Incidental Mutation 'R7570:Plekhg4'
ID 585728
Institutional Source Beutler Lab
Gene Symbol Plekhg4
Ensembl Gene ENSMUSG00000014782
Gene Name pleckstrin homology domain containing, family G (with RhoGef domain) member 4
Synonyms 4931414L13Rik
MMRRC Submission 045631-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.176) question?
Stock # R7570 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 106099906-106109494 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 106105316 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 594 (S594P)
Ref Sequence ENSEMBL: ENSMUSP00000150574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014927] [ENSMUST00000063071] [ENSMUST00000159286] [ENSMUST00000160191] [ENSMUST00000160650] [ENSMUST00000167294] [ENSMUST00000214056] [ENSMUST00000168196]
AlphaFold A0A1L1SU27
Predicted Effect possibly damaging
Transcript: ENSMUST00000014927
AA Change: S558P

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000014927
Gene: ENSMUSG00000014782
AA Change: S558P

DomainStartEndE-ValueType
low complexity region 364 377 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
low complexity region 463 475 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
low complexity region 559 577 N/A INTRINSIC
low complexity region 653 664 N/A INTRINSIC
low complexity region 701 718 N/A INTRINSIC
RhoGEF 729 900 3.15e-29 SMART
PH 914 1022 1.44e-5 SMART
low complexity region 1148 1169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063071
SMART Domains Protein: ENSMUSP00000050687
Gene: ENSMUSG00000051648

DomainStartEndE-ValueType
Pfam:BTB_2 15 92 1.3e-9 PFAM
internal_repeat_1 173 251 8.34e-9 PROSPERO
internal_repeat_1 429 509 8.34e-9 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000159286
SMART Domains Protein: ENSMUSP00000125556
Gene: ENSMUSG00000014782

DomainStartEndE-ValueType
SCOP:d1aua_2 136 275 5e-9 SMART
Blast:SEC14 137 271 9e-8 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000160191
AA Change: S489P

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125249
Gene: ENSMUSG00000014782
AA Change: S489P

DomainStartEndE-ValueType
low complexity region 295 308 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 394 406 N/A INTRINSIC
low complexity region 466 478 N/A INTRINSIC
low complexity region 490 508 N/A INTRINSIC
low complexity region 584 595 N/A INTRINSIC
low complexity region 632 649 N/A INTRINSIC
RhoGEF 660 831 3.15e-29 SMART
PH 845 953 1.44e-5 SMART
low complexity region 1079 1100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160650
Predicted Effect probably benign
Transcript: ENSMUST00000167294
SMART Domains Protein: ENSMUSP00000130831
Gene: ENSMUSG00000051648

DomainStartEndE-ValueType
Pfam:BTB_2 15 93 3.9e-10 PFAM
internal_repeat_1 173 251 6.24e-9 PROSPERO
internal_repeat_1 406 486 6.24e-9 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000214056
AA Change: S594P

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000168196
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (104/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can function as a guanine nucleotide exchange factor (GEF) and may play a role in intracellular signaling and cytoskeleton dynamics at the Golgi apparatus. Polymorphisms in the region of this gene have been found to be associated with spinocerebellar ataxia in some study populations. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik C T 6: 91,911,591 (GRCm39) T613I probably benign Het
Ajuba T C 14: 54,813,859 (GRCm39) E288G probably damaging Het
Ankrd12 C T 17: 66,292,355 (GRCm39) R1026K probably benign Het
Apol7b T C 15: 77,307,674 (GRCm39) T274A probably benign Het
Arid4a A T 12: 71,109,916 (GRCm39) R86* probably null Het
Asnsd1 C T 1: 53,387,417 (GRCm39) G70D probably damaging Het
Atg4c T A 4: 99,116,797 (GRCm39) V313D possibly damaging Het
Atp13a5 A C 16: 29,085,715 (GRCm39) C885G probably damaging Het
Bpifb9a A T 2: 154,104,183 (GRCm39) I209F possibly damaging Het
Bsn T C 9: 107,990,742 (GRCm39) D1670G probably damaging Het
Cct8 T A 16: 87,288,210 (GRCm39) I121F probably benign Het
Cd209a T G 8: 3,794,151 (GRCm39) D217A probably damaging Het
Cdk19 C T 10: 40,353,954 (GRCm39) S456L possibly damaging Het
Chd9 C T 8: 91,721,208 (GRCm39) H999Y unknown Het
Col5a1 G A 2: 27,841,395 (GRCm39) V339M unknown Het
Cr2 G A 1: 194,851,648 (GRCm39) R115* probably null Het
Cyb561 A T 11: 105,828,470 (GRCm39) F62I probably damaging Het
Cyp2c38 A T 19: 39,393,187 (GRCm39) N293K possibly damaging Het
Cyp2c69 A T 19: 39,848,342 (GRCm39) D293E probably damaging Het
Dcbld2 T A 16: 58,244,932 (GRCm39) C69S possibly damaging Het
Dcdc2a T C 13: 25,303,356 (GRCm39) S296P probably benign Het
Dmxl1 T A 18: 50,027,024 (GRCm39) I2044K possibly damaging Het
Dnah5 A G 15: 28,347,098 (GRCm39) D2527G probably damaging Het
Dnah6 T C 6: 73,126,413 (GRCm39) T1305A probably benign Het
Dnajc9 A G 14: 20,438,712 (GRCm39) V47A probably benign Het
Dnmt3b A G 2: 153,518,619 (GRCm39) Y594C probably damaging Het
Dph7 A G 2: 24,855,642 (GRCm39) D147G probably damaging Het
Drap1 T C 19: 5,473,380 (GRCm39) H164R possibly damaging Het
Dsg3 T A 18: 20,660,837 (GRCm39) V392E possibly damaging Het
Dxo A G 17: 35,056,616 (GRCm39) D81G probably benign Het
E230025N22Rik G T 18: 36,828,645 (GRCm39) T11K probably benign Het
Esyt1 A G 10: 128,354,801 (GRCm39) V533A possibly damaging Het
Etv3 T A 3: 87,443,338 (GRCm39) C307* probably null Het
Fam114a1 T A 5: 65,187,402 (GRCm39) probably null Het
Fam3c T A 6: 22,326,404 (GRCm39) probably benign Het
Fbn1 G T 2: 125,239,772 (GRCm39) T305K probably benign Het
Ggt1 A T 10: 75,421,428 (GRCm39) I484F probably damaging Het
Gpatch1 T C 7: 34,993,237 (GRCm39) D536G probably damaging Het
Gpx4 T C 10: 79,890,875 (GRCm39) I189T probably damaging Het
Gsr T A 8: 34,159,193 (GRCm39) C85S probably damaging Het
Gsta5 A T 9: 78,211,751 (GRCm39) D171V possibly damaging Het
Havcr1 T A 11: 46,661,369 (GRCm39) probably null Het
Heatr4 T C 12: 84,026,418 (GRCm39) T280A probably benign Het
Hmcn2 A T 2: 31,313,923 (GRCm39) E3532D probably benign Het
Hnrnpc T C 14: 52,312,556 (GRCm39) N308S possibly damaging Het
Ighv8-9 A G 12: 115,432,358 (GRCm39) V13A probably benign Het
Itgb2l A T 16: 96,227,439 (GRCm39) F535I probably benign Het
Kdm5a T G 6: 120,404,803 (GRCm39) D1348E probably damaging Het
Kndc1 CT C 7: 139,503,691 (GRCm39) probably null Het
Ky A G 9: 102,419,528 (GRCm39) I512V probably benign Het
Lamc1 A T 1: 153,119,021 (GRCm39) F866Y possibly damaging Het
Lbx1 C A 19: 45,223,687 (GRCm39) probably benign Het
Magel2 A G 7: 62,028,658 (GRCm39) T521A possibly damaging Het
Mgam A T 6: 40,723,367 (GRCm39) I491L probably benign Het
Mitd1 T C 1: 37,929,273 (GRCm39) E40G probably damaging Het
Mpzl3 A G 9: 44,981,985 (GRCm39) T218A probably benign Het
Mrpl42 A G 10: 95,316,827 (GRCm39) S77P probably benign Het
Mup5 C T 4: 61,752,911 (GRCm39) W37* probably null Het
Myh14 T C 7: 44,281,850 (GRCm39) I803V probably benign Het
Ncor2 T A 5: 125,107,153 (GRCm39) T744S Het
Ndufv3 A G 17: 31,746,596 (GRCm39) D162G probably damaging Het
Nostrin A G 2: 69,006,150 (GRCm39) E278G probably damaging Het
Nrxn1 T G 17: 90,469,807 (GRCm39) E1288A probably benign Het
Or4c11c A G 2: 88,661,472 (GRCm39) N4D possibly damaging Het
Or51b6b C A 7: 103,310,088 (GRCm39) R123L probably damaging Het
Or52h1 T A 7: 103,828,955 (GRCm39) Y220F probably damaging Het
Or8g55 A T 9: 39,784,751 (GRCm39) Y60F possibly damaging Het
Patj T A 4: 98,312,737 (GRCm39) probably null Het
Pcm1 T G 8: 41,720,381 (GRCm39) I314R possibly damaging Het
Pcsk6 A G 7: 65,683,646 (GRCm39) T754A probably benign Het
Pde2a A T 7: 101,152,041 (GRCm39) N326I probably benign Het
Plekhm3 T C 1: 64,977,065 (GRCm39) D135G probably damaging Het
Plin4 A T 17: 56,413,776 (GRCm39) M283K probably benign Het
Ppfia3 T C 7: 44,990,172 (GRCm39) probably null Het
Prdm9 T C 17: 15,775,914 (GRCm39) N179S probably benign Het
Prrt3 T C 6: 113,471,449 (GRCm39) S908G probably damaging Het
Psg22 C A 7: 18,456,660 (GRCm39) S181Y possibly damaging Het
Rcor3 C A 1: 191,822,173 (GRCm39) G8V probably damaging Het
Rp1l1 T A 14: 64,269,023 (GRCm39) C1536* probably null Het
Rpp25l T C 4: 41,712,529 (GRCm39) H82R probably damaging Het
Rps3a1 T A 3: 86,046,396 (GRCm39) M172L probably benign Het
Rtbdn T C 8: 85,679,556 (GRCm39) L110P probably damaging Het
Ryr1 T A 7: 28,778,010 (GRCm39) Q2169L probably damaging Het
Scn4a A T 11: 106,211,299 (GRCm39) C1573S possibly damaging Het
Sec16b A T 1: 157,358,965 (GRCm39) probably null Het
Serpina1a A T 12: 103,820,096 (GRCm39) D383E possibly damaging Het
Sh3gl3 T C 7: 81,934,285 (GRCm39) M262T probably benign Het
Sos2 G A 12: 69,637,654 (GRCm39) T1052M probably damaging Het
Spag16 G A 1: 70,036,000 (GRCm39) V343I probably benign Het
Spocd1 T G 4: 129,823,957 (GRCm39) D251E Het
Stc2 G T 11: 31,317,798 (GRCm39) N74K probably damaging Het
Tasor2 A G 13: 3,623,621 (GRCm39) Y2110H probably damaging Het
Thbs3 C T 3: 89,126,359 (GRCm39) Q227* probably null Het
Tmem92 A C 11: 94,669,816 (GRCm39) I105R probably benign Het
Tmod1 T A 4: 46,083,632 (GRCm39) N20K probably benign Het
Tns1 T C 1: 73,992,638 (GRCm39) D53G probably damaging Het
Tspan33 T A 6: 29,717,337 (GRCm39) L246Q probably damaging Het
Ttc16 A G 2: 32,658,980 (GRCm39) L392P probably damaging Het
Uggt1 T A 1: 36,224,919 (GRCm39) T572S probably benign Het
Usp17la A T 7: 104,509,604 (GRCm39) T70S probably damaging Het
Usp31 C T 7: 121,274,186 (GRCm39) R370H probably damaging Het
Wdr83 C T 8: 85,806,463 (GRCm39) V112M probably damaging Het
Zbtb25 T A 12: 76,416,366 (GRCm39) probably benign Het
Zfp110 T A 7: 12,583,267 (GRCm39) N638K possibly damaging Het
Zfp747l1 T A 7: 126,984,455 (GRCm39) S216C probably benign Het
Zfp820 T C 17: 22,037,994 (GRCm39) T445A probably benign Het
Other mutations in Plekhg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Plekhg4 APN 8 106,102,370 (GRCm39) missense probably benign 0.01
IGL00970:Plekhg4 APN 8 106,105,067 (GRCm39) missense probably benign 0.02
IGL01784:Plekhg4 APN 8 106,105,589 (GRCm39) missense probably damaging 1.00
IGL02063:Plekhg4 APN 8 106,105,884 (GRCm39) splice site probably benign
IGL02371:Plekhg4 APN 8 106,105,691 (GRCm39) splice site probably null
IGL02984:Plekhg4 UTSW 8 106,107,020 (GRCm39) missense probably damaging 1.00
R0013:Plekhg4 UTSW 8 106,102,028 (GRCm39) nonsense probably null
R0105:Plekhg4 UTSW 8 106,108,644 (GRCm39) missense possibly damaging 0.65
R0105:Plekhg4 UTSW 8 106,108,644 (GRCm39) missense possibly damaging 0.65
R0631:Plekhg4 UTSW 8 106,105,934 (GRCm39) missense probably damaging 1.00
R1078:Plekhg4 UTSW 8 106,108,309 (GRCm39) nonsense probably null
R1201:Plekhg4 UTSW 8 106,108,305 (GRCm39) missense probably damaging 1.00
R1222:Plekhg4 UTSW 8 106,105,742 (GRCm39) missense probably benign 0.03
R1418:Plekhg4 UTSW 8 106,105,742 (GRCm39) missense probably benign 0.03
R1459:Plekhg4 UTSW 8 106,108,431 (GRCm39) missense probably damaging 0.98
R1465:Plekhg4 UTSW 8 106,107,672 (GRCm39) splice site probably benign
R1558:Plekhg4 UTSW 8 106,108,467 (GRCm39) missense possibly damaging 0.73
R1637:Plekhg4 UTSW 8 106,108,413 (GRCm39) missense probably benign 0.08
R1757:Plekhg4 UTSW 8 106,108,293 (GRCm39) missense probably damaging 0.99
R1922:Plekhg4 UTSW 8 106,105,017 (GRCm39) missense probably damaging 1.00
R1961:Plekhg4 UTSW 8 106,108,096 (GRCm39) missense probably damaging 0.99
R2074:Plekhg4 UTSW 8 106,103,084 (GRCm39) small deletion probably benign
R2113:Plekhg4 UTSW 8 106,106,066 (GRCm39) missense probably damaging 1.00
R2124:Plekhg4 UTSW 8 106,103,084 (GRCm39) small deletion probably benign
R2196:Plekhg4 UTSW 8 106,103,084 (GRCm39) small deletion probably benign
R2321:Plekhg4 UTSW 8 106,104,172 (GRCm39) missense probably benign 0.00
R2432:Plekhg4 UTSW 8 106,108,468 (GRCm39) missense probably benign 0.00
R2908:Plekhg4 UTSW 8 106,107,493 (GRCm39) missense probably damaging 1.00
R2910:Plekhg4 UTSW 8 106,103,084 (GRCm39) small deletion probably benign
R4179:Plekhg4 UTSW 8 106,108,030 (GRCm39) missense possibly damaging 0.93
R4180:Plekhg4 UTSW 8 106,108,030 (GRCm39) missense possibly damaging 0.93
R4513:Plekhg4 UTSW 8 106,107,034 (GRCm39) missense probably damaging 1.00
R4678:Plekhg4 UTSW 8 106,107,003 (GRCm39) nonsense probably null
R4946:Plekhg4 UTSW 8 106,108,628 (GRCm39) missense probably null 0.01
R5223:Plekhg4 UTSW 8 106,105,581 (GRCm39) missense probably benign 0.18
R5362:Plekhg4 UTSW 8 106,108,030 (GRCm39) missense possibly damaging 0.93
R5454:Plekhg4 UTSW 8 106,102,745 (GRCm39) critical splice donor site probably null
R5609:Plekhg4 UTSW 8 106,106,134 (GRCm39) critical splice donor site probably null
R5624:Plekhg4 UTSW 8 106,107,382 (GRCm39) missense probably damaging 0.99
R5806:Plekhg4 UTSW 8 106,105,542 (GRCm39) missense possibly damaging 0.85
R6297:Plekhg4 UTSW 8 106,104,472 (GRCm39) missense probably damaging 1.00
R7198:Plekhg4 UTSW 8 106,105,329 (GRCm39) missense probably damaging 1.00
R7443:Plekhg4 UTSW 8 106,107,499 (GRCm39) missense probably damaging 1.00
R7577:Plekhg4 UTSW 8 106,102,031 (GRCm39) missense probably benign
R7632:Plekhg4 UTSW 8 106,106,782 (GRCm39) missense probably damaging 1.00
R7782:Plekhg4 UTSW 8 106,104,399 (GRCm39) missense probably benign 0.14
R7958:Plekhg4 UTSW 8 106,103,281 (GRCm39) missense possibly damaging 0.86
R8239:Plekhg4 UTSW 8 106,107,546 (GRCm39) nonsense probably null
R8335:Plekhg4 UTSW 8 106,102,848 (GRCm39) missense probably damaging 0.97
R8411:Plekhg4 UTSW 8 106,103,961 (GRCm39) nonsense probably null
R9011:Plekhg4 UTSW 8 106,102,284 (GRCm39) missense probably benign 0.23
R9017:Plekhg4 UTSW 8 106,105,332 (GRCm39) missense possibly damaging 0.85
R9255:Plekhg4 UTSW 8 106,103,271 (GRCm39) missense probably benign 0.00
R9297:Plekhg4 UTSW 8 106,105,907 (GRCm39) missense probably damaging 1.00
R9391:Plekhg4 UTSW 8 106,106,043 (GRCm39) missense probably damaging 1.00
R9524:Plekhg4 UTSW 8 106,101,398 (GRCm39) missense unknown
R9613:Plekhg4 UTSW 8 106,107,620 (GRCm39) missense probably damaging 1.00
R9683:Plekhg4 UTSW 8 106,102,923 (GRCm39) missense probably benign 0.00
Z1177:Plekhg4 UTSW 8 106,101,474 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AGCTCCACCAGAGTCTCAATCG -3'
(R):5'- TTTTGGTCCAGAGCCAACCAG -3'

Sequencing Primer
(F):5'- ACCAGAGTCTCAATCGGCTTG -3'
(R):5'- AGGCACAGCGACATTCCTG -3'
Posted On 2019-10-17