Incidental Mutation 'R7570:Pcsk6'
ID585713
Institutional Source Beutler Lab
Gene Symbol Pcsk6
Ensembl Gene ENSMUSG00000030513
Gene Nameproprotein convertase subtilisin/kexin type 6
SynonymsPACE4, SPC4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.232) question?
Stock #R7570 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location65861734-66050386 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66033898 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 754 (T754A)
Ref Sequence ENSEMBL: ENSMUSP00000095992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055576] [ENSMUST00000098391] [ENSMUST00000176209]
Predicted Effect probably benign
Transcript: ENSMUST00000055576
AA Change: T767A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000053742
Gene: ENSMUSG00000030513
AA Change: T767A

DomainStartEndE-ValueType
signal peptide 1 54 N/A INTRINSIC
Pfam:S8_pro-domain 65 141 3.1e-29 PFAM
Pfam:Peptidase_S8 186 469 5.2e-49 PFAM
Pfam:P_proprotein 529 619 9.7e-37 PFAM
FU 682 729 5.87e-11 SMART
EGF_like 688 737 5.03e1 SMART
FU 733 780 4.35e-14 SMART
EGF_like 738 771 3.57e1 SMART
FU 784 828 2.08e-11 SMART
EGF 789 819 2.48e1 SMART
FU 832 877 9.4e-10 SMART
EGF_like 837 868 6.28e1 SMART
FU 885 933 8.58e-4 SMART
EGF 890 920 1.69e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098391
AA Change: T754A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000095992
Gene: ENSMUSG00000030513
AA Change: T754A

DomainStartEndE-ValueType
signal peptide 1 54 N/A INTRINSIC
PDB:1KN6|A 62 129 2e-6 PDB
low complexity region 131 144 N/A INTRINSIC
Pfam:Peptidase_S8 190 478 1.1e-58 PFAM
Pfam:P_proprotein 529 619 4.5e-37 PFAM
FU 669 716 3.87e-11 SMART
EGF_like 675 724 5.03e1 SMART
FU 720 767 4.35e-14 SMART
EGF_like 725 758 3.57e1 SMART
FU 771 815 2.08e-11 SMART
EGF 776 806 2.48e1 SMART
FU 819 864 9.4e-10 SMART
EGF_like 824 855 6.28e1 SMART
FU 872 920 8.58e-4 SMART
EGF 877 907 1.69e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176209
AA Change: T606A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000135033
Gene: ENSMUSG00000030513
AA Change: T606A

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
Pfam:Peptidase_S8 103 372 6.5e-50 PFAM
Pfam:P_proprotein 368 458 6.2e-37 PFAM
FU 521 568 5.87e-11 SMART
EGF_like 527 576 5.03e1 SMART
FU 572 619 4.35e-14 SMART
EGF_like 577 610 3.57e1 SMART
FU 623 667 2.08e-11 SMART
EGF 628 658 2.48e1 SMART
FU 671 716 9.4e-10 SMART
EGF_like 676 707 6.28e1 SMART
FU 724 772 8.58e-4 SMART
EGF 729 759 1.69e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (104/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to the trans-Golgi network where a second autocatalytic event takes place and the catalytic activity is acquired. The encoded protease is constitutively secreted into the extracellular matrix and expressed in many tissues, including neuroendocrine, liver, gut, and brain. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. Some of its substrates include transforming growth factor beta related proteins, proalbumin, and von Willebrand factor. This gene is thought to play a role in tumor progression and left-right patterning. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutation of this gene results in partial lethality by E15.5. Embryos develop situs ambiguus with left pulmonary isomerism or craniofacial malformations including cyclopia, or both. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik C T 6: 91,934,610 T613I probably benign Het
9130019O22Rik T A 7: 127,385,283 S216C probably benign Het
Ajuba T C 14: 54,576,402 E288G probably damaging Het
Ankrd12 C T 17: 65,985,360 R1026K probably benign Het
Apol7b T C 15: 77,423,474 T274A probably benign Het
Arid4a A T 12: 71,063,142 R86* probably null Het
Asnsd1 C T 1: 53,348,258 G70D probably damaging Het
Atg4c T A 4: 99,228,560 V313D possibly damaging Het
Atp13a5 A C 16: 29,266,963 C885G probably damaging Het
Bpifb9a A T 2: 154,262,263 I209F possibly damaging Het
Bsn T C 9: 108,113,543 D1670G probably damaging Het
Cct8 T A 16: 87,491,322 I121F probably benign Het
Cd209a T G 8: 3,744,151 D217A probably damaging Het
Cdk19 C T 10: 40,477,958 S456L possibly damaging Het
Chd9 C T 8: 90,994,580 H999Y unknown Het
Col5a1 G A 2: 27,951,383 V339M unknown Het
Cr2 G A 1: 195,169,340 R115* probably null Het
Cyb561 A T 11: 105,937,644 F62I probably damaging Het
Cyp2c38 A T 19: 39,404,743 N293K possibly damaging Het
Cyp2c69 A T 19: 39,859,898 D293E probably damaging Het
Dcbld2 T A 16: 58,424,569 C69S possibly damaging Het
Dcdc2a T C 13: 25,119,373 S296P probably benign Het
Dmxl1 T A 18: 49,893,957 I2044K possibly damaging Het
Dnah5 A G 15: 28,346,952 D2527G probably damaging Het
Dnah6 T C 6: 73,149,430 T1305A probably benign Het
Dnajc9 A G 14: 20,388,644 V47A probably benign Het
Dnmt3b A G 2: 153,676,699 Y594C probably damaging Het
Dph7 A G 2: 24,965,630 D147G probably damaging Het
Drap1 T C 19: 5,423,352 H164R possibly damaging Het
Dsg3 T A 18: 20,527,780 V392E possibly damaging Het
Dxo A G 17: 34,837,640 D81G probably benign Het
E230025N22Rik G T 18: 36,695,592 T11K probably benign Het
Esyt1 A G 10: 128,518,932 V533A possibly damaging Het
Etv3 T A 3: 87,536,031 C307* probably null Het
Fam114a1 T A 5: 65,030,059 probably null Het
Fam208b A G 13: 3,573,621 Y2110H probably damaging Het
Fam3c T A 6: 22,326,405 probably benign Het
Fbn1 G T 2: 125,397,852 T305K probably benign Het
Ggt1 A T 10: 75,585,594 I484F probably damaging Het
Gm10639 A T 9: 78,304,469 D171V possibly damaging Het
Gpatch1 T C 7: 35,293,812 D536G probably damaging Het
Gpx4 T C 10: 80,055,041 I189T probably damaging Het
Gsr T A 8: 33,669,165 C85S probably damaging Het
Havcr1 T A 11: 46,770,542 probably null Het
Heatr4 T C 12: 83,979,644 T280A probably benign Het
Hmcn2 A T 2: 31,423,911 E3532D probably benign Het
Hnrnpc T C 14: 52,075,099 N308S possibly damaging Het
Ighv8-9 A G 12: 115,468,738 V13A probably benign Het
Itgb2l A T 16: 96,426,239 F535I probably benign Het
Kdm5a T G 6: 120,427,842 D1348E probably damaging Het
Kndc1 CT C 7: 139,923,775 probably null Het
Ky A G 9: 102,542,329 I512V probably benign Het
Lamc1 A T 1: 153,243,275 F866Y possibly damaging Het
Lbx1 C A 19: 45,235,248 probably benign Het
Magel2 A G 7: 62,378,910 T521A possibly damaging Het
Mgam A T 6: 40,746,433 I491L probably benign Het
Mitd1 T C 1: 37,890,192 E40G probably damaging Het
Mpzl3 A G 9: 45,070,687 T218A probably benign Het
Mrpl42 A G 10: 95,480,965 S77P probably benign Het
Mup5 C T 4: 61,834,674 W37* probably null Het
Myh14 T C 7: 44,632,426 I803V probably benign Het
Ncor2 T A 5: 125,030,089 T744S Het
Ndufv3 A G 17: 31,527,622 D162G probably damaging Het
Nostrin A G 2: 69,175,806 E278G probably damaging Het
Nrxn1 T G 17: 90,162,379 E1288A probably benign Het
Olfr1205 A G 2: 88,831,128 N4D possibly damaging Het
Olfr623 C A 7: 103,660,881 R123L probably damaging Het
Olfr648 T A 7: 104,179,748 Y220F probably damaging Het
Olfr972 A T 9: 39,873,455 Y60F possibly damaging Het
Patj T A 4: 98,424,500 probably null Het
Pcm1 T G 8: 41,267,344 I314R possibly damaging Het
Pde2a A T 7: 101,502,834 N326I probably benign Het
Plekhg4 T C 8: 105,378,684 S594P possibly damaging Het
Plekhm3 T C 1: 64,937,906 D135G probably damaging Het
Plin4 A T 17: 56,106,776 M283K probably benign Het
Ppfia3 T C 7: 45,340,748 probably null Het
Prdm9 T C 17: 15,555,652 N179S probably benign Het
Prrt3 T C 6: 113,494,488 S908G probably damaging Het
Psg22 C A 7: 18,722,735 S181Y possibly damaging Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rp1l1 T A 14: 64,031,574 C1536* probably null Het
Rpp25l T C 4: 41,712,529 H82R probably damaging Het
Rps3a1 T A 3: 86,139,089 M172L probably benign Het
Rtbdn T C 8: 84,952,927 L110P probably damaging Het
Ryr1 T A 7: 29,078,585 Q2169L probably damaging Het
Scn4a A T 11: 106,320,473 C1573S possibly damaging Het
Sec16b A T 1: 157,531,395 probably null Het
Serpina1a A T 12: 103,853,837 D383E possibly damaging Het
Sh3gl3 T C 7: 82,285,077 M262T probably benign Het
Sos2 G A 12: 69,590,880 T1052M probably damaging Het
Spag16 G A 1: 69,996,841 V343I probably benign Het
Spocd1 T G 4: 129,930,164 D251E Het
Stc2 G T 11: 31,367,798 N74K probably damaging Het
Thbs3 C T 3: 89,219,052 Q227* probably null Het
Tmem92 A C 11: 94,778,990 I105R probably benign Het
Tmod1 T A 4: 46,083,632 N20K probably benign Het
Tns1 T C 1: 73,953,479 D53G probably damaging Het
Tspan33 T A 6: 29,717,338 L246Q probably damaging Het
Ttc16 A G 2: 32,768,968 L392P probably damaging Het
Uggt1 T A 1: 36,185,838 T572S probably benign Het
Usp17la A T 7: 104,860,397 T70S probably damaging Het
Usp31 C T 7: 121,674,963 R370H probably damaging Het
Wdr83 C T 8: 85,079,834 V112M probably damaging Het
Zbtb25 T A 12: 76,369,592 probably benign Het
Zfp110 T A 7: 12,849,340 N638K possibly damaging Het
Zfp820 T C 17: 21,819,013 T445A probably benign Het
Other mutations in Pcsk6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Pcsk6 APN 7 65927820 missense probably damaging 1.00
IGL01609:Pcsk6 APN 7 66035273 splice site probably null
IGL01986:Pcsk6 APN 7 65927877 missense probably damaging 1.00
IGL02592:Pcsk6 APN 7 65969028 missense probably damaging 1.00
IGL02720:Pcsk6 APN 7 65980247 nonsense probably null
R0045:Pcsk6 UTSW 7 65962928 missense probably damaging 1.00
R0045:Pcsk6 UTSW 7 65962928 missense probably damaging 1.00
R0053:Pcsk6 UTSW 7 65983703 splice site probably benign
R0053:Pcsk6 UTSW 7 65983703 splice site probably benign
R0103:Pcsk6 UTSW 7 65929097 splice site probably benign
R0103:Pcsk6 UTSW 7 65929097 splice site probably benign
R0119:Pcsk6 UTSW 7 66039043 missense probably benign 0.10
R0299:Pcsk6 UTSW 7 66039043 missense probably benign 0.10
R0415:Pcsk6 UTSW 7 66033874 missense probably damaging 1.00
R0496:Pcsk6 UTSW 7 65927249 missense probably benign 0.00
R0518:Pcsk6 UTSW 7 65980167 missense possibly damaging 0.64
R0748:Pcsk6 UTSW 7 66038968 unclassified probably benign
R1456:Pcsk6 UTSW 7 66043535 missense possibly damaging 0.87
R1613:Pcsk6 UTSW 7 65910311 splice site probably benign
R1680:Pcsk6 UTSW 7 66035250 missense probably benign 0.14
R1682:Pcsk6 UTSW 7 65910228 missense probably damaging 1.00
R1987:Pcsk6 UTSW 7 65927287 missense possibly damaging 0.60
R4191:Pcsk6 UTSW 7 66025308 missense probably damaging 0.98
R4193:Pcsk6 UTSW 7 66025308 missense probably damaging 0.98
R4577:Pcsk6 UTSW 7 65959266 nonsense probably null
R4592:Pcsk6 UTSW 7 65931732 missense possibly damaging 0.54
R4687:Pcsk6 UTSW 7 65983753 missense probably damaging 1.00
R4697:Pcsk6 UTSW 7 65959241 missense probably damaging 1.00
R4778:Pcsk6 UTSW 7 65959145 missense probably damaging 1.00
R5065:Pcsk6 UTSW 7 65910299 missense possibly damaging 0.84
R5218:Pcsk6 UTSW 7 66025288 missense probably benign 0.01
R5356:Pcsk6 UTSW 7 65970592 missense probably damaging 1.00
R5427:Pcsk6 UTSW 7 66033899 missense probably benign 0.01
R5589:Pcsk6 UTSW 7 65929185 critical splice donor site probably null
R5637:Pcsk6 UTSW 7 65968997 missense probably damaging 1.00
R5888:Pcsk6 UTSW 7 66043624 missense probably null
R5958:Pcsk6 UTSW 7 66043611 missense probably damaging 1.00
R5997:Pcsk6 UTSW 7 65959293 missense probably damaging 1.00
R6191:Pcsk6 UTSW 7 65929127 missense probably benign 0.19
R6274:Pcsk6 UTSW 7 66033844 missense probably damaging 1.00
R6374:Pcsk6 UTSW 7 65980155 missense possibly damaging 0.80
R6393:Pcsk6 UTSW 7 65969014 missense probably damaging 1.00
R6730:Pcsk6 UTSW 7 65980248 missense probably damaging 1.00
R7205:Pcsk6 UTSW 7 66025408 critical splice donor site probably null
R7493:Pcsk6 UTSW 7 66043566 missense possibly damaging 0.53
R7731:Pcsk6 UTSW 7 66033893 missense probably benign 0.00
R7779:Pcsk6 UTSW 7 66025404 missense probably benign 0.03
R8042:Pcsk6 UTSW 7 65927935 missense not run
Z1177:Pcsk6 UTSW 7 65959113 missense not run
Z1177:Pcsk6 UTSW 7 66033811 missense not run
Predicted Primers PCR Primer
(F):5'- AAACAAGATCCTTACCTGCCCTTG -3'
(R):5'- CTGCTGAGTGCTGTGACTTC -3'

Sequencing Primer
(F):5'- CTTGCTCCCACAGGAAGTG -3'
(R):5'- CCTGGTGCAAGGTTCCACAAAAG -3'
Posted On2019-10-17