Incidental Mutation 'R7570:Chd9'
ID 585727
Institutional Source Beutler Lab
Gene Symbol Chd9
Ensembl Gene ENSMUSG00000056608
Gene Name chromodomain helicase DNA binding protein 9
Synonyms AD013, 1810014J18Rik, 9030205D12Rik, A330063D19Rik
MMRRC Submission 045631-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7570 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 91554980-91781144 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 91721208 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 999 (H999Y)
Ref Sequence ENSEMBL: ENSMUSP00000046356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048665] [ENSMUST00000109614] [ENSMUST00000209203] [ENSMUST00000209423] [ENSMUST00000210947]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000048665
AA Change: H999Y
SMART Domains Protein: ENSMUSP00000046356
Gene: ENSMUSG00000056608
AA Change: H999Y

DomainStartEndE-ValueType
low complexity region 323 334 N/A INTRINSIC
low complexity region 586 605 N/A INTRINSIC
CHROMO 687 753 2.41e-10 SMART
CHROMO 770 828 4.35e-8 SMART
DEXDc 855 1056 3.8e-36 SMART
Blast:DEXDc 1149 1174 7e-6 BLAST
HELICc 1211 1295 2.86e-22 SMART
low complexity region 1462 1475 N/A INTRINSIC
Blast:DEXDc 1506 1551 3e-16 BLAST
low complexity region 2048 2067 N/A INTRINSIC
low complexity region 2127 2199 N/A INTRINSIC
BRK 2456 2505 6.77e-25 SMART
BRK 2530 2574 1.5e-17 SMART
low complexity region 2594 2608 N/A INTRINSIC
low complexity region 2609 2639 N/A INTRINSIC
low complexity region 2642 2659 N/A INTRINSIC
low complexity region 2690 2704 N/A INTRINSIC
low complexity region 2746 2771 N/A INTRINSIC
low complexity region 2802 2813 N/A INTRINSIC
low complexity region 2843 2869 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000109614
AA Change: H999Y
SMART Domains Protein: ENSMUSP00000105243
Gene: ENSMUSG00000056608
AA Change: H999Y

DomainStartEndE-ValueType
low complexity region 323 334 N/A INTRINSIC
low complexity region 586 605 N/A INTRINSIC
CHROMO 687 753 2.41e-10 SMART
CHROMO 770 828 4.35e-8 SMART
DEXDc 855 1056 3.8e-36 SMART
Blast:DEXDc 1149 1174 7e-6 BLAST
HELICc 1211 1295 2.86e-22 SMART
low complexity region 1462 1475 N/A INTRINSIC
Blast:DEXDc 1506 1551 3e-16 BLAST
low complexity region 2048 2067 N/A INTRINSIC
low complexity region 2127 2199 N/A INTRINSIC
BRK 2472 2521 6.77e-25 SMART
BRK 2546 2590 1.5e-17 SMART
low complexity region 2610 2624 N/A INTRINSIC
low complexity region 2625 2655 N/A INTRINSIC
low complexity region 2658 2675 N/A INTRINSIC
low complexity region 2706 2720 N/A INTRINSIC
low complexity region 2762 2787 N/A INTRINSIC
low complexity region 2818 2829 N/A INTRINSIC
low complexity region 2859 2885 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000209203
AA Change: H999Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect unknown
Transcript: ENSMUST00000209423
AA Change: H999Y
Predicted Effect probably damaging
Transcript: ENSMUST00000210947
AA Change: H526Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (104/106)
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik C T 6: 91,911,591 (GRCm39) T613I probably benign Het
Ajuba T C 14: 54,813,859 (GRCm39) E288G probably damaging Het
Ankrd12 C T 17: 66,292,355 (GRCm39) R1026K probably benign Het
Apol7b T C 15: 77,307,674 (GRCm39) T274A probably benign Het
Arid4a A T 12: 71,109,916 (GRCm39) R86* probably null Het
Asnsd1 C T 1: 53,387,417 (GRCm39) G70D probably damaging Het
Atg4c T A 4: 99,116,797 (GRCm39) V313D possibly damaging Het
Atp13a5 A C 16: 29,085,715 (GRCm39) C885G probably damaging Het
Bpifb9a A T 2: 154,104,183 (GRCm39) I209F possibly damaging Het
Bsn T C 9: 107,990,742 (GRCm39) D1670G probably damaging Het
Cct8 T A 16: 87,288,210 (GRCm39) I121F probably benign Het
Cd209a T G 8: 3,794,151 (GRCm39) D217A probably damaging Het
Cdk19 C T 10: 40,353,954 (GRCm39) S456L possibly damaging Het
Col5a1 G A 2: 27,841,395 (GRCm39) V339M unknown Het
Cr2 G A 1: 194,851,648 (GRCm39) R115* probably null Het
Cyb561 A T 11: 105,828,470 (GRCm39) F62I probably damaging Het
Cyp2c38 A T 19: 39,393,187 (GRCm39) N293K possibly damaging Het
Cyp2c69 A T 19: 39,848,342 (GRCm39) D293E probably damaging Het
Dcbld2 T A 16: 58,244,932 (GRCm39) C69S possibly damaging Het
Dcdc2a T C 13: 25,303,356 (GRCm39) S296P probably benign Het
Dmxl1 T A 18: 50,027,024 (GRCm39) I2044K possibly damaging Het
Dnah5 A G 15: 28,347,098 (GRCm39) D2527G probably damaging Het
Dnah6 T C 6: 73,126,413 (GRCm39) T1305A probably benign Het
Dnajc9 A G 14: 20,438,712 (GRCm39) V47A probably benign Het
Dnmt3b A G 2: 153,518,619 (GRCm39) Y594C probably damaging Het
Dph7 A G 2: 24,855,642 (GRCm39) D147G probably damaging Het
Drap1 T C 19: 5,473,380 (GRCm39) H164R possibly damaging Het
Dsg3 T A 18: 20,660,837 (GRCm39) V392E possibly damaging Het
Dxo A G 17: 35,056,616 (GRCm39) D81G probably benign Het
E230025N22Rik G T 18: 36,828,645 (GRCm39) T11K probably benign Het
Esyt1 A G 10: 128,354,801 (GRCm39) V533A possibly damaging Het
Etv3 T A 3: 87,443,338 (GRCm39) C307* probably null Het
Fam114a1 T A 5: 65,187,402 (GRCm39) probably null Het
Fam3c T A 6: 22,326,404 (GRCm39) probably benign Het
Fbn1 G T 2: 125,239,772 (GRCm39) T305K probably benign Het
Ggt1 A T 10: 75,421,428 (GRCm39) I484F probably damaging Het
Gpatch1 T C 7: 34,993,237 (GRCm39) D536G probably damaging Het
Gpx4 T C 10: 79,890,875 (GRCm39) I189T probably damaging Het
Gsr T A 8: 34,159,193 (GRCm39) C85S probably damaging Het
Gsta5 A T 9: 78,211,751 (GRCm39) D171V possibly damaging Het
Havcr1 T A 11: 46,661,369 (GRCm39) probably null Het
Heatr4 T C 12: 84,026,418 (GRCm39) T280A probably benign Het
Hmcn2 A T 2: 31,313,923 (GRCm39) E3532D probably benign Het
Hnrnpc T C 14: 52,312,556 (GRCm39) N308S possibly damaging Het
Ighv8-9 A G 12: 115,432,358 (GRCm39) V13A probably benign Het
Itgb2l A T 16: 96,227,439 (GRCm39) F535I probably benign Het
Kdm5a T G 6: 120,404,803 (GRCm39) D1348E probably damaging Het
Kndc1 CT C 7: 139,503,691 (GRCm39) probably null Het
Ky A G 9: 102,419,528 (GRCm39) I512V probably benign Het
Lamc1 A T 1: 153,119,021 (GRCm39) F866Y possibly damaging Het
Lbx1 C A 19: 45,223,687 (GRCm39) probably benign Het
Magel2 A G 7: 62,028,658 (GRCm39) T521A possibly damaging Het
Mgam A T 6: 40,723,367 (GRCm39) I491L probably benign Het
Mitd1 T C 1: 37,929,273 (GRCm39) E40G probably damaging Het
Mpzl3 A G 9: 44,981,985 (GRCm39) T218A probably benign Het
Mrpl42 A G 10: 95,316,827 (GRCm39) S77P probably benign Het
Mup5 C T 4: 61,752,911 (GRCm39) W37* probably null Het
Myh14 T C 7: 44,281,850 (GRCm39) I803V probably benign Het
Ncor2 T A 5: 125,107,153 (GRCm39) T744S Het
Ndufv3 A G 17: 31,746,596 (GRCm39) D162G probably damaging Het
Nostrin A G 2: 69,006,150 (GRCm39) E278G probably damaging Het
Nrxn1 T G 17: 90,469,807 (GRCm39) E1288A probably benign Het
Or4c11c A G 2: 88,661,472 (GRCm39) N4D possibly damaging Het
Or51b6b C A 7: 103,310,088 (GRCm39) R123L probably damaging Het
Or52h1 T A 7: 103,828,955 (GRCm39) Y220F probably damaging Het
Or8g55 A T 9: 39,784,751 (GRCm39) Y60F possibly damaging Het
Patj T A 4: 98,312,737 (GRCm39) probably null Het
Pcm1 T G 8: 41,720,381 (GRCm39) I314R possibly damaging Het
Pcsk6 A G 7: 65,683,646 (GRCm39) T754A probably benign Het
Pde2a A T 7: 101,152,041 (GRCm39) N326I probably benign Het
Plekhg4 T C 8: 106,105,316 (GRCm39) S594P possibly damaging Het
Plekhm3 T C 1: 64,977,065 (GRCm39) D135G probably damaging Het
Plin4 A T 17: 56,413,776 (GRCm39) M283K probably benign Het
Ppfia3 T C 7: 44,990,172 (GRCm39) probably null Het
Prdm9 T C 17: 15,775,914 (GRCm39) N179S probably benign Het
Prrt3 T C 6: 113,471,449 (GRCm39) S908G probably damaging Het
Psg22 C A 7: 18,456,660 (GRCm39) S181Y possibly damaging Het
Rcor3 C A 1: 191,822,173 (GRCm39) G8V probably damaging Het
Rp1l1 T A 14: 64,269,023 (GRCm39) C1536* probably null Het
Rpp25l T C 4: 41,712,529 (GRCm39) H82R probably damaging Het
Rps3a1 T A 3: 86,046,396 (GRCm39) M172L probably benign Het
Rtbdn T C 8: 85,679,556 (GRCm39) L110P probably damaging Het
Ryr1 T A 7: 28,778,010 (GRCm39) Q2169L probably damaging Het
Scn4a A T 11: 106,211,299 (GRCm39) C1573S possibly damaging Het
Sec16b A T 1: 157,358,965 (GRCm39) probably null Het
Serpina1a A T 12: 103,820,096 (GRCm39) D383E possibly damaging Het
Sh3gl3 T C 7: 81,934,285 (GRCm39) M262T probably benign Het
Sos2 G A 12: 69,637,654 (GRCm39) T1052M probably damaging Het
Spag16 G A 1: 70,036,000 (GRCm39) V343I probably benign Het
Spocd1 T G 4: 129,823,957 (GRCm39) D251E Het
Stc2 G T 11: 31,317,798 (GRCm39) N74K probably damaging Het
Tasor2 A G 13: 3,623,621 (GRCm39) Y2110H probably damaging Het
Thbs3 C T 3: 89,126,359 (GRCm39) Q227* probably null Het
Tmem92 A C 11: 94,669,816 (GRCm39) I105R probably benign Het
Tmod1 T A 4: 46,083,632 (GRCm39) N20K probably benign Het
Tns1 T C 1: 73,992,638 (GRCm39) D53G probably damaging Het
Tspan33 T A 6: 29,717,337 (GRCm39) L246Q probably damaging Het
Ttc16 A G 2: 32,658,980 (GRCm39) L392P probably damaging Het
Uggt1 T A 1: 36,224,919 (GRCm39) T572S probably benign Het
Usp17la A T 7: 104,509,604 (GRCm39) T70S probably damaging Het
Usp31 C T 7: 121,274,186 (GRCm39) R370H probably damaging Het
Wdr83 C T 8: 85,806,463 (GRCm39) V112M probably damaging Het
Zbtb25 T A 12: 76,416,366 (GRCm39) probably benign Het
Zfp110 T A 7: 12,583,267 (GRCm39) N638K possibly damaging Het
Zfp747l1 T A 7: 126,984,455 (GRCm39) S216C probably benign Het
Zfp820 T C 17: 22,037,994 (GRCm39) T445A probably benign Het
Other mutations in Chd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Chd9 APN 8 91,752,020 (GRCm39) missense possibly damaging 0.79
IGL00547:Chd9 APN 8 91,732,426 (GRCm39) missense probably damaging 1.00
IGL00589:Chd9 APN 8 91,742,474 (GRCm39) missense probably damaging 1.00
IGL00640:Chd9 APN 8 91,712,760 (GRCm39) missense probably damaging 0.99
IGL00663:Chd9 APN 8 91,710,118 (GRCm39) missense probably damaging 1.00
IGL00852:Chd9 APN 8 91,699,835 (GRCm39) missense probably benign 0.29
IGL00908:Chd9 APN 8 91,723,508 (GRCm39) missense probably damaging 1.00
IGL00911:Chd9 APN 8 91,778,320 (GRCm39) missense probably damaging 1.00
IGL01068:Chd9 APN 8 91,768,744 (GRCm39) missense probably benign 0.13
IGL01668:Chd9 APN 8 91,753,404 (GRCm39) missense possibly damaging 0.53
IGL01873:Chd9 APN 8 91,660,395 (GRCm39) missense probably benign 0.00
IGL01969:Chd9 APN 8 91,760,138 (GRCm39) missense possibly damaging 0.72
IGL02105:Chd9 APN 8 91,659,116 (GRCm39) missense probably damaging 1.00
IGL02153:Chd9 APN 8 91,683,122 (GRCm39) nonsense probably null
IGL02164:Chd9 APN 8 91,659,849 (GRCm39) missense possibly damaging 0.94
IGL02725:Chd9 APN 8 91,778,312 (GRCm39) missense possibly damaging 0.78
IGL02755:Chd9 APN 8 91,760,210 (GRCm39) missense probably benign 0.33
IGL02892:Chd9 APN 8 91,703,543 (GRCm39) splice site probably benign
IGL02897:Chd9 APN 8 91,660,496 (GRCm39) splice site probably benign
IGL03005:Chd9 APN 8 91,738,075 (GRCm39) missense probably damaging 0.98
IGL03062:Chd9 APN 8 91,741,895 (GRCm39) splice site probably benign
IGL03140:Chd9 APN 8 91,768,856 (GRCm39) missense possibly damaging 0.91
hovel UTSW 8 91,741,832 (GRCm39) missense probably benign 0.19
shack UTSW 8 91,659,426 (GRCm39) missense probably damaging 1.00
R0056:Chd9 UTSW 8 91,660,165 (GRCm39) missense possibly damaging 0.62
R0157:Chd9 UTSW 8 91,735,464 (GRCm39) splice site probably null
R0238:Chd9 UTSW 8 91,659,456 (GRCm39) missense probably damaging 1.00
R0238:Chd9 UTSW 8 91,659,456 (GRCm39) missense probably damaging 1.00
R0432:Chd9 UTSW 8 91,721,078 (GRCm39) splice site probably benign
R0454:Chd9 UTSW 8 91,699,859 (GRCm39) missense possibly damaging 0.83
R0573:Chd9 UTSW 8 91,725,223 (GRCm39) missense probably damaging 1.00
R0580:Chd9 UTSW 8 91,721,191 (GRCm39) missense possibly damaging 0.91
R0604:Chd9 UTSW 8 91,763,170 (GRCm39) missense possibly damaging 0.82
R0662:Chd9 UTSW 8 91,704,304 (GRCm39) missense probably damaging 0.99
R0825:Chd9 UTSW 8 91,777,825 (GRCm39) missense probably benign 0.06
R0945:Chd9 UTSW 8 91,659,630 (GRCm39) missense possibly damaging 0.60
R0964:Chd9 UTSW 8 91,741,832 (GRCm39) missense probably benign 0.19
R0967:Chd9 UTSW 8 91,716,107 (GRCm39) missense probably damaging 1.00
R1015:Chd9 UTSW 8 91,659,206 (GRCm39) missense probably damaging 0.99
R1066:Chd9 UTSW 8 91,712,764 (GRCm39) nonsense probably null
R1244:Chd9 UTSW 8 91,749,557 (GRCm39) missense probably damaging 0.99
R1505:Chd9 UTSW 8 91,733,123 (GRCm39) splice site probably null
R1570:Chd9 UTSW 8 91,763,170 (GRCm39) missense probably benign 0.03
R1591:Chd9 UTSW 8 91,710,166 (GRCm39) missense probably damaging 0.97
R1624:Chd9 UTSW 8 91,725,163 (GRCm39) missense probably benign 0.17
R1626:Chd9 UTSW 8 91,721,224 (GRCm39) missense probably benign 0.00
R1632:Chd9 UTSW 8 91,683,335 (GRCm39) nonsense probably null
R1649:Chd9 UTSW 8 91,659,229 (GRCm39) missense possibly damaging 0.88
R1664:Chd9 UTSW 8 91,749,418 (GRCm39) splice site probably null
R1668:Chd9 UTSW 8 91,767,814 (GRCm39) missense probably damaging 0.99
R1681:Chd9 UTSW 8 91,699,763 (GRCm39) missense probably damaging 0.98
R1695:Chd9 UTSW 8 91,728,410 (GRCm39) missense probably damaging 1.00
R1714:Chd9 UTSW 8 91,760,853 (GRCm39) utr 3 prime probably benign
R1746:Chd9 UTSW 8 91,737,326 (GRCm39) missense probably benign 0.01
R1843:Chd9 UTSW 8 91,737,422 (GRCm39) missense probably benign 0.19
R1844:Chd9 UTSW 8 91,683,323 (GRCm39) nonsense probably null
R1941:Chd9 UTSW 8 91,703,697 (GRCm39) critical splice donor site probably null
R2022:Chd9 UTSW 8 91,761,682 (GRCm39) missense probably benign 0.17
R2027:Chd9 UTSW 8 91,634,619 (GRCm39) unclassified probably benign
R2098:Chd9 UTSW 8 91,760,615 (GRCm39) missense probably benign 0.01
R2099:Chd9 UTSW 8 91,760,615 (GRCm39) missense probably benign 0.01
R2100:Chd9 UTSW 8 91,760,615 (GRCm39) missense probably benign 0.01
R2101:Chd9 UTSW 8 91,760,615 (GRCm39) missense probably benign 0.01
R2224:Chd9 UTSW 8 91,737,913 (GRCm39) missense probably benign 0.04
R2276:Chd9 UTSW 8 91,760,615 (GRCm39) missense probably benign 0.01
R2278:Chd9 UTSW 8 91,760,615 (GRCm39) missense probably benign 0.01
R2316:Chd9 UTSW 8 91,777,756 (GRCm39) missense probably damaging 0.99
R2507:Chd9 UTSW 8 91,760,615 (GRCm39) missense probably benign 0.01
R2508:Chd9 UTSW 8 91,760,615 (GRCm39) missense probably benign 0.01
R2988:Chd9 UTSW 8 91,757,088 (GRCm39) splice site probably null
R3418:Chd9 UTSW 8 91,763,219 (GRCm39) missense probably damaging 1.00
R3817:Chd9 UTSW 8 91,710,893 (GRCm39) splice site probably benign
R3923:Chd9 UTSW 8 91,660,147 (GRCm39) missense probably benign 0.16
R4001:Chd9 UTSW 8 91,683,185 (GRCm39) missense probably damaging 1.00
R4003:Chd9 UTSW 8 91,683,185 (GRCm39) missense probably damaging 1.00
R4006:Chd9 UTSW 8 91,660,188 (GRCm39) missense probably benign 0.12
R4013:Chd9 UTSW 8 91,699,797 (GRCm39) missense possibly damaging 0.82
R4067:Chd9 UTSW 8 91,750,202 (GRCm39) missense possibly damaging 0.53
R4108:Chd9 UTSW 8 91,737,304 (GRCm39) missense probably benign 0.04
R4125:Chd9 UTSW 8 91,777,912 (GRCm39) missense probably damaging 0.99
R4126:Chd9 UTSW 8 91,777,912 (GRCm39) missense probably damaging 0.99
R4452:Chd9 UTSW 8 91,704,308 (GRCm39) missense probably damaging 0.99
R4463:Chd9 UTSW 8 91,705,627 (GRCm39) missense probably benign 0.01
R4478:Chd9 UTSW 8 91,760,659 (GRCm39) utr 3 prime probably benign
R4587:Chd9 UTSW 8 91,763,134 (GRCm39) missense possibly damaging 0.95
R4628:Chd9 UTSW 8 91,710,091 (GRCm39) missense probably benign 0.05
R4667:Chd9 UTSW 8 91,760,428 (GRCm39) missense possibly damaging 0.73
R4908:Chd9 UTSW 8 91,741,877 (GRCm39) missense possibly damaging 0.50
R4912:Chd9 UTSW 8 91,760,858 (GRCm39) missense possibly damaging 0.84
R4977:Chd9 UTSW 8 91,760,336 (GRCm39) missense possibly damaging 0.96
R5016:Chd9 UTSW 8 91,733,254 (GRCm39) nonsense probably null
R5083:Chd9 UTSW 8 91,711,002 (GRCm39) missense probably damaging 1.00
R5088:Chd9 UTSW 8 91,704,147 (GRCm39) missense possibly damaging 0.94
R5090:Chd9 UTSW 8 91,753,462 (GRCm39) nonsense probably null
R5307:Chd9 UTSW 8 91,723,777 (GRCm39) missense probably damaging 1.00
R5541:Chd9 UTSW 8 91,778,132 (GRCm39) missense probably benign 0.09
R5559:Chd9 UTSW 8 91,742,553 (GRCm39) critical splice donor site probably null
R5638:Chd9 UTSW 8 91,738,078 (GRCm39) missense possibly damaging 0.67
R5640:Chd9 UTSW 8 91,763,190 (GRCm39) missense probably damaging 1.00
R5793:Chd9 UTSW 8 91,728,384 (GRCm39) missense probably damaging 1.00
R5827:Chd9 UTSW 8 91,716,078 (GRCm39) missense probably damaging 1.00
R5834:Chd9 UTSW 8 91,723,792 (GRCm39) missense probably damaging 1.00
R5875:Chd9 UTSW 8 91,778,464 (GRCm39) missense probably damaging 0.99
R6002:Chd9 UTSW 8 91,705,515 (GRCm39) missense probably damaging 1.00
R6091:Chd9 UTSW 8 91,761,691 (GRCm39) missense probably damaging 1.00
R6185:Chd9 UTSW 8 91,775,765 (GRCm39) missense probably damaging 1.00
R6246:Chd9 UTSW 8 91,659,045 (GRCm39) missense probably damaging 1.00
R6292:Chd9 UTSW 8 91,659,550 (GRCm39) missense probably benign 0.05
R6305:Chd9 UTSW 8 91,757,174 (GRCm39) missense possibly damaging 0.93
R6348:Chd9 UTSW 8 91,737,903 (GRCm39) missense possibly damaging 0.95
R6438:Chd9 UTSW 8 91,725,149 (GRCm39) missense probably benign 0.02
R6470:Chd9 UTSW 8 91,659,426 (GRCm39) missense probably damaging 1.00
R6798:Chd9 UTSW 8 91,778,182 (GRCm39) missense possibly damaging 0.56
R6902:Chd9 UTSW 8 91,769,579 (GRCm39) missense probably damaging 1.00
R6908:Chd9 UTSW 8 91,683,044 (GRCm39) missense probably benign 0.02
R6929:Chd9 UTSW 8 91,769,573 (GRCm39) missense probably damaging 1.00
R6969:Chd9 UTSW 8 91,705,542 (GRCm39) missense probably benign 0.34
R7043:Chd9 UTSW 8 91,760,843 (GRCm39) utr 3 prime probably benign
R7094:Chd9 UTSW 8 91,716,189 (GRCm39) missense unknown
R7126:Chd9 UTSW 8 91,741,853 (GRCm39) missense unknown
R7182:Chd9 UTSW 8 91,733,250 (GRCm39) missense unknown
R7219:Chd9 UTSW 8 91,728,394 (GRCm39) missense unknown
R7260:Chd9 UTSW 8 91,721,171 (GRCm39) missense unknown
R7293:Chd9 UTSW 8 91,760,707 (GRCm39) missense unknown
R7303:Chd9 UTSW 8 91,778,532 (GRCm39) missense unknown
R7358:Chd9 UTSW 8 91,760,846 (GRCm39) missense unknown
R7358:Chd9 UTSW 8 91,710,115 (GRCm39) missense unknown
R7451:Chd9 UTSW 8 91,760,446 (GRCm39) missense probably benign 0.27
R7451:Chd9 UTSW 8 91,760,418 (GRCm39) frame shift probably null
R7456:Chd9 UTSW 8 91,659,153 (GRCm39) nonsense probably null
R7481:Chd9 UTSW 8 91,683,066 (GRCm39) missense unknown
R7532:Chd9 UTSW 8 91,721,193 (GRCm39) missense unknown
R7611:Chd9 UTSW 8 91,763,017 (GRCm39) missense probably damaging 1.00
R7673:Chd9 UTSW 8 91,778,325 (GRCm39) missense probably damaging 0.96
R7723:Chd9 UTSW 8 91,741,837 (GRCm39) missense unknown
R7739:Chd9 UTSW 8 91,761,653 (GRCm39) missense probably damaging 1.00
R7759:Chd9 UTSW 8 91,704,178 (GRCm39) critical splice donor site probably null
R7916:Chd9 UTSW 8 91,761,684 (GRCm39) nonsense probably null
R7921:Chd9 UTSW 8 91,768,909 (GRCm39) critical splice donor site probably null
R7957:Chd9 UTSW 8 91,778,326 (GRCm39) missense probably damaging 0.99
R7972:Chd9 UTSW 8 91,732,395 (GRCm39) missense unknown
R8108:Chd9 UTSW 8 91,659,852 (GRCm39) missense unknown
R8115:Chd9 UTSW 8 91,762,960 (GRCm39) missense probably damaging 0.99
R8165:Chd9 UTSW 8 91,767,769 (GRCm39) missense probably damaging 1.00
R8171:Chd9 UTSW 8 91,752,015 (GRCm39) missense possibly damaging 0.92
R8186:Chd9 UTSW 8 91,725,233 (GRCm39) missense unknown
R8208:Chd9 UTSW 8 91,763,891 (GRCm39) splice site probably null
R8256:Chd9 UTSW 8 91,660,129 (GRCm39) missense unknown
R8281:Chd9 UTSW 8 91,763,225 (GRCm39) missense probably damaging 1.00
R8504:Chd9 UTSW 8 91,723,472 (GRCm39) missense unknown
R8836:Chd9 UTSW 8 91,767,812 (GRCm39) missense probably damaging 0.99
R8892:Chd9 UTSW 8 91,660,468 (GRCm39) missense unknown
R8985:Chd9 UTSW 8 91,721,101 (GRCm39) missense unknown
R9029:Chd9 UTSW 8 91,683,198 (GRCm39) missense unknown
R9030:Chd9 UTSW 8 91,683,198 (GRCm39) missense unknown
R9038:Chd9 UTSW 8 91,716,233 (GRCm39) missense unknown
R9081:Chd9 UTSW 8 91,704,144 (GRCm39) nonsense probably null
R9134:Chd9 UTSW 8 91,659,754 (GRCm39) missense unknown
R9205:Chd9 UTSW 8 91,757,270 (GRCm39) missense probably benign 0.01
R9309:Chd9 UTSW 8 91,733,319 (GRCm39) missense unknown
R9375:Chd9 UTSW 8 91,725,335 (GRCm39) critical splice donor site probably null
R9449:Chd9 UTSW 8 91,659,174 (GRCm39) missense unknown
R9547:Chd9 UTSW 8 91,683,186 (GRCm39) missense unknown
R9573:Chd9 UTSW 8 91,704,302 (GRCm39) missense unknown
R9576:Chd9 UTSW 8 91,659,294 (GRCm39) missense unknown
R9601:Chd9 UTSW 8 91,732,360 (GRCm39) nonsense probably null
R9613:Chd9 UTSW 8 91,683,150 (GRCm39) nonsense probably null
R9639:Chd9 UTSW 8 91,760,840 (GRCm39) missense probably null
R9718:Chd9 UTSW 8 91,712,801 (GRCm39) missense unknown
R9746:Chd9 UTSW 8 91,738,063 (GRCm39) missense unknown
R9762:Chd9 UTSW 8 91,712,741 (GRCm39) missense unknown
R9764:Chd9 UTSW 8 91,721,220 (GRCm39) missense unknown
R9790:Chd9 UTSW 8 91,760,417 (GRCm39) missense possibly damaging 0.82
R9791:Chd9 UTSW 8 91,760,417 (GRCm39) missense possibly damaging 0.82
RF007:Chd9 UTSW 8 91,760,578 (GRCm39) missense possibly damaging 0.66
X0065:Chd9 UTSW 8 91,763,200 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCAGTGTTATTGAACAGCTA -3'
(R):5'- GTGGTACAGCTTTACAACAAATGC -3'

Sequencing Primer
(F):5'- CTGGTCTACAAAGTGAGCTCCAG -3'
(R):5'- GCTTTACAACAAATGCTAATTAAGGC -3'
Posted On 2019-10-17