Incidental Mutation 'R7570:Bsn'
ID585733
Institutional Source Beutler Lab
Gene Symbol Bsn
Ensembl Gene ENSMUSG00000032589
Gene Namebassoon
Synonymspresynaptic cytomatrix protein
MMRRC Submission
Accession Numbers

Genbank: NM_007567; MGI: 1277955

Is this an essential gene? Possibly non essential (E-score: 0.380) question?
Stock #R7570 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location108096022-108190384 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108113543 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1670 (D1670G)
Ref Sequence ENSEMBL: ENSMUSP00000035208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035208]
Predicted Effect probably damaging
Transcript: ENSMUST00000035208
AA Change: D1670G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035208
Gene: ENSMUSG00000032589
AA Change: D1670G

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
low complexity region 42 77 N/A INTRINSIC
Pfam:zf-piccolo 165 223 6.1e-30 PFAM
low complexity region 394 409 N/A INTRINSIC
low complexity region 445 454 N/A INTRINSIC
Pfam:zf-piccolo 462 520 5.2e-31 PFAM
low complexity region 527 540 N/A INTRINSIC
low complexity region 627 643 N/A INTRINSIC
low complexity region 664 681 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
low complexity region 788 803 N/A INTRINSIC
low complexity region 994 1021 N/A INTRINSIC
coiled coil region 1047 1101 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1333 1343 N/A INTRINSIC
low complexity region 1443 1455 N/A INTRINSIC
low complexity region 1481 1498 N/A INTRINSIC
low complexity region 1790 1800 N/A INTRINSIC
low complexity region 2117 2126 N/A INTRINSIC
low complexity region 2287 2303 N/A INTRINSIC
low complexity region 2326 2356 N/A INTRINSIC
SCOP:d1eq1a_ 2362 2477 2e-7 SMART
low complexity region 2607 2614 N/A INTRINSIC
low complexity region 2635 2651 N/A INTRINSIC
low complexity region 2655 2672 N/A INTRINSIC
coiled coil region 2949 2990 N/A INTRINSIC
low complexity region 3057 3071 N/A INTRINSIC
low complexity region 3089 3114 N/A INTRINSIC
low complexity region 3446 3461 N/A INTRINSIC
low complexity region 3520 3534 N/A INTRINSIC
low complexity region 3653 3666 N/A INTRINSIC
low complexity region 3750 3820 N/A INTRINSIC
low complexity region 3831 3852 N/A INTRINSIC
low complexity region 3856 3901 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124763
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (104/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurotransmitters are released from a specific site in the axon terminal called the active zone, which is composed of synaptic vesicles and a meshwork of cytoskeleton underlying the plasma membrane. The protein encoded by this gene is thought to be a scaffolding protein involved in organizing the presynaptic cytoskeleton. The gene is expressed primarily in neurons in the brain. A similar gene product in rodents is concentrated in the active zone of axon terminals and tightly associated with cytoskeletal structures, and is essential for regulating neurotransmitter release from a subset of synapses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants lacking functional protein exhibit impaired hippocampal and photoreceptor synaptic transmission, aberrant photoreceptor ribbon synapse formation, and spontaneous epileptic seizures. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(1) Gene trapped(8)

Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik C T 6: 91,934,610 T613I probably benign Het
9130019O22Rik T A 7: 127,385,283 S216C probably benign Het
Ajuba T C 14: 54,576,402 E288G probably damaging Het
Ankrd12 C T 17: 65,985,360 R1026K probably benign Het
Apol7b T C 15: 77,423,474 T274A probably benign Het
Arid4a A T 12: 71,063,142 R86* probably null Het
Asnsd1 C T 1: 53,348,258 G70D probably damaging Het
Atg4c T A 4: 99,228,560 V313D possibly damaging Het
Atp13a5 A C 16: 29,266,963 C885G probably damaging Het
Bpifb9a A T 2: 154,262,263 I209F possibly damaging Het
Cct8 T A 16: 87,491,322 I121F probably benign Het
Cd209a T G 8: 3,744,151 D217A probably damaging Het
Cdk19 C T 10: 40,477,958 S456L possibly damaging Het
Chd9 C T 8: 90,994,580 H999Y unknown Het
Col5a1 G A 2: 27,951,383 V339M unknown Het
Cr2 G A 1: 195,169,340 R115* probably null Het
Cyb561 A T 11: 105,937,644 F62I probably damaging Het
Cyp2c38 A T 19: 39,404,743 N293K possibly damaging Het
Cyp2c69 A T 19: 39,859,898 D293E probably damaging Het
Dcbld2 T A 16: 58,424,569 C69S possibly damaging Het
Dcdc2a T C 13: 25,119,373 S296P probably benign Het
Dmxl1 T A 18: 49,893,957 I2044K possibly damaging Het
Dnah5 A G 15: 28,346,952 D2527G probably damaging Het
Dnah6 T C 6: 73,149,430 T1305A probably benign Het
Dnajc9 A G 14: 20,388,644 V47A probably benign Het
Dnmt3b A G 2: 153,676,699 Y594C probably damaging Het
Dph7 A G 2: 24,965,630 D147G probably damaging Het
Drap1 T C 19: 5,423,352 H164R possibly damaging Het
Dsg3 T A 18: 20,527,780 V392E possibly damaging Het
Dxo A G 17: 34,837,640 D81G probably benign Het
E230025N22Rik G T 18: 36,695,592 T11K probably benign Het
Esyt1 A G 10: 128,518,932 V533A possibly damaging Het
Etv3 T A 3: 87,536,031 C307* probably null Het
Fam114a1 T A 5: 65,030,059 probably null Het
Fam208b A G 13: 3,573,621 Y2110H probably damaging Het
Fam3c T A 6: 22,326,405 probably benign Het
Fbn1 G T 2: 125,397,852 T305K probably benign Het
Ggt1 A T 10: 75,585,594 I484F probably damaging Het
Gm10639 A T 9: 78,304,469 D171V possibly damaging Het
Gpatch1 T C 7: 35,293,812 D536G probably damaging Het
Gpx4 T C 10: 80,055,041 I189T probably damaging Het
Gsr T A 8: 33,669,165 C85S probably damaging Het
Havcr1 T A 11: 46,770,542 probably null Het
Heatr4 T C 12: 83,979,644 T280A probably benign Het
Hmcn2 A T 2: 31,423,911 E3532D probably benign Het
Hnrnpc T C 14: 52,075,099 N308S possibly damaging Het
Ighv8-9 A G 12: 115,468,738 V13A probably benign Het
Itgb2l A T 16: 96,426,239 F535I probably benign Het
Kdm5a T G 6: 120,427,842 D1348E probably damaging Het
Kndc1 CT C 7: 139,923,775 probably null Het
Ky A G 9: 102,542,329 I512V probably benign Het
Lamc1 A T 1: 153,243,275 F866Y possibly damaging Het
Lbx1 C A 19: 45,235,248 probably benign Het
Magel2 A G 7: 62,378,910 T521A possibly damaging Het
Mgam A T 6: 40,746,433 I491L probably benign Het
Mitd1 T C 1: 37,890,192 E40G probably damaging Het
Mpzl3 A G 9: 45,070,687 T218A probably benign Het
Mrpl42 A G 10: 95,480,965 S77P probably benign Het
Mup5 C T 4: 61,834,674 W37* probably null Het
Myh14 T C 7: 44,632,426 I803V probably benign Het
Ncor2 T A 5: 125,030,089 T744S Het
Ndufv3 A G 17: 31,527,622 D162G probably damaging Het
Nostrin A G 2: 69,175,806 E278G probably damaging Het
Nrxn1 T G 17: 90,162,379 E1288A probably benign Het
Olfr1205 A G 2: 88,831,128 N4D possibly damaging Het
Olfr623 C A 7: 103,660,881 R123L probably damaging Het
Olfr648 T A 7: 104,179,748 Y220F probably damaging Het
Olfr972 A T 9: 39,873,455 Y60F possibly damaging Het
Patj T A 4: 98,424,500 probably null Het
Pcm1 T G 8: 41,267,344 I314R possibly damaging Het
Pcsk6 A G 7: 66,033,898 T754A probably benign Het
Pde2a A T 7: 101,502,834 N326I probably benign Het
Plekhg4 T C 8: 105,378,684 S594P possibly damaging Het
Plekhm3 T C 1: 64,937,906 D135G probably damaging Het
Plin4 A T 17: 56,106,776 M283K probably benign Het
Ppfia3 T C 7: 45,340,748 probably null Het
Prdm9 T C 17: 15,555,652 N179S probably benign Het
Prrt3 T C 6: 113,494,488 S908G probably damaging Het
Psg22 C A 7: 18,722,735 S181Y possibly damaging Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rp1l1 T A 14: 64,031,574 C1536* probably null Het
Rpp25l T C 4: 41,712,529 H82R probably damaging Het
Rps3a1 T A 3: 86,139,089 M172L probably benign Het
Rtbdn T C 8: 84,952,927 L110P probably damaging Het
Ryr1 T A 7: 29,078,585 Q2169L probably damaging Het
Scn4a A T 11: 106,320,473 C1573S possibly damaging Het
Sec16b A T 1: 157,531,395 probably null Het
Serpina1a A T 12: 103,853,837 D383E possibly damaging Het
Sh3gl3 T C 7: 82,285,077 M262T probably benign Het
Sos2 G A 12: 69,590,880 T1052M probably damaging Het
Spag16 G A 1: 69,996,841 V343I probably benign Het
Spocd1 T G 4: 129,930,164 D251E Het
Stc2 G T 11: 31,367,798 N74K probably damaging Het
Thbs3 C T 3: 89,219,052 Q227* probably null Het
Tmem92 A C 11: 94,778,990 I105R probably benign Het
Tmod1 T A 4: 46,083,632 N20K probably benign Het
Tns1 T C 1: 73,953,479 D53G probably damaging Het
Tspan33 T A 6: 29,717,338 L246Q probably damaging Het
Ttc16 A G 2: 32,768,968 L392P probably damaging Het
Uggt1 T A 1: 36,185,838 T572S probably benign Het
Usp17la A T 7: 104,860,397 T70S probably damaging Het
Usp31 C T 7: 121,674,963 R370H probably damaging Het
Wdr83 C T 8: 85,079,834 V112M probably damaging Het
Zbtb25 T A 12: 76,369,592 probably benign Het
Zfp110 T A 7: 12,849,340 N638K possibly damaging Het
Zfp820 T C 17: 21,819,013 T445A probably benign Het
Other mutations in Bsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Bsn APN 9 108115110 missense probably benign 0.01
IGL00330:Bsn APN 9 108115340 missense probably damaging 1.00
IGL00863:Bsn APN 9 108115322 missense probably damaging 1.00
IGL01123:Bsn APN 9 108115986 missense probably damaging 1.00
IGL01330:Bsn APN 9 108110913 unclassified probably benign
IGL01336:Bsn APN 9 108111785 missense probably damaging 0.99
IGL01399:Bsn APN 9 108107187 missense unknown
IGL01683:Bsn APN 9 108114896 missense possibly damaging 0.71
IGL02022:Bsn APN 9 108110418 unclassified probably benign
IGL02396:Bsn APN 9 108116046 missense possibly damaging 0.90
IGL02538:Bsn APN 9 108105236 missense unknown
IGL02565:Bsn APN 9 108113288 missense probably damaging 0.99
IGL02661:Bsn APN 9 108106936 nonsense probably null
IGL02739:Bsn APN 9 108112546 missense probably benign 0.14
IGL02951:Bsn APN 9 108115613 missense probably damaging 1.00
IGL02987:Bsn APN 9 108126304 missense probably benign 0.03
IGL03033:Bsn APN 9 108115993 missense probably damaging 1.00
IGL03069:Bsn APN 9 108114263 missense probably damaging 1.00
IGL03076:Bsn APN 9 108105382 missense unknown
R0068:Bsn UTSW 9 108112137 missense probably damaging 1.00
R0068:Bsn UTSW 9 108112137 missense probably damaging 1.00
R0167:Bsn UTSW 9 108125986 missense probably benign 0.01
R0234:Bsn UTSW 9 108116396 missense possibly damaging 0.50
R0234:Bsn UTSW 9 108116396 missense possibly damaging 0.50
R0359:Bsn UTSW 9 108111846 missense possibly damaging 0.81
R0514:Bsn UTSW 9 108125782 missense probably benign 0.07
R0593:Bsn UTSW 9 108110306 missense unknown
R0617:Bsn UTSW 9 108107240 missense unknown
R0636:Bsn UTSW 9 108107834 missense unknown
R0652:Bsn UTSW 9 108105742 missense unknown
R0718:Bsn UTSW 9 108111360 unclassified probably benign
R0730:Bsn UTSW 9 108106812 missense unknown
R0905:Bsn UTSW 9 108105635 missense unknown
R0963:Bsn UTSW 9 108111807 missense possibly damaging 0.81
R0992:Bsn UTSW 9 108114354 nonsense probably null
R1101:Bsn UTSW 9 108116411 missense probably damaging 1.00
R1393:Bsn UTSW 9 108110517 unclassified probably benign
R1490:Bsn UTSW 9 108113994 missense probably benign 0.03
R1566:Bsn UTSW 9 108125985 missense probably benign 0.35
R1582:Bsn UTSW 9 108105092 missense unknown
R1738:Bsn UTSW 9 108106934 missense unknown
R1867:Bsn UTSW 9 108106719 missense unknown
R1918:Bsn UTSW 9 108107573 missense unknown
R1933:Bsn UTSW 9 108116444 missense possibly damaging 0.91
R1946:Bsn UTSW 9 108114651 missense probably damaging 0.99
R1978:Bsn UTSW 9 108114549 missense probably benign 0.35
R2068:Bsn UTSW 9 108110684 unclassified probably benign
R2068:Bsn UTSW 9 108126550 missense possibly damaging 0.95
R2113:Bsn UTSW 9 108114886 missense probably benign 0.14
R2136:Bsn UTSW 9 108113231 missense probably damaging 1.00
R2172:Bsn UTSW 9 108109992 intron probably benign
R2266:Bsn UTSW 9 108115124 missense probably damaging 1.00
R2293:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2294:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2368:Bsn UTSW 9 108111030 nonsense probably null
R2442:Bsn UTSW 9 108106920 missense unknown
R2507:Bsn UTSW 9 108116114 missense probably damaging 1.00
R2880:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2881:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2922:Bsn UTSW 9 108108186 missense unknown
R2922:Bsn UTSW 9 108115469 missense probably damaging 1.00
R3618:Bsn UTSW 9 108117561 critical splice acceptor site probably null
R3742:Bsn UTSW 9 108105739 missense unknown
R3825:Bsn UTSW 9 108106856 missense unknown
R3982:Bsn UTSW 9 108107166 missense unknown
R4094:Bsn UTSW 9 108113870 missense probably damaging 1.00
R4158:Bsn UTSW 9 108112946 missense possibly damaging 0.95
R4225:Bsn UTSW 9 108106733 missense unknown
R4261:Bsn UTSW 9 108110684 unclassified probably benign
R4482:Bsn UTSW 9 108114664 missense probably damaging 1.00
R4515:Bsn UTSW 9 108104078 splice site probably null
R4585:Bsn UTSW 9 108110463 unclassified probably benign
R4628:Bsn UTSW 9 108113235 missense probably damaging 1.00
R4636:Bsn UTSW 9 108115424 missense probably damaging 1.00
R4679:Bsn UTSW 9 108110130 missense unknown
R4723:Bsn UTSW 9 108112655 missense probably benign 0.03
R4843:Bsn UTSW 9 108107189 missense unknown
R4885:Bsn UTSW 9 108107527 nonsense probably null
R4936:Bsn UTSW 9 108111761 missense probably damaging 1.00
R4942:Bsn UTSW 9 108106479 missense unknown
R4972:Bsn UTSW 9 108115178 missense probably damaging 1.00
R4992:Bsn UTSW 9 108115548 missense probably damaging 1.00
R5067:Bsn UTSW 9 108111953 missense probably damaging 1.00
R5206:Bsn UTSW 9 108105373 missense unknown
R5286:Bsn UTSW 9 108110924 unclassified probably benign
R5492:Bsn UTSW 9 108112515 missense probably damaging 0.98
R5553:Bsn UTSW 9 108110421 unclassified probably benign
R5561:Bsn UTSW 9 108105511 missense unknown
R5597:Bsn UTSW 9 108114932 missense probably benign 0.06
R5646:Bsn UTSW 9 108110432 unclassified probably benign
R5796:Bsn UTSW 9 108126024 missense probably damaging 1.00
R5801:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R5802:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R5850:Bsn UTSW 9 108114950 missense probably damaging 0.99
R5938:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R6221:Bsn UTSW 9 108105566 missense unknown
R6243:Bsn UTSW 9 108107561 missense unknown
R6254:Bsn UTSW 9 108111866 missense probably damaging 0.96
R6263:Bsn UTSW 9 108113254 missense probably damaging 1.00
R6345:Bsn UTSW 9 108107355 missense unknown
R6368:Bsn UTSW 9 108111314 unclassified probably benign
R6574:Bsn UTSW 9 108113954 missense possibly damaging 0.95
R6793:Bsn UTSW 9 108114615 nonsense probably null
R6802:Bsn UTSW 9 108110624 unclassified probably benign
R6943:Bsn UTSW 9 108107817 missense unknown
R6999:Bsn UTSW 9 108113433 missense probably benign 0.00
R7149:Bsn UTSW 9 108116321 nonsense probably null
R7199:Bsn UTSW 9 108115334 missense probably damaging 1.00
R7322:Bsn UTSW 9 108126421 nonsense probably null
R7349:Bsn UTSW 9 108110783 missense unknown
R7372:Bsn UTSW 9 108110519 missense unknown
R7373:Bsn UTSW 9 108113484 missense probably damaging 1.00
R7413:Bsn UTSW 9 108139491 missense possibly damaging 0.61
R7473:Bsn UTSW 9 108112250 missense probably damaging 1.00
R7482:Bsn UTSW 9 108113529 missense probably damaging 0.98
R7530:Bsn UTSW 9 108111956 missense probably damaging 1.00
R7549:Bsn UTSW 9 108114815 missense probably benign 0.05
R7635:Bsn UTSW 9 108110990 missense unknown
R7696:Bsn UTSW 9 108114501 missense probably damaging 1.00
R7757:Bsn UTSW 9 108114740 missense possibly damaging 0.90
R7868:Bsn UTSW 9 108114899 missense possibly damaging 0.95
R7897:Bsn UTSW 9 108111866 missense probably damaging 0.98
R7951:Bsn UTSW 9 108114899 missense possibly damaging 0.95
R7980:Bsn UTSW 9 108111866 missense probably damaging 0.98
R8022:Bsn UTSW 9 108114404
R8056:Bsn UTSW 9 108105307
X0028:Bsn UTSW 9 108113504 missense probably damaging 1.00
X0066:Bsn UTSW 9 108139210 missense probably damaging 1.00
Z1177:Bsn UTSW 9 108105499
Z1177:Bsn UTSW 9 108139195
Predicted Primers PCR Primer
(F):5'- GATGAGGCCATTGTGATGCTC -3'
(R):5'- TCTCAAATGCCCTCGGAACC -3'

Sequencing Primer
(F):5'- CCAGGAAGGTATGGGTCTGCTC -3'
(R):5'- CCCTCGGAACCGGCTGG -3'
Posted On2019-10-17