGL02051:Ryr1 APN 7 29071658 missense probably benign 0.16
IGL02152:Ryr1 APN 7 29052015 missense possibly damaging 0.95
IGL02271:Ryr1 APN 7 29094047 missense probably benign 0.07
IGL02321:Ryr1 APN 7 29078696 missense probably damaging 1.00
IGL02448:Ryr1 APN 7 29105066 splice site probably benign
IGL02472:Ryr1 APN 7 29040844 missense probably damaging 1.00
IGL02544:Ryr1 APN 7 29115599 missense probably benign 0.24
IGL02666:Ryr1 APN 7 29019763 missense unknown
IGL02672:Ryr1 APN 7 29004519 unclassified probably benign
IGL02677:Ryr1 APN 7 29110608 missense probably benign 0.18
IGL02686:Ryr1 APN 7 29069550 splice site probably benign
IGL02751:Ryr1 APN 7 29078774 missense probably damaging 1.00
IGL02899:Ryr1 APN 7 29048795 missense possibly damaging 0.53
IGL02926:Ryr1 APN 7 29061540 missense probably damaging 1.00
IGL02950:Ryr1 APN 7 29097459 missense probably damaging 1.00
IGL02960:Ryr1 APN 7 29060053 missense probably damaging 1.00
IGL02968:Ryr1 APN 7 29043893 missense probably damaging 1.00
IGL03070:Ryr1 APN 7 29070659 missense probably damaging 1.00
IGL03091:Ryr1 APN 7 29083486 missense possibly damaging 0.85
IGL03100:Ryr1 APN 7 29104593 missense probably damaging 1.00
IGL03107:Ryr1 APN 7 29075199 missense probably damaging 1.00
IGL03117:Ryr1 APN 7 29102964 missense probably damaging 1.00
IGL03118:Ryr1 APN 7 29015786 missense unknown
IGL03146:Ryr1 APN 7 29094032 missense probably benign 0.09
IGL03165:Ryr1 APN 7 29105040 missense probably benign 0.22
IGL03220:Ryr1 APN 7 29059855 missense probably damaging 1.00
R0017:Ryr1 UTSW 7 29047542 missense probably damaging 1.00
R0066:Ryr1 UTSW 7 29005567 unclassified probably benign
R0066:Ryr1 UTSW 7 29005567 unclassified probably benign
R0069:Ryr1 UTSW 7 29110505 splice site probably benign
R0148:Ryr1 UTSW 7 29052035 missense probably damaging 0.99
R0266:Ryr1 UTSW 7 29040679 missense probably damaging 1.00
R0346:Ryr1 UTSW 7 29067588 splice site probably benign
R0387:Ryr1 UTSW 7 29083367 splice site probably benign
R0454:Ryr1 UTSW 7 29036075 missense probably damaging 0.99
R0494:Ryr1 UTSW 7 29003793 splice site probably benign
R0533:Ryr1 UTSW 7 29078780 missense probably damaging 1.00
R0585:Ryr1 UTSW 7 29036076 missense probably damaging 1.00
R0591:Ryr1 UTSW 7 29104795 missense possibly damaging 0.68
R0624:Ryr1 UTSW 7 29074609 missense probably damaging 1.00
R0662:Ryr1 UTSW 7 29100189 missense probably damaging 1.00
R0849:Ryr1 UTSW 7 29040679 missense probably damaging 1.00
R0961:Ryr1 UTSW 7 29009697 missense unknown
R1052:Ryr1 UTSW 7 29096258 missense probably damaging 0.96
R1218:Ryr1 UTSW 7 29086109 missense possibly damaging 0.79
R1340:Ryr1 UTSW 7 29116012 missense probably damaging 0.99
R1513:Ryr1 UTSW 7 29070621 missense probably damaging 1.00
R1543:Ryr1 UTSW 7 29083537 missense possibly damaging 0.67
R1566:Ryr1 UTSW 7 29092175 missense possibly damaging 0.95
R1572:Ryr1 UTSW 7 29062191 missense probably damaging 1.00
R1623:Ryr1 UTSW 7 29095490 missense probably damaging 1.00
R1632:Ryr1 UTSW 7 29094261 missense probably benign 0.03
R1661:Ryr1 UTSW 7 29101738 missense probably damaging 0.98
R1665:Ryr1 UTSW 7 29036078 missense probably damaging 1.00
R1678:Ryr1 UTSW 7 29116154 missense probably damaging 0.99
R1705:Ryr1 UTSW 7 29078564 missense probably damaging 1.00
R1712:Ryr1 UTSW 7 29047503 missense probably benign 0.25
R1720:Ryr1 UTSW 7 29101870 missense probably damaging 0.99
R1799:Ryr1 UTSW 7 29067621 missense probably damaging 1.00
R1847:Ryr1 UTSW 7 29079811 missense probably benign 0.43
R1860:Ryr1 UTSW 7 29009552 missense unknown
R1861:Ryr1 UTSW 7 29009552 missense unknown
R1921:Ryr1 UTSW 7 29054944 missense probably damaging 1.00
R1983:Ryr1 UTSW 7 29059472 missense possibly damaging 0.74
R2043:Ryr1 UTSW 7 29059631 missense probably damaging 0.99
R2089:Ryr1 UTSW 7 29086049 missense probably damaging 1.00
R2091:Ryr1 UTSW 7 29086049 missense probably damaging 1.00
R2091:Ryr1 UTSW 7 29086049 missense probably damaging 1.00
R2105:Ryr1 UTSW 7 29090150 missense probably damaging 0.99
R2175:Ryr1 UTSW 7 29068442 missense probably damaging 1.00
R2259:Ryr1 UTSW 7 29019741 missense unknown
R2291:Ryr1 UTSW 7 29098777 missense probably damaging 1.00
R2351:Ryr1 UTSW 7 29075293 missense probably benign 0.18
R2512:Ryr1 UTSW 7 29103542 missense possibly damaging 0.64
R2571:Ryr1 UTSW 7 29009562 missense unknown
R2571:Ryr1 UTSW 7 29036126 missense possibly damaging 0.94
R2885:Ryr1 UTSW 7 29074798 missense probably damaging 0.99
R2886:Ryr1 UTSW 7 29074798 missense probably damaging 0.99
R2889:Ryr1 UTSW 7 29078741 missense possibly damaging 0.76
R3051:Ryr1 UTSW 7 29053090 missense probably damaging 1.00
R3052:Ryr1 UTSW 7 29053090 missense probably damaging 1.00
R3053:Ryr1 UTSW 7 29053090 missense probably damaging 1.00
R3082:Ryr1 UTSW 7 29045646 missense probably damaging 1.00
R3103:Ryr1 UTSW 7 29074948 missense probably damaging 1.00
R3237:Ryr1 UTSW 7 29069650 critical splice acceptor site probably null
R3551:Ryr1 UTSW 7 29056997 missense probably damaging 1.00
R3552:Ryr1 UTSW 7 29056997 missense probably damaging 1.00
R3807:Ryr1 UTSW 7 29020152 missense probably damaging 1.00
R3815:Ryr1 UTSW 7 29072902 missense probably damaging 0.98
R4010:Ryr1 UTSW 7 29095124 missense probably benign 0.41
R4041:Ryr1 UTSW 7 29085931 missense possibly damaging 0.77
R4226:Ryr1 UTSW 7 29062151 nonsense probably null
R4257:Ryr1 UTSW 7 29082450 missense possibly damaging 0.93
R4328:Ryr1 UTSW 7 29083059 missense probably damaging 1.00
R4394:Ryr1 UTSW 7 29094242 missense possibly damaging 0.69
R4485:Ryr1 UTSW 7 29090156 missense probably damaging 0.97
R4550:Ryr1 UTSW 7 29098735 missense probably benign 0.05
R4554:Ryr1 UTSW 7 29105008 missense probably benign 0.03
R4562:Ryr1 UTSW 7 29074580 intron probably benign
R4642:Ryr1 UTSW 7 29086038 missense possibly damaging 0.91
R4669:Ryr1 UTSW 7 29059831 missense probably null 0.99
R4707:Ryr1 UTSW 7 29045662 missense probably damaging 1.00
R4766:Ryr1 UTSW 7 29085833 missense probably damaging 0.96
R4768:Ryr1 UTSW 7 29004821 unclassified probably benign
R4770:Ryr1 UTSW 7 29109282 missense probably damaging 0.99
R4780:Ryr1 UTSW 7 29095097 missense possibly damaging 0.85
R4927:Ryr1 UTSW 7 29019983 missense unknown
R4933:Ryr1 UTSW 7 29104298 missense probably damaging 1.00
R4934:Ryr1 UTSW 7 29068095 missense probably damaging 1.00
R4942:Ryr1 UTSW 7 29069573 missense probably damaging 0.98
R4960:Ryr1 UTSW 7 29078783 missense possibly damaging 0.82
R5007:Ryr1 UTSW 7 29069115 missense probably damaging 1.00
R5011:Ryr1 UTSW 7 29102809 splice site probably null
R5013:Ryr1 UTSW 7 29102809 splice site probably null
R5137:Ryr1 UTSW 7 29101858 missense possibly damaging 0.94
R5167:Ryr1 UTSW 7 29067693 missense probably damaging 1.00
R5239:Ryr1 UTSW 7 29036128 missense probably damaging 1.00
R5291:Ryr1 UTSW 7 29115598 missense probably benign 0.03
R5303:Ryr1 UTSW 7 29068482 missense probably damaging 1.00
R5386:Ryr1 UTSW 7 29117416 missense probably damaging 0.98
R5431:Ryr1 UTSW 7 29109812 missense probably benign 0.39
R5460:Ryr1 UTSW 7 29071961 missense probably damaging 1.00
R5463:Ryr1 UTSW 7 29024023 missense possibly damaging 0.79
R5503:Ryr1 UTSW 7 29069028 missense possibly damaging 0.87
R5541:Ryr1 UTSW 7 29086185 missense probably damaging 1.00
R5573:Ryr1 UTSW 7 29015723 missense unknown
R5575:Ryr1 UTSW 7 29078693 missense possibly damaging 0.77
R5610:Ryr1 UTSW 7 29111974 missense probably benign 0.05
R5658:Ryr1 UTSW 7 29091089 splice site probably null
R5918:Ryr1 UTSW 7 29009152 missense probably benign 0.39
R5926:Ryr1 UTSW 7 29104360 missense probably damaging 1.00
R5938:Ryr1 UTSW 7 29046865 missense probably damaging 1.00
R5939:Ryr1 UTSW 7 29116127 missense probably damaging 0.97
R5947:Ryr1 UTSW 7 29071924 missense probably null 0.98
R5991:Ryr1 UTSW 7 29104610 missense probably damaging 0.99
R5992:Ryr1 UTSW 7 29067637 missense probably damaging 1.00
R5996:Ryr1 UTSW 7 29024241 missense probably benign 0.38
R6075:Ryr1 UTSW 7 29087438 missense probably damaging 1.00
R6091:Ryr1 UTSW 7 29071973 missense probably benign 0.01
R6126:Ryr1 UTSW 7 29076239 missense probably null 1.00
R6147:Ryr1 UTSW 7 29085914 missense possibly damaging 0.88
R6235:Ryr1 UTSW 7 29116181 missense probably benign 0.07
R6279:Ryr1 UTSW 7 29087428 missense possibly damaging 0.93
R6381:Ryr1 UTSW 7 29075257 missense possibly damaging 0.87
R6441:Ryr1 UTSW 7 29059695 missense possibly damaging 0.95
R6443:Ryr1 UTSW 7 29077078 missense probably damaging 0.97
R6459:Ryr1 UTSW 7 29015654 missense probably benign 0.39
R6514:Ryr1 UTSW 7 29046841 missense probably damaging 1.00
R6563:Ryr1 UTSW 7 29095492 missense possibly damaging 0.92
R6660:Ryr1 UTSW 7 29038345 critical splice donor site probably null
R6746:Ryr1 UTSW 7 29117404 missense possibly damaging 0.56
R6785:Ryr1 UTSW 7 29064874 missense probably benign 0.12
R6800:Ryr1 UTSW 7 29024316 missense possibly damaging 0.95
R6939:Ryr1 UTSW 7 29052326 missense possibly damaging 0.91
R6980:Ryr1 UTSW 7 29109387 missense probably benign 0.03
R6995:Ryr1 UTSW 7 29094182 missense probably damaging 0.97
R7065:Ryr1 UTSW 7 29103643 missense probably damaging 1.00
R7123:Ryr1 UTSW 7 29046854 missense probably benign 0.37
R7238:Ryr1 UTSW 7 29095382 missense probably benign 0.24
R7240:Ryr1 UTSW 7 29052015 missense possibly damaging 0.95
R7300:Ryr1 UTSW 7 29059511 missense probably damaging 1.00
R7365:Ryr1 UTSW 7 29085755 missense probably benign 0.05
R7403:Ryr1 UTSW 7 29013867 missense probably benign 0.34
R7422:Ryr1 UTSW 7 29085870 missense probably benign 0.00
R7493:Ryr1 UTSW 7 29095205 missense probably benign 0.44
R7593:Ryr1 UTSW 7 29036103 missense probably damaging 1.00
R7769:Ryr1 UTSW 7 29098785 missense probably damaging 1.00
R7781:Ryr1 UTSW 7 29067630 missense probably damaging 1.00
R7790:Ryr1 UTSW 7 29104832 missense probably benign 0.39
X0021:Ryr1 UTSW 7 29061531 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGGACATCATGGCGGTAC -3'
(R):5'- AGAGATGCAACCCAGTGTCC -3'

Sequencing Primer
(F):5'- ATCATGGCGGTACAGCGTG -3'
(R):5'- TTCCCCAGAGTCCTTGCAGG -3'
Posted On2019-10-17