Incidental Mutation 'R7570:Arid4a'
ID585745
Institutional Source Beutler Lab
Gene Symbol Arid4a
Ensembl Gene ENSMUSG00000048118
Gene NameAT rich interactive domain 4A (RBP1-like)
SynonymsRbbp1, A630067N03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7570 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location71015990-71098592 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 71063142 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 86 (R86*)
Ref Sequence ENSEMBL: ENSMUSP00000121319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046305] [ENSMUST00000135709]
Predicted Effect probably null
Transcript: ENSMUST00000046305
AA Change: R408*
SMART Domains Protein: ENSMUSP00000035512
Gene: ENSMUSG00000048118
AA Change: R408*

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
TUDOR 58 114 3.6e-12 SMART
low complexity region 152 167 N/A INTRINSIC
Pfam:RBB1NT 170 262 4e-32 PFAM
ARID 306 397 6.7e-37 SMART
BRIGHT 310 402 2.3e-40 SMART
low complexity region 411 422 N/A INTRINSIC
CHROMO 483 652 6.8e-6 SMART
low complexity region 690 707 N/A INTRINSIC
low complexity region 965 976 N/A INTRINSIC
low complexity region 991 1003 N/A INTRINSIC
coiled coil region 1185 1224 N/A INTRINSIC
low complexity region 1229 1252 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000135709
AA Change: R86*
SMART Domains Protein: ENSMUSP00000121319
Gene: ENSMUSG00000048118
AA Change: R86*

DomainStartEndE-ValueType
ARID 1 75 1.02e-16 SMART
BRIGHT 1 80 2.05e-23 SMART
low complexity region 89 100 N/A INTRINSIC
CHROMO 161 330 1.08e-3 SMART
low complexity region 368 385 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ubiquitously expressed nuclear protein. It binds directly, with several other proteins, to retinoblastoma protein (pRB) which regulates cell proliferation. pRB represses transcription by recruiting the encoded protein. This protein, in turn, serves as a bridging molecule to recruit HDACs and, in addition, provides a second HDAC-independent repression function. The encoded protein possesses transcriptional repression activity. Multiple alternatively spliced transcripts have been observed for this gene, although not all transcript variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered DNA methylation patterns, disrupted hematopoiesis and a portion develop acute myeloid leukemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik C T 6: 91,934,610 T613I probably benign Het
9130019O22Rik T A 7: 127,385,283 S216C probably benign Het
Ajuba T C 14: 54,576,402 E288G probably damaging Het
Ankrd12 C T 17: 65,985,360 R1026K probably benign Het
Apol7b T C 15: 77,423,474 T274A probably benign Het
Asnsd1 C T 1: 53,348,258 G70D probably damaging Het
Atg4c T A 4: 99,228,560 V313D possibly damaging Het
Atp13a5 A C 16: 29,266,963 C885G probably damaging Het
Bpifb9a A T 2: 154,262,263 I209F possibly damaging Het
Bsn T C 9: 108,113,543 D1670G probably damaging Het
Cct8 T A 16: 87,491,322 I121F probably benign Het
Cd209a T G 8: 3,744,151 D217A probably damaging Het
Cdk19 C T 10: 40,477,958 S456L possibly damaging Het
Chd9 C T 8: 90,994,580 H999Y unknown Het
Col5a1 G A 2: 27,951,383 V339M unknown Het
Cr2 G A 1: 195,169,340 R115* probably null Het
Cyb561 A T 11: 105,937,644 F62I probably damaging Het
Cyp2c38 A T 19: 39,404,743 N293K possibly damaging Het
Cyp2c69 A T 19: 39,859,898 D293E probably damaging Het
Dcbld2 T A 16: 58,424,569 C69S possibly damaging Het
Dcdc2a T C 13: 25,119,373 S296P probably benign Het
Dmxl1 T A 18: 49,893,957 I2044K possibly damaging Het
Dnah5 A G 15: 28,346,952 D2527G probably damaging Het
Dnah6 T C 6: 73,149,430 T1305A probably benign Het
Dnajc9 A G 14: 20,388,644 V47A probably benign Het
Dnmt3b A G 2: 153,676,699 Y594C probably damaging Het
Dph7 A G 2: 24,965,630 D147G probably damaging Het
Drap1 T C 19: 5,423,352 H164R possibly damaging Het
Dsg3 T A 18: 20,527,780 V392E possibly damaging Het
Dxo A G 17: 34,837,640 D81G probably benign Het
E230025N22Rik G T 18: 36,695,592 T11K probably benign Het
Esyt1 A G 10: 128,518,932 V533A possibly damaging Het
Etv3 T A 3: 87,536,031 C307* probably null Het
Fam114a1 T A 5: 65,030,059 probably null Het
Fam208b A G 13: 3,573,621 Y2110H probably damaging Het
Fbn1 G T 2: 125,397,852 T305K probably benign Het
Ggt1 A T 10: 75,585,594 I484F probably damaging Het
Gm10639 A T 9: 78,304,469 D171V possibly damaging Het
Gpatch1 T C 7: 35,293,812 D536G probably damaging Het
Gpx4 T C 10: 80,055,041 I189T probably damaging Het
Gsr T A 8: 33,669,165 C85S probably damaging Het
Havcr1 T A 11: 46,770,542 probably null Het
Heatr4 T C 12: 83,979,644 T280A probably benign Het
Hmcn2 A T 2: 31,423,911 E3532D probably benign Het
Hnrnpc T C 14: 52,075,099 N308S possibly damaging Het
Ighv8-9 A G 12: 115,468,738 V13A probably benign Het
Itgb2l A T 16: 96,426,239 F535I probably benign Het
Kdm5a T G 6: 120,427,842 D1348E probably damaging Het
Kndc1 CT C 7: 139,923,775 probably null Het
Ky A G 9: 102,542,329 I512V probably benign Het
Lamc1 A T 1: 153,243,275 F866Y possibly damaging Het
Lbx1 C A 19: 45,235,248 probably benign Het
Magel2 A G 7: 62,378,910 T521A possibly damaging Het
Mgam A T 6: 40,746,433 I491L probably benign Het
Mitd1 T C 1: 37,890,192 E40G probably damaging Het
Mpzl3 A G 9: 45,070,687 T218A probably benign Het
Mrpl42 A G 10: 95,480,965 S77P probably benign Het
Mup5 C T 4: 61,834,674 W37* probably null Het
Myh14 T C 7: 44,632,426 I803V probably benign Het
Ncor2 T A 5: 125,030,089 T744S Het
Ndufv3 A G 17: 31,527,622 D162G probably damaging Het
Nostrin A G 2: 69,175,806 E278G probably damaging Het
Nrxn1 T G 17: 90,162,379 E1288A probably benign Het
Olfr1205 A G 2: 88,831,128 N4D possibly damaging Het
Olfr623 C A 7: 103,660,881 R123L probably damaging Het
Olfr648 T A 7: 104,179,748 Y220F probably damaging Het
Olfr972 A T 9: 39,873,455 Y60F possibly damaging Het
Patj T A 4: 98,424,500 probably null Het
Pcm1 T G 8: 41,267,344 I314R possibly damaging Het
Pcsk6 A G 7: 66,033,898 T754A probably benign Het
Pde2a A T 7: 101,502,834 N326I probably benign Het
Plekhg4 T C 8: 105,378,684 S594P possibly damaging Het
Plekhm3 T C 1: 64,937,906 D135G probably damaging Het
Plin4 A T 17: 56,106,776 M283K probably benign Het
Ppfia3 T C 7: 45,340,748 probably null Het
Prdm9 T C 17: 15,555,652 N179S probably benign Het
Prrt3 T C 6: 113,494,488 S908G probably damaging Het
Psg22 C A 7: 18,722,735 S181Y possibly damaging Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rp1l1 T A 14: 64,031,574 C1536* probably null Het
Rpp25l T C 4: 41,712,529 H82R probably damaging Het
Rps3a1 T A 3: 86,139,089 M172L probably benign Het
Rtbdn T C 8: 84,952,927 L110P probably damaging Het
Ryr1 T A 7: 29,078,585 Q2169L probably damaging Het
Scn4a A T 11: 106,320,473 C1573S possibly damaging Het
Sec16b A T 1: 157,531,395 probably null Het
Serpina1a A T 12: 103,853,837 D383E possibly damaging Het
Sh3gl3 T C 7: 82,285,077 M262T probably benign Het
Sos2 G A 12: 69,590,880 T1052M probably damaging Het
Spag16 G A 1: 69,996,841 V343I probably benign Het
Spocd1 T G 4: 129,930,164 D251E Het
Stc2 G T 11: 31,367,798 N74K probably damaging Het
Thbs3 C T 3: 89,219,052 Q227* probably null Het
Tmem92 A C 11: 94,778,990 I105R probably benign Het
Tmod1 T A 4: 46,083,632 N20K probably benign Het
Tns1 T C 1: 73,953,479 D53G probably damaging Het
Tspan33 T A 6: 29,717,338 L246Q probably damaging Het
Ttc16 A G 2: 32,768,968 L392P probably damaging Het
Uggt1 T A 1: 36,185,838 T572S probably benign Het
Usp17la A T 7: 104,860,397 T70S probably damaging Het
Usp31 C T 7: 121,674,963 R370H probably damaging Het
Wdr83 C T 8: 85,079,834 V112M probably damaging Het
Zbtb25 T A 12: 76,369,592 probably benign Het
Zfp110 T A 7: 12,849,340 N638K possibly damaging Het
Zfp820 T C 17: 21,819,013 T445A probably benign Het
Other mutations in Arid4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Arid4a APN 12 71072593 missense probably damaging 1.00
IGL00546:Arid4a APN 12 71075671 missense probably benign
IGL00553:Arid4a APN 12 71075977 missense probably benign 0.04
IGL00708:Arid4a APN 12 71072728 missense probably benign 0.02
IGL00847:Arid4a APN 12 71075718 missense probably damaging 1.00
IGL01112:Arid4a APN 12 71072733 critical splice donor site probably null
IGL01456:Arid4a APN 12 71067262 missense probably benign 0.00
IGL01505:Arid4a APN 12 71037115 missense probably damaging 1.00
IGL01555:Arid4a APN 12 71061527 splice site probably benign
IGL01631:Arid4a APN 12 71022262 splice site probably benign
IGL02958:Arid4a APN 12 71097563 missense probably benign 0.01
IGL03087:Arid4a APN 12 71075245 missense possibly damaging 0.94
IGL03111:Arid4a APN 12 71039966 missense probably damaging 1.00
IGL03234:Arid4a APN 12 71045060 missense probably benign 0.34
After_8 UTSW 12 71023498 critical splice acceptor site probably null
ariano UTSW 12 71069860 nonsense probably null
guava UTSW 12 71072632 missense probably damaging 0.99
limoncello UTSW 12 71067341 splice site probably null
Under_8 UTSW 12 71063206 missense probably benign 0.10
R0047:Arid4a UTSW 12 71075419 missense probably damaging 1.00
R0047:Arid4a UTSW 12 71075419 missense probably damaging 1.00
R0270:Arid4a UTSW 12 71072632 missense probably damaging 0.99
R0310:Arid4a UTSW 12 71075830 missense probably benign 0.05
R0504:Arid4a UTSW 12 71047214 missense probably damaging 1.00
R1061:Arid4a UTSW 12 71074955 missense probably damaging 1.00
R1087:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1169:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1171:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1531:Arid4a UTSW 12 71076005 missense probably benign 0.01
R1674:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1676:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1768:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1833:Arid4a UTSW 12 71075466 missense possibly damaging 0.50
R1878:Arid4a UTSW 12 71087589 missense probably damaging 1.00
R2290:Arid4a UTSW 12 71061541 missense probably damaging 1.00
R2292:Arid4a UTSW 12 71061541 missense probably damaging 1.00
R2871:Arid4a UTSW 12 71022260 critical splice donor site probably null
R2871:Arid4a UTSW 12 71022260 critical splice donor site probably null
R3411:Arid4a UTSW 12 71061525 splice site probably benign
R3768:Arid4a UTSW 12 71067119 missense probably damaging 1.00
R3838:Arid4a UTSW 12 71075785 missense possibly damaging 0.94
R4320:Arid4a UTSW 12 71069995 missense possibly damaging 0.69
R4589:Arid4a UTSW 12 71069964 missense probably damaging 1.00
R4829:Arid4a UTSW 12 71023498 critical splice acceptor site probably null
R4862:Arid4a UTSW 12 71075947 missense probably damaging 0.96
R4952:Arid4a UTSW 12 71023525 missense possibly damaging 0.64
R5072:Arid4a UTSW 12 71045079 missense probably benign 0.08
R5423:Arid4a UTSW 12 71069860 nonsense probably null
R5767:Arid4a UTSW 12 71060093 missense probably damaging 1.00
R5911:Arid4a UTSW 12 71069973 missense probably damaging 1.00
R5952:Arid4a UTSW 12 71063206 missense probably benign 0.10
R6088:Arid4a UTSW 12 71022236 missense probably damaging 0.99
R6235:Arid4a UTSW 12 71069772 intron probably null
R6277:Arid4a UTSW 12 71039891 missense possibly damaging 0.49
R6455:Arid4a UTSW 12 71075088 missense probably benign 0.04
R6523:Arid4a UTSW 12 71067341 splice site probably null
R6701:Arid4a UTSW 12 71087512 missense probably damaging 1.00
R6812:Arid4a UTSW 12 71047263 missense possibly damaging 0.92
R6815:Arid4a UTSW 12 71017082 splice site probably null
R6837:Arid4a UTSW 12 71075515 missense probably benign
R6858:Arid4a UTSW 12 71023509 missense probably benign 0.01
R6895:Arid4a UTSW 12 71063302 missense probably benign 0.18
R6901:Arid4a UTSW 12 71067137 missense probably damaging 0.99
R6905:Arid4a UTSW 12 71061544 missense probably benign 0.43
R7387:Arid4a UTSW 12 71087496 missense probably damaging 1.00
R7772:Arid4a UTSW 12 71061589 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- AGGCTTATTAGTCTCTGGTTCTCAG -3'
(R):5'- GGCGACTTTAGCTCTGTGTC -3'

Sequencing Primer
(F):5'- CATGGCTCAGGTTTTACTACA -3'
(R):5'- GACTTTAGCTCTGTGTCTTCTCTG -3'
Posted On2019-10-17