Incidental Mutation 'R7570:Kndc1'
ID585721
Institutional Source Beutler Lab
Gene Symbol Kndc1
Ensembl Gene ENSMUSG00000066129
Gene Namekinase non-catalytic C-lobe domain (KIND) containing 1
SynonymsB830014K08Rik, 2410012C07Rik, very-kind, VKIND
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7570 (G1)
Quality Score214.458
Status Not validated
Chromosome7
Chromosomal Location139894696-139941537 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CT to C at 139923775 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000050586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053445]
Predicted Effect probably null
Transcript: ENSMUST00000053445
SMART Domains Protein: ENSMUSP00000050586
Gene: ENSMUSG00000066129

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
KIND 456 620 1.22e-50 SMART
low complexity region 658 670 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 792 801 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
coiled coil region 1121 1151 N/A INTRINSIC
Pfam:RasGEF_N 1242 1341 2.2e-17 PFAM
Pfam:RasGEF 1464 1672 3.8e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154782
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156941
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Ras guanine nucleotide exchange factor that appears to negatively regulate dendritic growth in the brain. Knockdown of this gene in senescent umbilical vein endothelial cells partially reversed the senescence, showing that this gene could potentially be targeted by anti-aging therapies. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik C T 6: 91,934,610 T613I probably benign Het
9130019O22Rik T A 7: 127,385,283 S216C probably benign Het
Ajuba T C 14: 54,576,402 E288G probably damaging Het
Ankrd12 C T 17: 65,985,360 R1026K probably benign Het
Apol7b T C 15: 77,423,474 T274A probably benign Het
Arid4a A T 12: 71,063,142 R86* probably null Het
Asnsd1 C T 1: 53,348,258 G70D probably damaging Het
Atg4c T A 4: 99,228,560 V313D possibly damaging Het
Atp13a5 A C 16: 29,266,963 C885G probably damaging Het
Bpifb9a A T 2: 154,262,263 I209F possibly damaging Het
Bsn T C 9: 108,113,543 D1670G probably damaging Het
Cct8 T A 16: 87,491,322 I121F probably benign Het
Cd209a T G 8: 3,744,151 D217A probably damaging Het
Cdk19 C T 10: 40,477,958 S456L possibly damaging Het
Chd9 C T 8: 90,994,580 H999Y unknown Het
Col5a1 G A 2: 27,951,383 V339M unknown Het
Cr2 G A 1: 195,169,340 R115* probably null Het
Cyb561 A T 11: 105,937,644 F62I probably damaging Het
Cyp2c38 A T 19: 39,404,743 N293K possibly damaging Het
Cyp2c69 A T 19: 39,859,898 D293E probably damaging Het
Dcbld2 T A 16: 58,424,569 C69S possibly damaging Het
Dcdc2a T C 13: 25,119,373 S296P probably benign Het
Dmxl1 T A 18: 49,893,957 I2044K possibly damaging Het
Dnah5 A G 15: 28,346,952 D2527G probably damaging Het
Dnah6 T C 6: 73,149,430 T1305A probably benign Het
Dnajc9 A G 14: 20,388,644 V47A probably benign Het
Dnmt3b A G 2: 153,676,699 Y594C probably damaging Het
Dph7 A G 2: 24,965,630 D147G probably damaging Het
Drap1 T C 19: 5,423,352 H164R possibly damaging Het
Dsg3 T A 18: 20,527,780 V392E possibly damaging Het
Dxo A G 17: 34,837,640 D81G probably benign Het
E230025N22Rik G T 18: 36,695,592 T11K probably benign Het
Esyt1 A G 10: 128,518,932 V533A possibly damaging Het
Etv3 T A 3: 87,536,031 C307* probably null Het
Fam114a1 T A 5: 65,030,059 probably null Het
Fam208b A G 13: 3,573,621 Y2110H probably damaging Het
Fbn1 G T 2: 125,397,852 T305K probably benign Het
Ggt1 A T 10: 75,585,594 I484F probably damaging Het
Gm10639 A T 9: 78,304,469 D171V possibly damaging Het
Gpatch1 T C 7: 35,293,812 D536G probably damaging Het
Gpx4 T C 10: 80,055,041 I189T probably damaging Het
Gsr T A 8: 33,669,165 C85S probably damaging Het
Havcr1 T A 11: 46,770,542 probably null Het
Heatr4 T C 12: 83,979,644 T280A probably benign Het
Hmcn2 A T 2: 31,423,911 E3532D probably benign Het
Hnrnpc T C 14: 52,075,099 N308S possibly damaging Het
Ighv8-9 A G 12: 115,468,738 V13A probably benign Het
Itgb2l A T 16: 96,426,239 F535I probably benign Het
Kdm5a T G 6: 120,427,842 D1348E probably damaging Het
Ky A G 9: 102,542,329 I512V probably benign Het
Lamc1 A T 1: 153,243,275 F866Y possibly damaging Het
Lbx1 C A 19: 45,235,248 probably benign Het
Magel2 A G 7: 62,378,910 T521A possibly damaging Het
Mgam A T 6: 40,746,433 I491L probably benign Het
Mitd1 T C 1: 37,890,192 E40G probably damaging Het
Mpzl3 A G 9: 45,070,687 T218A probably benign Het
Mrpl42 A G 10: 95,480,965 S77P probably benign Het
Mup5 C T 4: 61,834,674 W37* probably null Het
Myh14 T C 7: 44,632,426 I803V probably benign Het
Ncor2 T A 5: 125,030,089 T744S Het
Ndufv3 A G 17: 31,527,622 D162G probably damaging Het
Nostrin A G 2: 69,175,806 E278G probably damaging Het
Nrxn1 T G 17: 90,162,379 E1288A probably benign Het
Olfr1205 A G 2: 88,831,128 N4D possibly damaging Het
Olfr623 C A 7: 103,660,881 R123L probably damaging Het
Olfr648 T A 7: 104,179,748 Y220F probably damaging Het
Olfr972 A T 9: 39,873,455 Y60F possibly damaging Het
Patj T A 4: 98,424,500 probably null Het
Pcm1 T G 8: 41,267,344 I314R possibly damaging Het
Pcsk6 A G 7: 66,033,898 T754A probably benign Het
Pde2a A T 7: 101,502,834 N326I probably benign Het
Plekhg4 T C 8: 105,378,684 S594P possibly damaging Het
Plekhm3 T C 1: 64,937,906 D135G probably damaging Het
Plin4 A T 17: 56,106,776 M283K probably benign Het
Ppfia3 T C 7: 45,340,748 probably null Het
Prdm9 T C 17: 15,555,652 N179S probably benign Het
Prrt3 T C 6: 113,494,488 S908G probably damaging Het
Psg22 C A 7: 18,722,735 S181Y possibly damaging Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rp1l1 T A 14: 64,031,574 C1536* probably null Het
Rpp25l T C 4: 41,712,529 H82R probably damaging Het
Rps3a1 T A 3: 86,139,089 M172L probably benign Het
Rtbdn T C 8: 84,952,927 L110P probably damaging Het
Ryr1 T A 7: 29,078,585 Q2169L probably damaging Het
Scn4a A T 11: 106,320,473 C1573S possibly damaging Het
Sec16b A T 1: 157,531,395 probably null Het
Serpina1a A T 12: 103,853,837 D383E possibly damaging Het
Sh3gl3 T C 7: 82,285,077 M262T probably benign Het
Sos2 G A 12: 69,590,880 T1052M probably damaging Het
Spag16 G A 1: 69,996,841 V343I probably benign Het
Spocd1 T G 4: 129,930,164 D251E Het
Stc2 G T 11: 31,367,798 N74K probably damaging Het
Thbs3 C T 3: 89,219,052 Q227* probably null Het
Tmem92 A C 11: 94,778,990 I105R probably benign Het
Tmod1 T A 4: 46,083,632 N20K probably benign Het
Tns1 T C 1: 73,953,479 D53G probably damaging Het
Tspan33 T A 6: 29,717,338 L246Q probably damaging Het
Ttc16 A G 2: 32,768,968 L392P probably damaging Het
Uggt1 T A 1: 36,185,838 T572S probably benign Het
Usp17la A T 7: 104,860,397 T70S probably damaging Het
Usp31 C T 7: 121,674,963 R370H probably damaging Het
Wdr83 C T 8: 85,079,834 V112M probably damaging Het
Zbtb25 T A 12: 76,369,592 probably benign Het
Zfp110 T A 7: 12,849,340 N638K possibly damaging Het
Zfp820 T C 17: 21,819,013 T445A probably benign Het
Other mutations in Kndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Kndc1 APN 7 139901988 splice site probably benign
IGL01061:Kndc1 APN 7 139922694 missense probably benign 0.00
IGL01099:Kndc1 APN 7 139920784 missense probably damaging 1.00
IGL01522:Kndc1 APN 7 139913972 splice site probably benign
IGL01767:Kndc1 APN 7 139930046 missense probably damaging 1.00
IGL01884:Kndc1 APN 7 139914194 missense probably damaging 1.00
IGL01932:Kndc1 APN 7 139923790 missense probably damaging 0.98
IGL02133:Kndc1 APN 7 139920767 missense probably benign 0.19
IGL02411:Kndc1 APN 7 139921913 critical splice donor site probably null
IGL02472:Kndc1 APN 7 139910901 missense probably benign 0.01
IGL02537:Kndc1 APN 7 139910410 missense probably benign 0.01
IGL02708:Kndc1 APN 7 139901181 missense probably damaging 1.00
IGL03115:Kndc1 APN 7 139921509 missense probably benign 0.28
IGL03160:Kndc1 APN 7 139920689 nonsense probably null
IGL03138:Kndc1 UTSW 7 139939878 missense possibly damaging 0.89
PIT4142001:Kndc1 UTSW 7 139923776 frame shift probably null
PIT4696001:Kndc1 UTSW 7 139932917 missense probably damaging 1.00
R0349:Kndc1 UTSW 7 139910304 missense probably benign 0.00
R0384:Kndc1 UTSW 7 139910599 missense possibly damaging 0.85
R0415:Kndc1 UTSW 7 139930124 missense probably damaging 1.00
R0421:Kndc1 UTSW 7 139908996 missense probably damaging 1.00
R0487:Kndc1 UTSW 7 139914023 missense probably null 0.19
R0530:Kndc1 UTSW 7 139901237 missense probably damaging 1.00
R0905:Kndc1 UTSW 7 139923735 missense possibly damaging 0.94
R1434:Kndc1 UTSW 7 139922684 missense probably damaging 1.00
R1608:Kndc1 UTSW 7 139927408 missense possibly damaging 0.80
R1644:Kndc1 UTSW 7 139930756 missense probably damaging 1.00
R1835:Kndc1 UTSW 7 139927711 missense probably damaging 0.99
R2012:Kndc1 UTSW 7 139921280 missense possibly damaging 0.90
R2102:Kndc1 UTSW 7 139930761 missense probably benign 0.02
R2103:Kndc1 UTSW 7 139921234 missense probably benign 0.01
R2128:Kndc1 UTSW 7 139930112 missense probably damaging 1.00
R2516:Kndc1 UTSW 7 139921822 missense probably damaging 1.00
R3030:Kndc1 UTSW 7 139901207 missense probably damaging 1.00
R3617:Kndc1 UTSW 7 139902060 splice site probably benign
R3747:Kndc1 UTSW 7 139927904 critical splice donor site probably null
R3848:Kndc1 UTSW 7 139908977 missense probably damaging 1.00
R4028:Kndc1 UTSW 7 139930028 missense probably damaging 0.98
R4043:Kndc1 UTSW 7 139924129 missense probably benign 0.06
R4044:Kndc1 UTSW 7 139924129 missense probably benign 0.06
R4095:Kndc1 UTSW 7 139937025 missense possibly damaging 0.49
R4289:Kndc1 UTSW 7 139910882 missense probably benign 0.01
R4478:Kndc1 UTSW 7 139920684 missense probably damaging 1.00
R4514:Kndc1 UTSW 7 139910286 missense probably benign 0.00
R4540:Kndc1 UTSW 7 139921427 nonsense probably null
R4584:Kndc1 UTSW 7 139901243 missense probably damaging 1.00
R4693:Kndc1 UTSW 7 139921779 missense probably benign 0.02
R4705:Kndc1 UTSW 7 139930123 missense possibly damaging 0.81
R4773:Kndc1 UTSW 7 139924031 nonsense probably null
R4859:Kndc1 UTSW 7 139921905 missense probably benign 0.03
R5004:Kndc1 UTSW 7 139932879 nonsense probably null
R5037:Kndc1 UTSW 7 139910455 missense possibly damaging 0.52
R5322:Kndc1 UTSW 7 139936809 missense probably damaging 1.00
R5428:Kndc1 UTSW 7 139908962 missense probably damaging 0.99
R5503:Kndc1 UTSW 7 139931889 missense probably damaging 1.00
R5506:Kndc1 UTSW 7 139927891 missense probably damaging 1.00
R5525:Kndc1 UTSW 7 139924111 missense probably benign 0.00
R5888:Kndc1 UTSW 7 139895217 missense probably benign 0.00
R5942:Kndc1 UTSW 7 139936879 missense probably damaging 1.00
R5979:Kndc1 UTSW 7 139939827 missense probably benign 0.05
R5990:Kndc1 UTSW 7 139927420 missense probably damaging 0.99
R6038:Kndc1 UTSW 7 139923775 frame shift probably null
R6076:Kndc1 UTSW 7 139902038 missense probably damaging 1.00
R6118:Kndc1 UTSW 7 139923802 missense probably damaging 1.00
R6151:Kndc1 UTSW 7 139921213 missense probably benign 0.04
R6276:Kndc1 UTSW 7 139921063 missense probably benign
R6367:Kndc1 UTSW 7 139913506 missense probably damaging 1.00
R6726:Kndc1 UTSW 7 139922751 critical splice donor site probably null
R6745:Kndc1 UTSW 7 139920976 missense probably benign 0.02
R6886:Kndc1 UTSW 7 139913569 missense probably benign 0.01
R6912:Kndc1 UTSW 7 139910278 missense probably damaging 0.99
R7070:Kndc1 UTSW 7 139921828 missense probably damaging 1.00
R7123:Kndc1 UTSW 7 139936836 missense probably damaging 0.99
R7158:Kndc1 UTSW 7 139931860 missense possibly damaging 0.48
R7248:Kndc1 UTSW 7 139920783 missense probably damaging 1.00
R7437:Kndc1 UTSW 7 139909043 missense probably damaging 1.00
R7564:Kndc1 UTSW 7 139920696 missense probably benign 0.01
R7625:Kndc1 UTSW 7 139938017 missense possibly damaging 0.90
R7629:Kndc1 UTSW 7 139895260 missense probably damaging 1.00
R7726:Kndc1 UTSW 7 139939838 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- AGTTTGCAGCAGGATGAGTG -3'
(R):5'- CACCGTCCTCAGATCTAGCTAG -3'

Sequencing Primer
(F):5'- AGTGCTTAGGGGAGCTGATC -3'
(R):5'- TCAGATCTAGCTAGCCGGG -3'
Posted On2019-10-17