Mutagenetix > Incidental Mutation

Incidental Mutation 'R7570:Mrpl42'

585737

Institutional Source

Beutler Lab

Gene Symbol

Mrpl42

Ensembl Gene

ENSMUSG00000062981

Gene Name

mitochondrial ribosomal protein L42

Synonyms

HSPC204, 2700009F22Rik, Rpml31, 2900055D03Rik, D10Ertd322e, PTD007, MRP-L31

MMRRC Submission

045631-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.829) question?

Stock #

R7570 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

95480805-95501940 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 95480965 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 77 (S77P)

Ref Sequence

ENSEMBL: ENSMUSP00000151315 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075829] [ENSMUST00000217777] [ENSMUST00000218893] [ENSMUST00000219019]

AlphaFold

Q9CPV3

Predicted Effect

silent
Transcript: ENSMUST00000075829

SMART Domains

Protein: ENSMUSP00000075226
Gene: ENSMUSG00000062981

Domain	Start	End	E-Value	Type
Pfam:MRP-S32	45	142	6.8e-46	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000217777
AA Change: S77P

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

Predicted Effect

silent
Transcript: ENSMUST00000218893

Predicted Effect

probably benign
Transcript: ENSMUST00000219019

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

98% (104/106)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a protein identified as belonging to both the 28S and the 39S subunits. Alternative splicing results in multiple transcript variants. Pseudogenes corresponding to this gene are found on chromosomes 4q, 6p, 6q, 7p, and 15q. [provided by RefSeq, May 2011]

Allele List at MGI

Other mutations in this stock

Total: 106 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930590J08Rik	C	T	6: 91,934,610	T613I	probably benign	Het
9130019O22Rik	T	A	7: 127,385,283	S216C	probably benign	Het
Ajuba	T	C	14: 54,576,402	E288G	probably damaging	Het
Ankrd12	C	T	17: 65,985,360	R1026K	probably benign	Het
Apol7b	T	C	15: 77,423,474	T274A	probably benign	Het
Arid4a	A	T	12: 71,063,142	R86*	probably null	Het
Asnsd1	C	T	1: 53,348,258	G70D	probably damaging	Het
Atg4c	T	A	4: 99,228,560	V313D	possibly damaging	Het
Atp13a5	A	C	16: 29,266,963	C885G	probably damaging	Het
Bpifb9a	A	T	2: 154,262,263	I209F	possibly damaging	Het
Bsn	T	C	9: 108,113,543	D1670G	probably damaging	Het
Cct8	T	A	16: 87,491,322	I121F	probably benign	Het
Cd209a	T	G	8: 3,744,151	D217A	probably damaging	Het
Cdk19	C	T	10: 40,477,958	S456L	possibly damaging	Het
Chd9	C	T	8: 90,994,580	H999Y	unknown	Het
Col5a1	G	A	2: 27,951,383	V339M	unknown	Het
Cr2	G	A	1: 195,169,340	R115*	probably null	Het
Cyb561	A	T	11: 105,937,644	F62I	probably damaging	Het
Cyp2c38	A	T	19: 39,404,743	N293K	possibly damaging	Het
Cyp2c69	A	T	19: 39,859,898	D293E	probably damaging	Het
Dcbld2	T	A	16: 58,424,569	C69S	possibly damaging	Het
Dcdc2a	T	C	13: 25,119,373	S296P	probably benign	Het
Dmxl1	T	A	18: 49,893,957	I2044K	possibly damaging	Het
Dnah5	A	G	15: 28,346,952	D2527G	probably damaging	Het
Dnah6	T	C	6: 73,149,430	T1305A	probably benign	Het
Dnajc9	A	G	14: 20,388,644	V47A	probably benign	Het
Dnmt3b	A	G	2: 153,676,699	Y594C	probably damaging	Het
Dph7	A	G	2: 24,965,630	D147G	probably damaging	Het
Drap1	T	C	19: 5,423,352	H164R	possibly damaging	Het
Dsg3	T	A	18: 20,527,780	V392E	possibly damaging	Het
Dxo	A	G	17: 34,837,640	D81G	probably benign	Het
E230025N22Rik	G	T	18: 36,695,592	T11K	probably benign	Het
Esyt1	A	G	10: 128,518,932	V533A	possibly damaging	Het
Etv3	T	A	3: 87,536,031	C307*	probably null	Het
Fam114a1	T	A	5: 65,030,059		probably null	Het
Fam208b	A	G	13: 3,573,621	Y2110H	probably damaging	Het
Fam3c	T	A	6: 22,326,405		probably benign	Het
Fbn1	G	T	2: 125,397,852	T305K	probably benign	Het
Ggt1	A	T	10: 75,585,594	I484F	probably damaging	Het
Gm10639	A	T	9: 78,304,469	D171V	possibly damaging	Het
Gpatch1	T	C	7: 35,293,812	D536G	probably damaging	Het
Gpx4	T	C	10: 80,055,041	I189T	probably damaging	Het
Gsr	T	A	8: 33,669,165	C85S	probably damaging	Het
Havcr1	T	A	11: 46,770,542		probably null	Het
Heatr4	T	C	12: 83,979,644	T280A	probably benign	Het
Hmcn2	A	T	2: 31,423,911	E3532D	probably benign	Het
Hnrnpc	T	C	14: 52,075,099	N308S	possibly damaging	Het
Ighv8-9	A	G	12: 115,468,738	V13A	probably benign	Het
Itgb2l	A	T	16: 96,426,239	F535I	probably benign	Het
Kdm5a	T	G	6: 120,427,842	D1348E	probably damaging	Het
Kndc1	CT	C	7: 139,923,775		probably null	Het
Ky	A	G	9: 102,542,329	I512V	probably benign	Het
Lamc1	A	T	1: 153,243,275	F866Y	possibly damaging	Het
Lbx1	C	A	19: 45,235,248		probably benign	Het
Magel2	A	G	7: 62,378,910	T521A	possibly damaging	Het
Mgam	A	T	6: 40,746,433	I491L	probably benign	Het
Mitd1	T	C	1: 37,890,192	E40G	probably damaging	Het
Mpzl3	A	G	9: 45,070,687	T218A	probably benign	Het
Mup5	C	T	4: 61,834,674	W37*	probably null	Het
Myh14	T	C	7: 44,632,426	I803V	probably benign	Het
Ncor2	T	A	5: 125,030,089	T744S		Het
Ndufv3	A	G	17: 31,527,622	D162G	probably damaging	Het
Nostrin	A	G	2: 69,175,806	E278G	probably damaging	Het
Nrxn1	T	G	17: 90,162,379	E1288A	probably benign	Het
Olfr1205	A	G	2: 88,831,128	N4D	possibly damaging	Het
Olfr623	C	A	7: 103,660,881	R123L	probably damaging	Het
Olfr648	T	A	7: 104,179,748	Y220F	probably damaging	Het
Olfr972	A	T	9: 39,873,455	Y60F	possibly damaging	Het
Patj	T	A	4: 98,424,500		probably null	Het
Pcm1	T	G	8: 41,267,344	I314R	possibly damaging	Het
Pcsk6	A	G	7: 66,033,898	T754A	probably benign	Het
Pde2a	A	T	7: 101,502,834	N326I	probably benign	Het
Plekhg4	T	C	8: 105,378,684	S594P	possibly damaging	Het
Plekhm3	T	C	1: 64,937,906	D135G	probably damaging	Het
Plin4	A	T	17: 56,106,776	M283K	probably benign	Het
Ppfia3	T	C	7: 45,340,748		probably null	Het
Prdm9	T	C	17: 15,555,652	N179S	probably benign	Het
Prrt3	T	C	6: 113,494,488	S908G	probably damaging	Het
Psg22	C	A	7: 18,722,735	S181Y	possibly damaging	Het
Rcor3	C	A	1: 192,137,876	G8V	probably damaging	Het
Rp1l1	T	A	14: 64,031,574	C1536*	probably null	Het
Rpp25l	T	C	4: 41,712,529	H82R	probably damaging	Het
Rps3a1	T	A	3: 86,139,089	M172L	probably benign	Het
Rtbdn	T	C	8: 84,952,927	L110P	probably damaging	Het
Ryr1	T	A	7: 29,078,585	Q2169L	probably damaging	Het
Scn4a	A	T	11: 106,320,473	C1573S	possibly damaging	Het
Sec16b	A	T	1: 157,531,395		probably null	Het
Serpina1a	A	T	12: 103,853,837	D383E	possibly damaging	Het
Sh3gl3	T	C	7: 82,285,077	M262T	probably benign	Het
Sos2	G	A	12: 69,590,880	T1052M	probably damaging	Het
Spag16	G	A	1: 69,996,841	V343I	probably benign	Het
Spocd1	T	G	4: 129,930,164	D251E		Het
Stc2	G	T	11: 31,367,798	N74K	probably damaging	Het
Thbs3	C	T	3: 89,219,052	Q227*	probably null	Het
Tmem92	A	C	11: 94,778,990	I105R	probably benign	Het
Tmod1	T	A	4: 46,083,632	N20K	probably benign	Het
Tns1	T	C	1: 73,953,479	D53G	probably damaging	Het
Tspan33	T	A	6: 29,717,338	L246Q	probably damaging	Het
Ttc16	A	G	2: 32,768,968	L392P	probably damaging	Het
Uggt1	T	A	1: 36,185,838	T572S	probably benign	Het
Usp17la	A	T	7: 104,860,397	T70S	probably damaging	Het
Usp31	C	T	7: 121,674,963	R370H	probably damaging	Het
Wdr83	C	T	8: 85,079,834	V112M	probably damaging	Het
Zbtb25	T	A	12: 76,369,592		probably benign	Het
Zfp110	T	A	7: 12,849,340	N638K	possibly damaging	Het
Zfp820	T	C	17: 21,819,013	T445A	probably benign	Het

Other mutations in Mrpl42

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00984:Mrpl42	APN	10	95490340	missense	probably benign
R1321:Mrpl42	UTSW	10	95493711	missense	probably damaging	1.00
R4979:Mrpl42	UTSW	10	95490375	missense	probably benign	0.41
R5999:Mrpl42	UTSW	10	95500479	start gained	probably benign
R6268:Mrpl42	UTSW	10	95496707	splice site	probably null
R9516:Mrpl42	UTSW	10	95496822	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- CCAGGGGAAAAGACTTTAATGTTTC -3'
(R):5'- AATGGCGGATTGTGGCTTATTACTAAG -3'

Sequencing Primer
(F):5'- CGACCACCTTAATGATGGT -3'
(R):5'- ACCACAGAAATTTAAGTTGTC -3'

Posted On

2019-10-17