Incidental Mutation 'R0620:Sp100'
ID 58571
Institutional Source Beutler Lab
Gene Symbol Sp100
Ensembl Gene ENSMUSG00000026222
Gene Name nuclear antigen Sp100
Synonyms
MMRRC Submission 038809-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock # R0620 (G1)
Quality Score 100
Status Validated
Chromosome 1
Chromosomal Location 85649988-85709998 bp(+) (GRCm38)
Type of Mutation splice site (5 bp from exon)
DNA Base Change (assembly) G to A at 85659867 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054279] [ENSMUST00000054279] [ENSMUST00000054279] [ENSMUST00000054279] [ENSMUST00000066427] [ENSMUST00000066427] [ENSMUST00000145440] [ENSMUST00000145440] [ENSMUST00000147552] [ENSMUST00000147552] [ENSMUST00000147552] [ENSMUST00000147552] [ENSMUST00000150967] [ENSMUST00000150967] [ENSMUST00000150967] [ENSMUST00000150967] [ENSMUST00000153574] [ENSMUST00000153574] [ENSMUST00000153574] [ENSMUST00000153574] [ENSMUST00000155094] [ENSMUST00000155094]
AlphaFold O35892
Predicted Effect probably null
Transcript: ENSMUST00000054279
SMART Domains Protein: ENSMUSP00000051705
Gene: ENSMUSG00000026222

DomainStartEndE-ValueType
Pfam:Sp100 19 122 4.9e-47 PFAM
low complexity region 334 345 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000054279
SMART Domains Protein: ENSMUSP00000051705
Gene: ENSMUSG00000026222

DomainStartEndE-ValueType
Pfam:Sp100 19 122 4.9e-47 PFAM
low complexity region 334 345 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000054279
SMART Domains Protein: ENSMUSP00000051705
Gene: ENSMUSG00000026222

DomainStartEndE-ValueType
Pfam:Sp100 19 122 4.9e-47 PFAM
low complexity region 334 345 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000054279
SMART Domains Protein: ENSMUSP00000051705
Gene: ENSMUSG00000026222

DomainStartEndE-ValueType
Pfam:Sp100 19 122 4.9e-47 PFAM
low complexity region 334 345 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000066427
SMART Domains Protein: ENSMUSP00000066399
Gene: ENSMUSG00000026222

DomainStartEndE-ValueType
Pfam:Sp100 21 119 3.4e-40 PFAM
low complexity region 320 335 N/A INTRINSIC
low complexity region 367 377 N/A INTRINSIC
SAND 386 459 8.85e-38 SMART
BROMO 473 573 1.16e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000066427
SMART Domains Protein: ENSMUSP00000066399
Gene: ENSMUSG00000026222

DomainStartEndE-ValueType
Pfam:Sp100 21 119 3.4e-40 PFAM
low complexity region 320 335 N/A INTRINSIC
low complexity region 367 377 N/A INTRINSIC
SAND 386 459 8.85e-38 SMART
BROMO 473 573 1.16e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141998
Predicted Effect probably benign
Transcript: ENSMUST00000145440
SMART Domains Protein: ENSMUSP00000120604
Gene: ENSMUSG00000026222

DomainStartEndE-ValueType
Pfam:Sp100 19 122 3.7e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145440
SMART Domains Protein: ENSMUSP00000120604
Gene: ENSMUSG00000026222

DomainStartEndE-ValueType
Pfam:Sp100 19 122 3.7e-47 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000147552
SMART Domains Protein: ENSMUSP00000116942
Gene: ENSMUSG00000026222

DomainStartEndE-ValueType
Pfam:Sp100 19 122 2.5e-46 PFAM
low complexity region 305 319 N/A INTRINSIC
low complexity region 349 359 N/A INTRINSIC
SAND 368 441 8.85e-38 SMART
Predicted Effect probably null
Transcript: ENSMUST00000147552
SMART Domains Protein: ENSMUSP00000116942
Gene: ENSMUSG00000026222

DomainStartEndE-ValueType
Pfam:Sp100 19 122 2.5e-46 PFAM
low complexity region 305 319 N/A INTRINSIC
low complexity region 349 359 N/A INTRINSIC
SAND 368 441 8.85e-38 SMART
Predicted Effect probably null
Transcript: ENSMUST00000147552
SMART Domains Protein: ENSMUSP00000116942
Gene: ENSMUSG00000026222

DomainStartEndE-ValueType
Pfam:Sp100 19 122 2.5e-46 PFAM
low complexity region 305 319 N/A INTRINSIC
low complexity region 349 359 N/A INTRINSIC
SAND 368 441 8.85e-38 SMART
Predicted Effect probably null
Transcript: ENSMUST00000147552
SMART Domains Protein: ENSMUSP00000116942
Gene: ENSMUSG00000026222

DomainStartEndE-ValueType
Pfam:Sp100 19 122 2.5e-46 PFAM
low complexity region 305 319 N/A INTRINSIC
low complexity region 349 359 N/A INTRINSIC
SAND 368 441 8.85e-38 SMART
Predicted Effect probably null
Transcript: ENSMUST00000150967
SMART Domains Protein: ENSMUSP00000122899
Gene: ENSMUSG00000026222

DomainStartEndE-ValueType
Pfam:Sp100 19 122 2.1e-46 PFAM
low complexity region 324 334 N/A INTRINSIC
SAND 343 416 8.85e-38 SMART
Predicted Effect probably null
Transcript: ENSMUST00000150967
SMART Domains Protein: ENSMUSP00000122899
Gene: ENSMUSG00000026222

DomainStartEndE-ValueType
Pfam:Sp100 19 122 2.1e-46 PFAM
low complexity region 324 334 N/A INTRINSIC
SAND 343 416 8.85e-38 SMART
Predicted Effect probably null
Transcript: ENSMUST00000150967
SMART Domains Protein: ENSMUSP00000122899
Gene: ENSMUSG00000026222

DomainStartEndE-ValueType
Pfam:Sp100 19 122 2.1e-46 PFAM
low complexity region 324 334 N/A INTRINSIC
SAND 343 416 8.85e-38 SMART
Predicted Effect probably null
Transcript: ENSMUST00000150967
SMART Domains Protein: ENSMUSP00000122899
Gene: ENSMUSG00000026222

DomainStartEndE-ValueType
Pfam:Sp100 19 122 2.1e-46 PFAM
low complexity region 324 334 N/A INTRINSIC
SAND 343 416 8.85e-38 SMART
Predicted Effect probably null
Transcript: ENSMUST00000153574
SMART Domains Protein: ENSMUSP00000122670
Gene: ENSMUSG00000026222

DomainStartEndE-ValueType
Pfam:Sp100 19 122 9.2e-47 PFAM
low complexity region 342 352 N/A INTRINSIC
SAND 361 434 8.85e-38 SMART
Blast:BROMO 453 476 9e-6 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000153574
SMART Domains Protein: ENSMUSP00000122670
Gene: ENSMUSG00000026222

DomainStartEndE-ValueType
Pfam:Sp100 19 122 9.2e-47 PFAM
low complexity region 342 352 N/A INTRINSIC
SAND 361 434 8.85e-38 SMART
Blast:BROMO 453 476 9e-6 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000153574
SMART Domains Protein: ENSMUSP00000122670
Gene: ENSMUSG00000026222

DomainStartEndE-ValueType
Pfam:Sp100 19 122 9.2e-47 PFAM
low complexity region 342 352 N/A INTRINSIC
SAND 361 434 8.85e-38 SMART
Blast:BROMO 453 476 9e-6 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000153574
SMART Domains Protein: ENSMUSP00000122670
Gene: ENSMUSG00000026222

DomainStartEndE-ValueType
Pfam:Sp100 19 122 9.2e-47 PFAM
low complexity region 342 352 N/A INTRINSIC
SAND 361 434 8.85e-38 SMART
Blast:BROMO 453 476 9e-6 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000155094
SMART Domains Protein: ENSMUSP00000118481
Gene: ENSMUSG00000026222

DomainStartEndE-ValueType
Pfam:Sp100 19 122 1.6e-46 PFAM
low complexity region 320 335 N/A INTRINSIC
low complexity region 367 377 N/A INTRINSIC
SAND 386 459 8.85e-38 SMART
Predicted Effect probably null
Transcript: ENSMUST00000155094
SMART Domains Protein: ENSMUSP00000118481
Gene: ENSMUSG00000026222

DomainStartEndE-ValueType
Pfam:Sp100 19 122 1.6e-46 PFAM
low complexity region 320 335 N/A INTRINSIC
low complexity region 367 377 N/A INTRINSIC
SAND 386 459 8.85e-38 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 100% (74/74)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,328,375 Q973L probably damaging Het
Adamts9 T C 6: 92,858,113 T679A possibly damaging Het
Ahr T C 12: 35,508,194 T276A probably benign Het
Akap9 A T 5: 4,064,136 Q3138H probably damaging Het
Armt1 T A 10: 4,432,689 F7I probably benign Het
B3galt2 A G 1: 143,646,140 R5G probably damaging Het
Bod1l T C 5: 41,801,233 N2750S probably benign Het
Cadps2 T A 6: 23,583,396 E365V probably damaging Het
Cd200r3 T A 16: 44,957,717 probably null Het
Cst7 T A 2: 150,575,886 probably benign Het
Defb30 A T 14: 63,049,763 probably benign Het
Dido1 C T 2: 180,659,851 G2087S probably benign Het
Dio2 A G 12: 90,738,071 Y72H probably benign Het
Dnah11 C T 12: 117,987,469 E3035K probably damaging Het
Dnajb13 T C 7: 100,503,249 K287E possibly damaging Het
Dnajc11 G A 4: 151,973,628 V244I possibly damaging Het
Ect2 C T 3: 27,139,652 A226T probably damaging Het
Ercc8 G A 13: 108,174,061 probably null Het
Fam120b T A 17: 15,402,927 M389K probably benign Het
Fam151a A G 4: 106,747,931 M497V probably benign Het
Fam186b C A 15: 99,280,128 G439V probably benign Het
Fank1 A G 7: 133,876,765 Y185C probably damaging Het
Gart T C 16: 91,630,602 probably benign Het
Glb1l T C 1: 75,199,720 Y572C probably damaging Het
Gm11563 C T 11: 99,658,437 A164T unknown Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
Gsdmc3 T A 15: 63,859,693 D330V probably damaging Het
H2-DMa C T 17: 34,137,960 T144M probably damaging Het
Haus6 A T 4: 86,583,514 F707I possibly damaging Het
Hmcn1 T A 1: 150,594,016 T4971S probably benign Het
Ints6 A T 14: 62,696,759 F766L probably benign Het
Kdm5d T A Y: 927,330 M650K probably damaging Het
Kif21b T C 1: 136,159,428 F881S possibly damaging Het
Klrk1 C A 6: 129,614,635 Q176H possibly damaging Het
Ky T C 9: 102,537,621 V244A probably benign Het
Mia2 T A 12: 59,154,419 L191M possibly damaging Het
Miga2 T A 2: 30,381,744 probably benign Het
Mtss1l C T 8: 110,737,948 P322S probably damaging Het
Nalcn A G 14: 123,299,141 probably benign Het
Ncbp3 T A 11: 73,049,845 probably benign Het
Nprl3 G A 11: 32,234,876 L378F probably damaging Het
Ntrk2 A T 13: 58,846,821 M184L probably benign Het
Olfr311 T G 11: 58,841,443 C110G probably damaging Het
Olfr738 G T 14: 50,413,697 C51F probably benign Het
Osbpl9 T C 4: 109,083,128 E287G probably damaging Het
Parva T C 7: 112,576,411 F250L probably damaging Het
Pcdhb11 C T 18: 37,421,811 Q65* probably null Het
Phtf1 A G 3: 103,993,765 T377A probably damaging Het
Pkp4 G A 2: 59,322,643 V612I possibly damaging Het
Plscr2 C A 9: 92,287,654 S52R probably benign Het
Pnisr C T 4: 21,874,092 probably benign Het
Pole2 A C 12: 69,209,879 S291A probably damaging Het
Ppp2r5d A G 17: 46,684,018 F586L probably benign Het
Prrx1 G A 1: 163,257,816 R182C probably damaging Het
Ptprs A G 17: 56,429,103 I110T possibly damaging Het
Rasgrf2 G A 13: 91,919,817 probably benign Het
Riox2 T C 16: 59,491,892 V464A probably benign Het
Robo2 A G 16: 73,967,802 V646A possibly damaging Het
Ros1 T A 10: 52,118,348 I1279F probably damaging Het
Siglec1 G A 2: 131,074,268 T1254M probably benign Het
Snx7 T C 3: 117,846,675 N62D probably damaging Het
Stil A T 4: 115,007,159 I86L possibly damaging Het
Tbc1d16 T A 11: 119,209,038 D170V probably benign Het
Tmem2 T A 19: 21,817,971 S743T probably benign Het
Trappc13 G A 13: 104,161,081 T105M probably damaging Het
Trhr T A 15: 44,229,500 S378T probably benign Het
Ttc7b T C 12: 100,500,073 probably null Het
Vegfc A T 8: 54,157,139 Y110F probably benign Het
Vmn1r184 C A 7: 26,267,177 P116H possibly damaging Het
Vmn2r5 A T 3: 64,503,814 C444* probably null Het
Zfp341 A G 2: 154,634,273 E460G possibly damaging Het
Zfp819 T A 7: 43,616,444 V41E probably benign Het
Other mutations in Sp100
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01082:Sp100 APN 1 85670020 missense possibly damaging 0.48
IGL01998:Sp100 APN 1 85666929 missense probably benign 0.01
IGL02192:Sp100 APN 1 85708001 missense probably damaging 0.99
IGL02809:Sp100 APN 1 85681124 missense probably damaging 0.99
IGL03274:Sp100 APN 1 85707304 intron probably benign
PIT4458001:Sp100 UTSW 1 85708116 missense probably benign 0.10
R0115:Sp100 UTSW 1 85650131 splice site probably benign
R0599:Sp100 UTSW 1 85681110 missense possibly damaging 0.68
R0693:Sp100 UTSW 1 85667005 critical splice donor site probably null
R0709:Sp100 UTSW 1 85694281 missense probably damaging 0.96
R0744:Sp100 UTSW 1 85699744 missense probably damaging 0.97
R0836:Sp100 UTSW 1 85699744 missense probably damaging 0.97
R1175:Sp100 UTSW 1 85701420 missense possibly damaging 0.83
R1496:Sp100 UTSW 1 85663521 splice site probably benign
R1749:Sp100 UTSW 1 85699636 missense possibly damaging 0.95
R2046:Sp100 UTSW 1 85709065 missense possibly damaging 0.53
R2069:Sp100 UTSW 1 85681142 splice site probably null
R2441:Sp100 UTSW 1 85703489 unclassified probably benign
R3933:Sp100 UTSW 1 85681109 missense probably benign 0.29
R4171:Sp100 UTSW 1 85706841 missense probably benign 0.00
R4762:Sp100 UTSW 1 85701458 makesense probably null
R4863:Sp100 UTSW 1 85705003 missense probably benign 0.03
R5156:Sp100 UTSW 1 85673683 missense probably damaging 1.00
R5273:Sp100 UTSW 1 85709104 missense possibly damaging 0.86
R5635:Sp100 UTSW 1 85682264 intron probably benign
R5810:Sp100 UTSW 1 85665285 missense probably benign 0.12
R5910:Sp100 UTSW 1 85681140 critical splice donor site probably null
R5931:Sp100 UTSW 1 85679083 missense probably damaging 1.00
R7466:Sp100 UTSW 1 85707239 missense possibly damaging 0.93
R7514:Sp100 UTSW 1 85681139 nonsense probably null
R7647:Sp100 UTSW 1 85692043 missense possibly damaging 0.91
R7851:Sp100 UTSW 1 85706926 missense probably benign 0.12
R7908:Sp100 UTSW 1 85708067 missense possibly damaging 0.51
R8064:Sp100 UTSW 1 85681139 nonsense probably null
R8094:Sp100 UTSW 1 85697098 missense possibly damaging 0.95
R8757:Sp100 UTSW 1 85662564 missense possibly damaging 0.92
R8785:Sp100 UTSW 1 85699751 critical splice donor site probably benign
R9382:Sp100 UTSW 1 85699615 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTCCACTGAACAGGAGAACACAGA -3'
(R):5'- TGACATGGAACACCATTCCCTCAGA -3'

Sequencing Primer
(F):5'- TGAACAGGAGAACACAGAGATGC -3'
(R):5'- acacacacacacacacacag -3'
Posted On 2013-07-11