Incidental Mutation 'R7570:Arid4a'
ID 585745
Institutional Source Beutler Lab
Gene Symbol Arid4a
Ensembl Gene ENSMUSG00000048118
Gene Name AT-rich interaction domain 4A
Synonyms A630067N03Rik, Rbbp1
MMRRC Submission 045631-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7570 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 71062764-71145366 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 71109916 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 86 (R86*)
Ref Sequence ENSEMBL: ENSMUSP00000121319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046305] [ENSMUST00000135709]
AlphaFold F8VPQ2
Predicted Effect probably null
Transcript: ENSMUST00000046305
AA Change: R408*
SMART Domains Protein: ENSMUSP00000035512
Gene: ENSMUSG00000048118
AA Change: R408*

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
TUDOR 58 114 3.6e-12 SMART
low complexity region 152 167 N/A INTRINSIC
Pfam:RBB1NT 170 262 4e-32 PFAM
ARID 306 397 6.7e-37 SMART
BRIGHT 310 402 2.3e-40 SMART
low complexity region 411 422 N/A INTRINSIC
CHROMO 483 652 6.8e-6 SMART
low complexity region 690 707 N/A INTRINSIC
low complexity region 965 976 N/A INTRINSIC
low complexity region 991 1003 N/A INTRINSIC
coiled coil region 1185 1224 N/A INTRINSIC
low complexity region 1229 1252 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000135709
AA Change: R86*
SMART Domains Protein: ENSMUSP00000121319
Gene: ENSMUSG00000048118
AA Change: R86*

DomainStartEndE-ValueType
ARID 1 75 1.02e-16 SMART
BRIGHT 1 80 2.05e-23 SMART
low complexity region 89 100 N/A INTRINSIC
CHROMO 161 330 1.08e-3 SMART
low complexity region 368 385 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (104/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ubiquitously expressed nuclear protein. It binds directly, with several other proteins, to retinoblastoma protein (pRB) which regulates cell proliferation. pRB represses transcription by recruiting the encoded protein. This protein, in turn, serves as a bridging molecule to recruit HDACs and, in addition, provides a second HDAC-independent repression function. The encoded protein possesses transcriptional repression activity. Multiple alternatively spliced transcripts have been observed for this gene, although not all transcript variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered DNA methylation patterns, disrupted hematopoiesis and a portion develop acute myeloid leukemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik C T 6: 91,911,591 (GRCm39) T613I probably benign Het
Ajuba T C 14: 54,813,859 (GRCm39) E288G probably damaging Het
Ankrd12 C T 17: 66,292,355 (GRCm39) R1026K probably benign Het
Apol7b T C 15: 77,307,674 (GRCm39) T274A probably benign Het
Asnsd1 C T 1: 53,387,417 (GRCm39) G70D probably damaging Het
Atg4c T A 4: 99,116,797 (GRCm39) V313D possibly damaging Het
Atp13a5 A C 16: 29,085,715 (GRCm39) C885G probably damaging Het
Bpifb9a A T 2: 154,104,183 (GRCm39) I209F possibly damaging Het
Bsn T C 9: 107,990,742 (GRCm39) D1670G probably damaging Het
Cct8 T A 16: 87,288,210 (GRCm39) I121F probably benign Het
Cd209a T G 8: 3,794,151 (GRCm39) D217A probably damaging Het
Cdk19 C T 10: 40,353,954 (GRCm39) S456L possibly damaging Het
Chd9 C T 8: 91,721,208 (GRCm39) H999Y unknown Het
Col5a1 G A 2: 27,841,395 (GRCm39) V339M unknown Het
Cr2 G A 1: 194,851,648 (GRCm39) R115* probably null Het
Cyb561 A T 11: 105,828,470 (GRCm39) F62I probably damaging Het
Cyp2c38 A T 19: 39,393,187 (GRCm39) N293K possibly damaging Het
Cyp2c69 A T 19: 39,848,342 (GRCm39) D293E probably damaging Het
Dcbld2 T A 16: 58,244,932 (GRCm39) C69S possibly damaging Het
Dcdc2a T C 13: 25,303,356 (GRCm39) S296P probably benign Het
Dmxl1 T A 18: 50,027,024 (GRCm39) I2044K possibly damaging Het
Dnah5 A G 15: 28,347,098 (GRCm39) D2527G probably damaging Het
Dnah6 T C 6: 73,126,413 (GRCm39) T1305A probably benign Het
Dnajc9 A G 14: 20,438,712 (GRCm39) V47A probably benign Het
Dnmt3b A G 2: 153,518,619 (GRCm39) Y594C probably damaging Het
Dph7 A G 2: 24,855,642 (GRCm39) D147G probably damaging Het
Drap1 T C 19: 5,473,380 (GRCm39) H164R possibly damaging Het
Dsg3 T A 18: 20,660,837 (GRCm39) V392E possibly damaging Het
Dxo A G 17: 35,056,616 (GRCm39) D81G probably benign Het
E230025N22Rik G T 18: 36,828,645 (GRCm39) T11K probably benign Het
Esyt1 A G 10: 128,354,801 (GRCm39) V533A possibly damaging Het
Etv3 T A 3: 87,443,338 (GRCm39) C307* probably null Het
Fam114a1 T A 5: 65,187,402 (GRCm39) probably null Het
Fam3c T A 6: 22,326,404 (GRCm39) probably benign Het
Fbn1 G T 2: 125,239,772 (GRCm39) T305K probably benign Het
Ggt1 A T 10: 75,421,428 (GRCm39) I484F probably damaging Het
Gpatch1 T C 7: 34,993,237 (GRCm39) D536G probably damaging Het
Gpx4 T C 10: 79,890,875 (GRCm39) I189T probably damaging Het
Gsr T A 8: 34,159,193 (GRCm39) C85S probably damaging Het
Gsta5 A T 9: 78,211,751 (GRCm39) D171V possibly damaging Het
Havcr1 T A 11: 46,661,369 (GRCm39) probably null Het
Heatr4 T C 12: 84,026,418 (GRCm39) T280A probably benign Het
Hmcn2 A T 2: 31,313,923 (GRCm39) E3532D probably benign Het
Hnrnpc T C 14: 52,312,556 (GRCm39) N308S possibly damaging Het
Ighv8-9 A G 12: 115,432,358 (GRCm39) V13A probably benign Het
Itgb2l A T 16: 96,227,439 (GRCm39) F535I probably benign Het
Kdm5a T G 6: 120,404,803 (GRCm39) D1348E probably damaging Het
Kndc1 CT C 7: 139,503,691 (GRCm39) probably null Het
Ky A G 9: 102,419,528 (GRCm39) I512V probably benign Het
Lamc1 A T 1: 153,119,021 (GRCm39) F866Y possibly damaging Het
Lbx1 C A 19: 45,223,687 (GRCm39) probably benign Het
Magel2 A G 7: 62,028,658 (GRCm39) T521A possibly damaging Het
Mgam A T 6: 40,723,367 (GRCm39) I491L probably benign Het
Mitd1 T C 1: 37,929,273 (GRCm39) E40G probably damaging Het
Mpzl3 A G 9: 44,981,985 (GRCm39) T218A probably benign Het
Mrpl42 A G 10: 95,316,827 (GRCm39) S77P probably benign Het
Mup5 C T 4: 61,752,911 (GRCm39) W37* probably null Het
Myh14 T C 7: 44,281,850 (GRCm39) I803V probably benign Het
Ncor2 T A 5: 125,107,153 (GRCm39) T744S Het
Ndufv3 A G 17: 31,746,596 (GRCm39) D162G probably damaging Het
Nostrin A G 2: 69,006,150 (GRCm39) E278G probably damaging Het
Nrxn1 T G 17: 90,469,807 (GRCm39) E1288A probably benign Het
Or4c11c A G 2: 88,661,472 (GRCm39) N4D possibly damaging Het
Or51b6b C A 7: 103,310,088 (GRCm39) R123L probably damaging Het
Or52h1 T A 7: 103,828,955 (GRCm39) Y220F probably damaging Het
Or8g55 A T 9: 39,784,751 (GRCm39) Y60F possibly damaging Het
Patj T A 4: 98,312,737 (GRCm39) probably null Het
Pcm1 T G 8: 41,720,381 (GRCm39) I314R possibly damaging Het
Pcsk6 A G 7: 65,683,646 (GRCm39) T754A probably benign Het
Pde2a A T 7: 101,152,041 (GRCm39) N326I probably benign Het
Plekhg4 T C 8: 106,105,316 (GRCm39) S594P possibly damaging Het
Plekhm3 T C 1: 64,977,065 (GRCm39) D135G probably damaging Het
Plin4 A T 17: 56,413,776 (GRCm39) M283K probably benign Het
Ppfia3 T C 7: 44,990,172 (GRCm39) probably null Het
Prdm9 T C 17: 15,775,914 (GRCm39) N179S probably benign Het
Prrt3 T C 6: 113,471,449 (GRCm39) S908G probably damaging Het
Psg22 C A 7: 18,456,660 (GRCm39) S181Y possibly damaging Het
Rcor3 C A 1: 191,822,173 (GRCm39) G8V probably damaging Het
Rp1l1 T A 14: 64,269,023 (GRCm39) C1536* probably null Het
Rpp25l T C 4: 41,712,529 (GRCm39) H82R probably damaging Het
Rps3a1 T A 3: 86,046,396 (GRCm39) M172L probably benign Het
Rtbdn T C 8: 85,679,556 (GRCm39) L110P probably damaging Het
Ryr1 T A 7: 28,778,010 (GRCm39) Q2169L probably damaging Het
Scn4a A T 11: 106,211,299 (GRCm39) C1573S possibly damaging Het
Sec16b A T 1: 157,358,965 (GRCm39) probably null Het
Serpina1a A T 12: 103,820,096 (GRCm39) D383E possibly damaging Het
Sh3gl3 T C 7: 81,934,285 (GRCm39) M262T probably benign Het
Sos2 G A 12: 69,637,654 (GRCm39) T1052M probably damaging Het
Spag16 G A 1: 70,036,000 (GRCm39) V343I probably benign Het
Spocd1 T G 4: 129,823,957 (GRCm39) D251E Het
Stc2 G T 11: 31,317,798 (GRCm39) N74K probably damaging Het
Tasor2 A G 13: 3,623,621 (GRCm39) Y2110H probably damaging Het
Thbs3 C T 3: 89,126,359 (GRCm39) Q227* probably null Het
Tmem92 A C 11: 94,669,816 (GRCm39) I105R probably benign Het
Tmod1 T A 4: 46,083,632 (GRCm39) N20K probably benign Het
Tns1 T C 1: 73,992,638 (GRCm39) D53G probably damaging Het
Tspan33 T A 6: 29,717,337 (GRCm39) L246Q probably damaging Het
Ttc16 A G 2: 32,658,980 (GRCm39) L392P probably damaging Het
Uggt1 T A 1: 36,224,919 (GRCm39) T572S probably benign Het
Usp17la A T 7: 104,509,604 (GRCm39) T70S probably damaging Het
Usp31 C T 7: 121,274,186 (GRCm39) R370H probably damaging Het
Wdr83 C T 8: 85,806,463 (GRCm39) V112M probably damaging Het
Zbtb25 T A 12: 76,416,366 (GRCm39) probably benign Het
Zfp110 T A 7: 12,583,267 (GRCm39) N638K possibly damaging Het
Zfp747l1 T A 7: 126,984,455 (GRCm39) S216C probably benign Het
Zfp820 T C 17: 22,037,994 (GRCm39) T445A probably benign Het
Other mutations in Arid4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Arid4a APN 12 71,119,367 (GRCm39) missense probably damaging 1.00
IGL00546:Arid4a APN 12 71,122,445 (GRCm39) missense probably benign
IGL00553:Arid4a APN 12 71,122,751 (GRCm39) missense probably benign 0.04
IGL00708:Arid4a APN 12 71,119,502 (GRCm39) missense probably benign 0.02
IGL00847:Arid4a APN 12 71,122,492 (GRCm39) missense probably damaging 1.00
IGL01112:Arid4a APN 12 71,119,507 (GRCm39) critical splice donor site probably null
IGL01456:Arid4a APN 12 71,114,036 (GRCm39) missense probably benign 0.00
IGL01505:Arid4a APN 12 71,083,889 (GRCm39) missense probably damaging 1.00
IGL01555:Arid4a APN 12 71,108,301 (GRCm39) splice site probably benign
IGL01631:Arid4a APN 12 71,069,036 (GRCm39) splice site probably benign
IGL02958:Arid4a APN 12 71,144,337 (GRCm39) missense probably benign 0.01
IGL03087:Arid4a APN 12 71,122,019 (GRCm39) missense possibly damaging 0.94
IGL03111:Arid4a APN 12 71,086,740 (GRCm39) missense probably damaging 1.00
IGL03234:Arid4a APN 12 71,091,834 (GRCm39) missense probably benign 0.34
After_8 UTSW 12 71,070,272 (GRCm39) critical splice acceptor site probably null
ariano UTSW 12 71,116,634 (GRCm39) nonsense probably null
Dusty UTSW 12 71,106,867 (GRCm39) missense probably damaging 1.00
guava UTSW 12 71,119,406 (GRCm39) missense probably damaging 0.99
limoncello UTSW 12 71,114,115 (GRCm39) splice site probably null
Sahara UTSW 12 71,106,889 (GRCm39) nonsense probably null
Under_8 UTSW 12 71,109,980 (GRCm39) missense probably benign 0.10
R0047:Arid4a UTSW 12 71,122,193 (GRCm39) missense probably damaging 1.00
R0047:Arid4a UTSW 12 71,122,193 (GRCm39) missense probably damaging 1.00
R0270:Arid4a UTSW 12 71,119,406 (GRCm39) missense probably damaging 0.99
R0310:Arid4a UTSW 12 71,122,604 (GRCm39) missense probably benign 0.05
R0504:Arid4a UTSW 12 71,093,988 (GRCm39) missense probably damaging 1.00
R1061:Arid4a UTSW 12 71,121,729 (GRCm39) missense probably damaging 1.00
R1087:Arid4a UTSW 12 71,122,112 (GRCm39) missense probably benign 0.01
R1169:Arid4a UTSW 12 71,122,112 (GRCm39) missense probably benign 0.01
R1171:Arid4a UTSW 12 71,122,112 (GRCm39) missense probably benign 0.01
R1531:Arid4a UTSW 12 71,122,779 (GRCm39) missense probably benign 0.01
R1674:Arid4a UTSW 12 71,122,112 (GRCm39) missense probably benign 0.01
R1676:Arid4a UTSW 12 71,122,112 (GRCm39) missense probably benign 0.01
R1768:Arid4a UTSW 12 71,122,112 (GRCm39) missense probably benign 0.01
R1833:Arid4a UTSW 12 71,122,240 (GRCm39) missense possibly damaging 0.50
R1878:Arid4a UTSW 12 71,134,363 (GRCm39) missense probably damaging 1.00
R2290:Arid4a UTSW 12 71,108,315 (GRCm39) missense probably damaging 1.00
R2292:Arid4a UTSW 12 71,108,315 (GRCm39) missense probably damaging 1.00
R2871:Arid4a UTSW 12 71,069,034 (GRCm39) critical splice donor site probably null
R2871:Arid4a UTSW 12 71,069,034 (GRCm39) critical splice donor site probably null
R3411:Arid4a UTSW 12 71,108,299 (GRCm39) splice site probably benign
R3768:Arid4a UTSW 12 71,113,893 (GRCm39) missense probably damaging 1.00
R3838:Arid4a UTSW 12 71,122,559 (GRCm39) missense possibly damaging 0.94
R4320:Arid4a UTSW 12 71,116,769 (GRCm39) missense possibly damaging 0.69
R4589:Arid4a UTSW 12 71,116,738 (GRCm39) missense probably damaging 1.00
R4829:Arid4a UTSW 12 71,070,272 (GRCm39) critical splice acceptor site probably null
R4862:Arid4a UTSW 12 71,122,721 (GRCm39) missense probably damaging 0.96
R4952:Arid4a UTSW 12 71,070,299 (GRCm39) missense possibly damaging 0.64
R5072:Arid4a UTSW 12 71,091,853 (GRCm39) missense probably benign 0.08
R5423:Arid4a UTSW 12 71,116,634 (GRCm39) nonsense probably null
R5767:Arid4a UTSW 12 71,106,867 (GRCm39) missense probably damaging 1.00
R5911:Arid4a UTSW 12 71,116,747 (GRCm39) missense probably damaging 1.00
R5952:Arid4a UTSW 12 71,109,980 (GRCm39) missense probably benign 0.10
R6088:Arid4a UTSW 12 71,069,010 (GRCm39) missense probably damaging 0.99
R6235:Arid4a UTSW 12 71,116,546 (GRCm39) splice site probably null
R6277:Arid4a UTSW 12 71,086,665 (GRCm39) missense possibly damaging 0.49
R6455:Arid4a UTSW 12 71,121,862 (GRCm39) missense probably benign 0.04
R6523:Arid4a UTSW 12 71,114,115 (GRCm39) splice site probably null
R6701:Arid4a UTSW 12 71,134,286 (GRCm39) missense probably damaging 1.00
R6812:Arid4a UTSW 12 71,094,037 (GRCm39) missense possibly damaging 0.92
R6815:Arid4a UTSW 12 71,063,856 (GRCm39) splice site probably null
R6837:Arid4a UTSW 12 71,122,289 (GRCm39) missense probably benign
R6858:Arid4a UTSW 12 71,070,283 (GRCm39) missense probably benign 0.01
R6895:Arid4a UTSW 12 71,110,076 (GRCm39) missense probably benign 0.18
R6901:Arid4a UTSW 12 71,113,911 (GRCm39) missense probably damaging 0.99
R6905:Arid4a UTSW 12 71,108,318 (GRCm39) missense probably benign 0.43
R7387:Arid4a UTSW 12 71,134,270 (GRCm39) missense probably damaging 1.00
R7772:Arid4a UTSW 12 71,108,363 (GRCm39) missense possibly damaging 0.65
R8194:Arid4a UTSW 12 71,106,889 (GRCm39) nonsense probably null
R8206:Arid4a UTSW 12 71,133,361 (GRCm39) missense probably damaging 1.00
R8552:Arid4a UTSW 12 71,106,849 (GRCm39) missense probably benign
R8696:Arid4a UTSW 12 71,110,090 (GRCm39) missense probably damaging 1.00
R9015:Arid4a UTSW 12 71,122,168 (GRCm39) missense possibly damaging 0.89
R9109:Arid4a UTSW 12 71,122,129 (GRCm39) missense probably damaging 1.00
R9450:Arid4a UTSW 12 71,119,374 (GRCm39) missense
Z1176:Arid4a UTSW 12 71,086,694 (GRCm39) missense possibly damaging 0.89
Z1177:Arid4a UTSW 12 71,122,411 (GRCm39) missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AGGCTTATTAGTCTCTGGTTCTCAG -3'
(R):5'- GGCGACTTTAGCTCTGTGTC -3'

Sequencing Primer
(F):5'- CATGGCTCAGGTTTTACTACA -3'
(R):5'- GACTTTAGCTCTGTGTCTTCTCTG -3'
Posted On 2019-10-17