Incidental Mutation 'R0620:B3galt2'
ID 58573
Institutional Source Beutler Lab
Gene Symbol B3galt2
Ensembl Gene ENSMUSG00000033849
Gene Name UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2
Synonyms
MMRRC Submission 038809-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock # R0620 (G1)
Quality Score 221
Status Validated
Chromosome 1
Chromosomal Location 143640664-143654614 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 143646140 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 5 (R5G)
Ref Sequence ENSEMBL: ENSMUSP00000046118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018337] [ENSMUST00000038252]
AlphaFold O54905
Predicted Effect probably benign
Transcript: ENSMUST00000018337
SMART Domains Protein: ENSMUSP00000018337
Gene: ENSMUSG00000026361

DomainStartEndE-ValueType
Pfam:CDC73_N 1 297 3.4e-135 PFAM
Pfam:CDC73_C 356 521 2.6e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000038252
AA Change: R5G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046118
Gene: ENSMUSG00000033849
AA Change: R5G

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Galactosyl_T 165 359 3.8e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189597
Meta Mutation Damage Score 0.4803 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the beta-1,3-galactosyltransferase (beta3GalT) gene family. This family encodes type II membrane-bound glycoproteins with diverse enzymatic functions using different donor substrates (UDP-galactose and UDP-N-acetylglucosamine) and different acceptor sugars (N-acetylglucosamine, galactose, N-acetylgalactosamine). The beta3GalT genes are distantly related to the Drosophila Brainiac gene and have the protein coding sequence contained in a single exon. The beta3GalT proteins also contain conserved sequences not found in the beta4GalT or alpha3GalT proteins. The carbohydrate chains synthesized by these enzymes are designated as type 1, whereas beta4GalT enzymes synthesize type 2 carbohydrate chains. The ratio of type 1:type 2 chains changes during embryogenesis. By sequence similarity, the beta3GalT genes fall into at least two groups: beta3GalT4 and 4 other beta3GalT genes (beta3GalT1-3, beta3GalT5). This gene encodes a protein that functions in N-linked glycoprotein glycosylation and shows strict donor substrate specificity for UDP-galactose. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice for a targeted mutation display hyperactivity, impaired motor coordination, decreased anxiety, increased startle reflexes, and decreased coping response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,328,375 Q973L probably damaging Het
Adamts9 T C 6: 92,858,113 T679A possibly damaging Het
Ahr T C 12: 35,508,194 T276A probably benign Het
Akap9 A T 5: 4,064,136 Q3138H probably damaging Het
Armt1 T A 10: 4,432,689 F7I probably benign Het
Bod1l T C 5: 41,801,233 N2750S probably benign Het
Cadps2 T A 6: 23,583,396 E365V probably damaging Het
Cd200r3 T A 16: 44,957,717 probably null Het
Cst7 T A 2: 150,575,886 probably benign Het
Defb30 A T 14: 63,049,763 probably benign Het
Dido1 C T 2: 180,659,851 G2087S probably benign Het
Dio2 A G 12: 90,738,071 Y72H probably benign Het
Dnah11 C T 12: 117,987,469 E3035K probably damaging Het
Dnajb13 T C 7: 100,503,249 K287E possibly damaging Het
Dnajc11 G A 4: 151,973,628 V244I possibly damaging Het
Ect2 C T 3: 27,139,652 A226T probably damaging Het
Ercc8 G A 13: 108,174,061 probably null Het
Fam120b T A 17: 15,402,927 M389K probably benign Het
Fam151a A G 4: 106,747,931 M497V probably benign Het
Fam186b C A 15: 99,280,128 G439V probably benign Het
Fank1 A G 7: 133,876,765 Y185C probably damaging Het
Gart T C 16: 91,630,602 probably benign Het
Glb1l T C 1: 75,199,720 Y572C probably damaging Het
Gm11563 C T 11: 99,658,437 A164T unknown Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
Gsdmc3 T A 15: 63,859,693 D330V probably damaging Het
H2-DMa C T 17: 34,137,960 T144M probably damaging Het
Haus6 A T 4: 86,583,514 F707I possibly damaging Het
Hmcn1 T A 1: 150,594,016 T4971S probably benign Het
Ints6 A T 14: 62,696,759 F766L probably benign Het
Kdm5d T A Y: 927,330 M650K probably damaging Het
Kif21b T C 1: 136,159,428 F881S possibly damaging Het
Klrk1 C A 6: 129,614,635 Q176H possibly damaging Het
Ky T C 9: 102,537,621 V244A probably benign Het
Mia2 T A 12: 59,154,419 L191M possibly damaging Het
Miga2 T A 2: 30,381,744 probably benign Het
Mtss1l C T 8: 110,737,948 P322S probably damaging Het
Nalcn A G 14: 123,299,141 probably benign Het
Ncbp3 T A 11: 73,049,845 probably benign Het
Nprl3 G A 11: 32,234,876 L378F probably damaging Het
Ntrk2 A T 13: 58,846,821 M184L probably benign Het
Olfr311 T G 11: 58,841,443 C110G probably damaging Het
Olfr738 G T 14: 50,413,697 C51F probably benign Het
Osbpl9 T C 4: 109,083,128 E287G probably damaging Het
Parva T C 7: 112,576,411 F250L probably damaging Het
Pcdhb11 C T 18: 37,421,811 Q65* probably null Het
Phtf1 A G 3: 103,993,765 T377A probably damaging Het
Pkp4 G A 2: 59,322,643 V612I possibly damaging Het
Plscr2 C A 9: 92,287,654 S52R probably benign Het
Pnisr C T 4: 21,874,092 probably benign Het
Pole2 A C 12: 69,209,879 S291A probably damaging Het
Ppp2r5d A G 17: 46,684,018 F586L probably benign Het
Prrx1 G A 1: 163,257,816 R182C probably damaging Het
Ptprs A G 17: 56,429,103 I110T possibly damaging Het
Rasgrf2 G A 13: 91,919,817 probably benign Het
Riox2 T C 16: 59,491,892 V464A probably benign Het
Robo2 A G 16: 73,967,802 V646A possibly damaging Het
Ros1 T A 10: 52,118,348 I1279F probably damaging Het
Siglec1 G A 2: 131,074,268 T1254M probably benign Het
Snx7 T C 3: 117,846,675 N62D probably damaging Het
Sp100 G A 1: 85,659,867 probably null Het
Stil A T 4: 115,007,159 I86L possibly damaging Het
Tbc1d16 T A 11: 119,209,038 D170V probably benign Het
Tmem2 T A 19: 21,817,971 S743T probably benign Het
Trappc13 G A 13: 104,161,081 T105M probably damaging Het
Trhr T A 15: 44,229,500 S378T probably benign Het
Ttc7b T C 12: 100,500,073 probably null Het
Vegfc A T 8: 54,157,139 Y110F probably benign Het
Vmn1r184 C A 7: 26,267,177 P116H possibly damaging Het
Vmn2r5 A T 3: 64,503,814 C444* probably null Het
Zfp341 A G 2: 154,634,273 E460G possibly damaging Het
Zfp819 T A 7: 43,616,444 V41E probably benign Het
Other mutations in B3galt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:B3galt2 APN 1 143647155 missense probably damaging 1.00
IGL01019:B3galt2 APN 1 143646757 missense probably benign 0.00
IGL01406:B3galt2 APN 1 143647106 missense possibly damaging 0.91
IGL01736:B3galt2 APN 1 143646845 missense probably benign 0.00
IGL02427:B3galt2 APN 1 143646516 missense probably benign
IGL03289:B3galt2 APN 1 143647304 missense probably damaging 1.00
R0143:B3galt2 UTSW 1 143647334 missense possibly damaging 0.95
R0665:B3galt2 UTSW 1 143646453 missense possibly damaging 0.64
R1765:B3galt2 UTSW 1 143646469 missense probably benign 0.03
R2325:B3galt2 UTSW 1 143647188 missense probably benign 0.01
R3817:B3galt2 UTSW 1 143647073 missense probably damaging 1.00
R5248:B3galt2 UTSW 1 143647111 missense probably benign 0.01
R5863:B3galt2 UTSW 1 143646366 missense probably benign 0.36
R6339:B3galt2 UTSW 1 143646902 missense possibly damaging 0.49
R6419:B3galt2 UTSW 1 143647101 missense possibly damaging 0.48
R7529:B3galt2 UTSW 1 143646536 missense probably benign 0.01
R7577:B3galt2 UTSW 1 143647304 missense probably damaging 1.00
R8966:B3galt2 UTSW 1 143646145 missense probably damaging 1.00
R9421:B3galt2 UTSW 1 143646626 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTTCTGAAGGCCCTCTTTCCGAG -3'
(R):5'- TGTGACTCCCTGTGGTGATAGCTC -3'

Sequencing Primer
(F):5'- CCGAGCCTTTGTCAGAAATC -3'
(R):5'- TCCTCGGAAAGTGTATGTCACAG -3'
Posted On 2013-07-11