Incidental Mutation 'R7570:Ggt1'
ID585735
Institutional Source Beutler Lab
Gene Symbol Ggt1
Ensembl Gene ENSMUSG00000006345
Gene Namegamma-glutamyltransferase 1
SynonymsGgtp, CD224, GGT, dwg
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R7570 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location75561604-75586200 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75585594 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 484 (I484F)
Ref Sequence ENSEMBL: ENSMUSP00000006508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006508] [ENSMUST00000072217] [ENSMUST00000134503] [ENSMUST00000189972] [ENSMUST00000218807]
Predicted Effect probably damaging
Transcript: ENSMUST00000006508
AA Change: I484F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000006508
Gene: ENSMUSG00000006345
AA Change: I484F

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 563 4.9e-179 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072217
SMART Domains Protein: ENSMUSP00000072074
Gene: ENSMUSG00000006344

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:G_glu_transpept 58 568 1.6e-164 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129020
SMART Domains Protein: ENSMUSP00000118825
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
Pfam:G_glu_transpept 1 263 3.3e-88 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134503
AA Change: I484F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121312
Gene: ENSMUSG00000006345
AA Change: I484F

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 563 1.4e-184 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155186
SMART Domains Protein: ENSMUSP00000123017
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
Pfam:G_glu_transpept 1 128 6.3e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189972
SMART Domains Protein: ENSMUSP00000139459
Gene: ENSMUSG00000006344

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189991
Predicted Effect probably benign
Transcript: ENSMUST00000218807
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (104/106)
MGI Phenotype FUNCTION: This gene encodes gamma-glutamyl transpeptidase, a plasmamembrane-associated enzyme that cleaves the peptide bond between gamma-glutamyl and cysteinyl glycine moieties of glutathione. The encoded protein is autocatalytically processed to generate an enzymatically active heterodimer comprised of heavy and light chains. Mice lacking the encoded protein grow slowly, develop cataracts and have elevated levels of glutathione in plasma and urine. Transgenic overexpression of the encoded protein in mice enhances osteoclastic bone resorption. The mutant alleles termed 'Dwarf grey' and 'Dwarf grey Bayer' in mice are associated with deletions in this gene. A gamma-glutamyl transpeptidase paralog is located adjacent to this gene. Alternative splicing results in multiple transcript variants. Additional transcripts using alternate promoters and differing in 5' UTRs have been described. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous mutants may exhibit impaired growth, skeletal abnormalities, cataracts, lethargic behavior, premature greying, sterility, and shortened life span. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik C T 6: 91,934,610 T613I probably benign Het
9130019O22Rik T A 7: 127,385,283 S216C probably benign Het
Ajuba T C 14: 54,576,402 E288G probably damaging Het
Ankrd12 C T 17: 65,985,360 R1026K probably benign Het
Apol7b T C 15: 77,423,474 T274A probably benign Het
Arid4a A T 12: 71,063,142 R86* probably null Het
Asnsd1 C T 1: 53,348,258 G70D probably damaging Het
Atg4c T A 4: 99,228,560 V313D possibly damaging Het
Atp13a5 A C 16: 29,266,963 C885G probably damaging Het
Bpifb9a A T 2: 154,262,263 I209F possibly damaging Het
Bsn T C 9: 108,113,543 D1670G probably damaging Het
Cct8 T A 16: 87,491,322 I121F probably benign Het
Cd209a T G 8: 3,744,151 D217A probably damaging Het
Cdk19 C T 10: 40,477,958 S456L possibly damaging Het
Chd9 C T 8: 90,994,580 H999Y unknown Het
Col5a1 G A 2: 27,951,383 V339M unknown Het
Cr2 G A 1: 195,169,340 R115* probably null Het
Cyb561 A T 11: 105,937,644 F62I probably damaging Het
Cyp2c38 A T 19: 39,404,743 N293K possibly damaging Het
Cyp2c69 A T 19: 39,859,898 D293E probably damaging Het
Dcbld2 T A 16: 58,424,569 C69S possibly damaging Het
Dcdc2a T C 13: 25,119,373 S296P probably benign Het
Dmxl1 T A 18: 49,893,957 I2044K possibly damaging Het
Dnah5 A G 15: 28,346,952 D2527G probably damaging Het
Dnah6 T C 6: 73,149,430 T1305A probably benign Het
Dnajc9 A G 14: 20,388,644 V47A probably benign Het
Dnmt3b A G 2: 153,676,699 Y594C probably damaging Het
Dph7 A G 2: 24,965,630 D147G probably damaging Het
Drap1 T C 19: 5,423,352 H164R possibly damaging Het
Dsg3 T A 18: 20,527,780 V392E possibly damaging Het
Dxo A G 17: 34,837,640 D81G probably benign Het
E230025N22Rik G T 18: 36,695,592 T11K probably benign Het
Esyt1 A G 10: 128,518,932 V533A possibly damaging Het
Etv3 T A 3: 87,536,031 C307* probably null Het
Fam114a1 T A 5: 65,030,059 probably null Het
Fam208b A G 13: 3,573,621 Y2110H probably damaging Het
Fam3c T A 6: 22,326,405 probably benign Het
Fbn1 G T 2: 125,397,852 T305K probably benign Het
Gm10639 A T 9: 78,304,469 D171V possibly damaging Het
Gpatch1 T C 7: 35,293,812 D536G probably damaging Het
Gpx4 T C 10: 80,055,041 I189T probably damaging Het
Gsr T A 8: 33,669,165 C85S probably damaging Het
Havcr1 T A 11: 46,770,542 probably null Het
Heatr4 T C 12: 83,979,644 T280A probably benign Het
Hmcn2 A T 2: 31,423,911 E3532D probably benign Het
Hnrnpc T C 14: 52,075,099 N308S possibly damaging Het
Ighv8-9 A G 12: 115,468,738 V13A probably benign Het
Itgb2l A T 16: 96,426,239 F535I probably benign Het
Kdm5a T G 6: 120,427,842 D1348E probably damaging Het
Kndc1 CT C 7: 139,923,775 probably null Het
Ky A G 9: 102,542,329 I512V probably benign Het
Lamc1 A T 1: 153,243,275 F866Y possibly damaging Het
Lbx1 C A 19: 45,235,248 probably benign Het
Magel2 A G 7: 62,378,910 T521A possibly damaging Het
Mgam A T 6: 40,746,433 I491L probably benign Het
Mitd1 T C 1: 37,890,192 E40G probably damaging Het
Mpzl3 A G 9: 45,070,687 T218A probably benign Het
Mrpl42 A G 10: 95,480,965 S77P probably benign Het
Mup5 C T 4: 61,834,674 W37* probably null Het
Myh14 T C 7: 44,632,426 I803V probably benign Het
Ncor2 T A 5: 125,030,089 T744S Het
Ndufv3 A G 17: 31,527,622 D162G probably damaging Het
Nostrin A G 2: 69,175,806 E278G probably damaging Het
Nrxn1 T G 17: 90,162,379 E1288A probably benign Het
Olfr1205 A G 2: 88,831,128 N4D possibly damaging Het
Olfr623 C A 7: 103,660,881 R123L probably damaging Het
Olfr648 T A 7: 104,179,748 Y220F probably damaging Het
Olfr972 A T 9: 39,873,455 Y60F possibly damaging Het
Patj T A 4: 98,424,500 probably null Het
Pcm1 T G 8: 41,267,344 I314R possibly damaging Het
Pcsk6 A G 7: 66,033,898 T754A probably benign Het
Pde2a A T 7: 101,502,834 N326I probably benign Het
Plekhg4 T C 8: 105,378,684 S594P possibly damaging Het
Plekhm3 T C 1: 64,937,906 D135G probably damaging Het
Plin4 A T 17: 56,106,776 M283K probably benign Het
Ppfia3 T C 7: 45,340,748 probably null Het
Prdm9 T C 17: 15,555,652 N179S probably benign Het
Prrt3 T C 6: 113,494,488 S908G probably damaging Het
Psg22 C A 7: 18,722,735 S181Y possibly damaging Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rp1l1 T A 14: 64,031,574 C1536* probably null Het
Rpp25l T C 4: 41,712,529 H82R probably damaging Het
Rps3a1 T A 3: 86,139,089 M172L probably benign Het
Rtbdn T C 8: 84,952,927 L110P probably damaging Het
Ryr1 T A 7: 29,078,585 Q2169L probably damaging Het
Scn4a A T 11: 106,320,473 C1573S possibly damaging Het
Sec16b A T 1: 157,531,395 probably null Het
Serpina1a A T 12: 103,853,837 D383E possibly damaging Het
Sh3gl3 T C 7: 82,285,077 M262T probably benign Het
Sos2 G A 12: 69,590,880 T1052M probably damaging Het
Spag16 G A 1: 69,996,841 V343I probably benign Het
Spocd1 T G 4: 129,930,164 D251E Het
Stc2 G T 11: 31,367,798 N74K probably damaging Het
Thbs3 C T 3: 89,219,052 Q227* probably null Het
Tmem92 A C 11: 94,778,990 I105R probably benign Het
Tmod1 T A 4: 46,083,632 N20K probably benign Het
Tns1 T C 1: 73,953,479 D53G probably damaging Het
Tspan33 T A 6: 29,717,338 L246Q probably damaging Het
Ttc16 A G 2: 32,768,968 L392P probably damaging Het
Uggt1 T A 1: 36,185,838 T572S probably benign Het
Usp17la A T 7: 104,860,397 T70S probably damaging Het
Usp31 C T 7: 121,674,963 R370H probably damaging Het
Wdr83 C T 8: 85,079,834 V112M probably damaging Het
Zbtb25 T A 12: 76,369,592 probably benign Het
Zfp110 T A 7: 12,849,340 N638K possibly damaging Het
Zfp820 T C 17: 21,819,013 T445A probably benign Het
Other mutations in Ggt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Ggt1 APN 10 75584863 missense probably benign 0.15
IGL01593:Ggt1 APN 10 75585287 critical splice donor site probably null
IGL02713:Ggt1 APN 10 75574344 missense probably damaging 1.00
IGL03276:Ggt1 APN 10 75580497 unclassified probably benign
PIT4498001:Ggt1 UTSW 10 75578855 missense possibly damaging 0.95
R0373:Ggt1 UTSW 10 75579270 missense probably benign 0.11
R0420:Ggt1 UTSW 10 75576213 splice site probably benign
R0505:Ggt1 UTSW 10 75585957 missense probably damaging 0.99
R0630:Ggt1 UTSW 10 75585502 splice site probably null
R1837:Ggt1 UTSW 10 75579294 missense probably benign 0.00
R2655:Ggt1 UTSW 10 75581385 nonsense probably null
R2656:Ggt1 UTSW 10 75581385 nonsense probably null
R2910:Ggt1 UTSW 10 75580596 missense probably benign 0.09
R3840:Ggt1 UTSW 10 75581385 nonsense probably null
R3841:Ggt1 UTSW 10 75581385 nonsense probably null
R4744:Ggt1 UTSW 10 75585899 missense probably benign 0.00
R5254:Ggt1 UTSW 10 75579198 unclassified probably null
R5323:Ggt1 UTSW 10 75585661 critical splice acceptor site probably null
R5326:Ggt1 UTSW 10 75585706 critical splice donor site probably null
R5512:Ggt1 UTSW 10 75584884 missense probably damaging 0.99
R5579:Ggt1 UTSW 10 75585948 missense probably damaging 1.00
R5707:Ggt1 UTSW 10 75585238 missense probably benign 0.01
R5961:Ggt1 UTSW 10 75585902 unclassified probably null
R6159:Ggt1 UTSW 10 75584965 missense probably damaging 1.00
R6239:Ggt1 UTSW 10 75585681 unclassified probably null
R7224:Ggt1 UTSW 10 75574276 missense possibly damaging 0.86
R7649:Ggt1 UTSW 10 75585456 missense possibly damaging 0.89
R7702:Ggt1 UTSW 10 75576282 missense probably benign 0.00
R7713:Ggt1 UTSW 10 75585674 missense probably damaging 1.00
R7823:Ggt1 UTSW 10 75574341 missense possibly damaging 0.88
R8070:Ggt1 UTSW 10 75578899 missense not run
Predicted Primers PCR Primer
(F):5'- TGGATCATAGGTAAGCAGCCTC -3'
(R):5'- TCAGAAGATGCCAGCCTCTAG -3'

Sequencing Primer
(F):5'- GTGTCCCTCAATCATCCTGGATAAG -3'
(R):5'- AGCCTCTAGGATGCTCTCTC -3'
Posted On2019-10-17