Incidental Mutation 'R7570:Fam208b'
ID 585750
Institutional Source Beutler Lab
Gene Symbol Fam208b
Ensembl Gene ENSMUSG00000033799
Gene Name family with sequence similarity 208, member B
Synonyms BC016423
MMRRC Submission 045631-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R7570 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 3566035-3611108 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 3573621 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 2110 (Y2110H)
Ref Sequence ENSEMBL: ENSMUSP00000093774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096069]
AlphaFold Q5DTT3
Predicted Effect probably damaging
Transcript: ENSMUST00000096069
AA Change: Y2110H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000093774
Gene: ENSMUSG00000033799
AA Change: Y2110H

DomainStartEndE-ValueType
Pfam:DUF3699 91 167 1.4e-24 PFAM
low complexity region 272 282 N/A INTRINSIC
low complexity region 447 459 N/A INTRINSIC
Pfam:DUF3715 533 695 2.3e-25 PFAM
low complexity region 1156 1168 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 2012 2021 N/A INTRINSIC
low complexity region 2250 2263 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (104/106)
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik C T 6: 91,934,610 (GRCm38) T613I probably benign Het
9130019O22Rik T A 7: 127,385,283 (GRCm38) S216C probably benign Het
Ajuba T C 14: 54,576,402 (GRCm38) E288G probably damaging Het
Ankrd12 C T 17: 65,985,360 (GRCm38) R1026K probably benign Het
Apol7b T C 15: 77,423,474 (GRCm38) T274A probably benign Het
Arid4a A T 12: 71,063,142 (GRCm38) R86* probably null Het
Asnsd1 C T 1: 53,348,258 (GRCm38) G70D probably damaging Het
Atg4c T A 4: 99,228,560 (GRCm38) V313D possibly damaging Het
Atp13a5 A C 16: 29,266,963 (GRCm38) C885G probably damaging Het
Bpifb9a A T 2: 154,262,263 (GRCm38) I209F possibly damaging Het
Bsn T C 9: 108,113,543 (GRCm38) D1670G probably damaging Het
Cct8 T A 16: 87,491,322 (GRCm38) I121F probably benign Het
Cd209a T G 8: 3,744,151 (GRCm38) D217A probably damaging Het
Cdk19 C T 10: 40,477,958 (GRCm38) S456L possibly damaging Het
Chd9 C T 8: 90,994,580 (GRCm38) H999Y unknown Het
Col5a1 G A 2: 27,951,383 (GRCm38) V339M unknown Het
Cr2 G A 1: 195,169,340 (GRCm38) R115* probably null Het
Cyb561 A T 11: 105,937,644 (GRCm38) F62I probably damaging Het
Cyp2c38 A T 19: 39,404,743 (GRCm38) N293K possibly damaging Het
Cyp2c69 A T 19: 39,859,898 (GRCm38) D293E probably damaging Het
Dcbld2 T A 16: 58,424,569 (GRCm38) C69S possibly damaging Het
Dcdc2a T C 13: 25,119,373 (GRCm38) S296P probably benign Het
Dmxl1 T A 18: 49,893,957 (GRCm38) I2044K possibly damaging Het
Dnah5 A G 15: 28,346,952 (GRCm38) D2527G probably damaging Het
Dnah6 T C 6: 73,149,430 (GRCm38) T1305A probably benign Het
Dnajc9 A G 14: 20,388,644 (GRCm38) V47A probably benign Het
Dnmt3b A G 2: 153,676,699 (GRCm38) Y594C probably damaging Het
Dph7 A G 2: 24,965,630 (GRCm38) D147G probably damaging Het
Drap1 T C 19: 5,423,352 (GRCm38) H164R possibly damaging Het
Dsg3 T A 18: 20,527,780 (GRCm38) V392E possibly damaging Het
Dxo A G 17: 34,837,640 (GRCm38) D81G probably benign Het
E230025N22Rik G T 18: 36,695,592 (GRCm38) T11K probably benign Het
Esyt1 A G 10: 128,518,932 (GRCm38) V533A possibly damaging Het
Etv3 T A 3: 87,536,031 (GRCm38) C307* probably null Het
Fam114a1 T A 5: 65,030,059 (GRCm38) probably null Het
Fam3c T A 6: 22,326,405 (GRCm38) probably benign Het
Fbn1 G T 2: 125,397,852 (GRCm38) T305K probably benign Het
Ggt1 A T 10: 75,585,594 (GRCm38) I484F probably damaging Het
Gm10639 A T 9: 78,304,469 (GRCm38) D171V possibly damaging Het
Gpatch1 T C 7: 35,293,812 (GRCm38) D536G probably damaging Het
Gpx4 T C 10: 80,055,041 (GRCm38) I189T probably damaging Het
Gsr T A 8: 33,669,165 (GRCm38) C85S probably damaging Het
Havcr1 T A 11: 46,770,542 (GRCm38) probably null Het
Heatr4 T C 12: 83,979,644 (GRCm38) T280A probably benign Het
Hmcn2 A T 2: 31,423,911 (GRCm38) E3532D probably benign Het
Hnrnpc T C 14: 52,075,099 (GRCm38) N308S possibly damaging Het
Ighv8-9 A G 12: 115,468,738 (GRCm38) V13A probably benign Het
Itgb2l A T 16: 96,426,239 (GRCm38) F535I probably benign Het
Kdm5a T G 6: 120,427,842 (GRCm38) D1348E probably damaging Het
Kndc1 CT C 7: 139,923,775 (GRCm38) probably null Het
Ky A G 9: 102,542,329 (GRCm38) I512V probably benign Het
Lamc1 A T 1: 153,243,275 (GRCm38) F866Y possibly damaging Het
Lbx1 C A 19: 45,235,248 (GRCm38) probably benign Het
Magel2 A G 7: 62,378,910 (GRCm38) T521A possibly damaging Het
Mgam A T 6: 40,746,433 (GRCm38) I491L probably benign Het
Mitd1 T C 1: 37,890,192 (GRCm38) E40G probably damaging Het
Mpzl3 A G 9: 45,070,687 (GRCm38) T218A probably benign Het
Mrpl42 A G 10: 95,480,965 (GRCm38) S77P probably benign Het
Mup5 C T 4: 61,834,674 (GRCm38) W37* probably null Het
Myh14 T C 7: 44,632,426 (GRCm38) I803V probably benign Het
Ncor2 T A 5: 125,030,089 (GRCm38) T744S Het
Ndufv3 A G 17: 31,527,622 (GRCm38) D162G probably damaging Het
Nostrin A G 2: 69,175,806 (GRCm38) E278G probably damaging Het
Nrxn1 T G 17: 90,162,379 (GRCm38) E1288A probably benign Het
Olfr1205 A G 2: 88,831,128 (GRCm38) N4D possibly damaging Het
Olfr623 C A 7: 103,660,881 (GRCm38) R123L probably damaging Het
Olfr648 T A 7: 104,179,748 (GRCm38) Y220F probably damaging Het
Olfr972 A T 9: 39,873,455 (GRCm38) Y60F possibly damaging Het
Patj T A 4: 98,424,500 (GRCm38) probably null Het
Pcm1 T G 8: 41,267,344 (GRCm38) I314R possibly damaging Het
Pcsk6 A G 7: 66,033,898 (GRCm38) T754A probably benign Het
Pde2a A T 7: 101,502,834 (GRCm38) N326I probably benign Het
Plekhg4 T C 8: 105,378,684 (GRCm38) S594P possibly damaging Het
Plekhm3 T C 1: 64,937,906 (GRCm38) D135G probably damaging Het
Plin4 A T 17: 56,106,776 (GRCm38) M283K probably benign Het
Ppfia3 T C 7: 45,340,748 (GRCm38) probably null Het
Prdm9 T C 17: 15,555,652 (GRCm38) N179S probably benign Het
Prrt3 T C 6: 113,494,488 (GRCm38) S908G probably damaging Het
Psg22 C A 7: 18,722,735 (GRCm38) S181Y possibly damaging Het
Rcor3 C A 1: 192,137,876 (GRCm38) G8V probably damaging Het
Rp1l1 T A 14: 64,031,574 (GRCm38) C1536* probably null Het
Rpp25l T C 4: 41,712,529 (GRCm38) H82R probably damaging Het
Rps3a1 T A 3: 86,139,089 (GRCm38) M172L probably benign Het
Rtbdn T C 8: 84,952,927 (GRCm38) L110P probably damaging Het
Ryr1 T A 7: 29,078,585 (GRCm38) Q2169L probably damaging Het
Scn4a A T 11: 106,320,473 (GRCm38) C1573S possibly damaging Het
Sec16b A T 1: 157,531,395 (GRCm38) probably null Het
Serpina1a A T 12: 103,853,837 (GRCm38) D383E possibly damaging Het
Sh3gl3 T C 7: 82,285,077 (GRCm38) M262T probably benign Het
Sos2 G A 12: 69,590,880 (GRCm38) T1052M probably damaging Het
Spag16 G A 1: 69,996,841 (GRCm38) V343I probably benign Het
Spocd1 T G 4: 129,930,164 (GRCm38) D251E Het
Stc2 G T 11: 31,367,798 (GRCm38) N74K probably damaging Het
Thbs3 C T 3: 89,219,052 (GRCm38) Q227* probably null Het
Tmem92 A C 11: 94,778,990 (GRCm38) I105R probably benign Het
Tmod1 T A 4: 46,083,632 (GRCm38) N20K probably benign Het
Tns1 T C 1: 73,953,479 (GRCm38) D53G probably damaging Het
Tspan33 T A 6: 29,717,338 (GRCm38) L246Q probably damaging Het
Ttc16 A G 2: 32,768,968 (GRCm38) L392P probably damaging Het
Uggt1 T A 1: 36,185,838 (GRCm38) T572S probably benign Het
Usp17la A T 7: 104,860,397 (GRCm38) T70S probably damaging Het
Usp31 C T 7: 121,674,963 (GRCm38) R370H probably damaging Het
Wdr83 C T 8: 85,079,834 (GRCm38) V112M probably damaging Het
Zbtb25 T A 12: 76,369,592 (GRCm38) probably benign Het
Zfp110 T A 7: 12,849,340 (GRCm38) N638K possibly damaging Het
Zfp820 T C 17: 21,819,013 (GRCm38) T445A probably benign Het
Other mutations in Fam208b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Fam208b APN 13 3,574,832 (GRCm38) missense probably benign
IGL00670:Fam208b APN 13 3,585,241 (GRCm38) missense probably benign 0.14
IGL00957:Fam208b APN 13 3,577,101 (GRCm38) missense possibly damaging 0.86
IGL01311:Fam208b APN 13 3,575,885 (GRCm38) missense possibly damaging 0.85
IGL01318:Fam208b APN 13 3,575,067 (GRCm38) missense possibly damaging 0.66
IGL01767:Fam208b APN 13 3,576,633 (GRCm38) missense probably benign 0.00
IGL02073:Fam208b APN 13 3,574,721 (GRCm38) missense probably benign 0.01
IGL02152:Fam208b APN 13 3,585,371 (GRCm38) missense probably benign
IGL02431:Fam208b APN 13 3,574,736 (GRCm38) missense possibly damaging 0.85
IGL02478:Fam208b APN 13 3,574,661 (GRCm38) missense probably benign 0.12
IGL02732:Fam208b APN 13 3,573,626 (GRCm38) missense probably benign 0.09
IGL02745:Fam208b APN 13 3,585,140 (GRCm38) missense probably benign 0.23
IGL02800:Fam208b APN 13 3,585,154 (GRCm38) missense probably benign
IGL02989:Fam208b APN 13 3,584,820 (GRCm38) missense probably benign 0.01
IGL03124:Fam208b APN 13 3,574,704 (GRCm38) missense probably benign 0.41
IGL03154:Fam208b APN 13 3,575,255 (GRCm38) missense possibly damaging 0.56
IGL03216:Fam208b APN 13 3,574,553 (GRCm38) missense probably damaging 0.98
BB001:Fam208b UTSW 13 3,594,331 (GRCm38) missense possibly damaging 0.92
BB011:Fam208b UTSW 13 3,594,331 (GRCm38) missense possibly damaging 0.92
H8562:Fam208b UTSW 13 3,577,000 (GRCm38) missense probably damaging 0.98
PIT4585001:Fam208b UTSW 13 3,574,979 (GRCm38) missense possibly damaging 0.55
R0016:Fam208b UTSW 13 3,585,170 (GRCm38) splice site probably null
R0016:Fam208b UTSW 13 3,585,170 (GRCm38) splice site probably null
R0157:Fam208b UTSW 13 3,575,550 (GRCm38) missense probably benign 0.06
R0375:Fam208b UTSW 13 3,596,842 (GRCm38) missense possibly damaging 0.85
R0403:Fam208b UTSW 13 3,582,052 (GRCm38) nonsense probably null
R0472:Fam208b UTSW 13 3,588,364 (GRCm38) missense possibly damaging 0.93
R0517:Fam208b UTSW 13 3,566,964 (GRCm38) missense possibly damaging 0.94
R0586:Fam208b UTSW 13 3,590,321 (GRCm38) missense probably damaging 0.99
R0600:Fam208b UTSW 13 3,576,054 (GRCm38) missense probably benign
R0659:Fam208b UTSW 13 3,574,448 (GRCm38) missense probably damaging 0.99
R1257:Fam208b UTSW 13 3,575,049 (GRCm38) missense probably benign 0.25
R1375:Fam208b UTSW 13 3,576,029 (GRCm38) missense probably benign 0.06
R1443:Fam208b UTSW 13 3,575,543 (GRCm38) missense probably benign 0.00
R1497:Fam208b UTSW 13 3,570,409 (GRCm38) missense probably damaging 0.96
R1544:Fam208b UTSW 13 3,590,413 (GRCm38) missense possibly damaging 0.68
R1554:Fam208b UTSW 13 3,576,374 (GRCm38) missense possibly damaging 0.85
R1629:Fam208b UTSW 13 3,574,121 (GRCm38) missense possibly damaging 0.84
R1633:Fam208b UTSW 13 3,581,771 (GRCm38) missense possibly damaging 0.53
R1661:Fam208b UTSW 13 3,573,860 (GRCm38) missense possibly damaging 0.63
R1673:Fam208b UTSW 13 3,584,498 (GRCm38) critical splice donor site probably null
R1675:Fam208b UTSW 13 3,569,507 (GRCm38) missense possibly damaging 0.65
R1781:Fam208b UTSW 13 3,584,759 (GRCm38) missense possibly damaging 0.95
R1792:Fam208b UTSW 13 3,590,559 (GRCm38) missense possibly damaging 0.91
R1826:Fam208b UTSW 13 3,581,759 (GRCm38) missense probably damaging 0.98
R1920:Fam208b UTSW 13 3,576,612 (GRCm38) missense possibly damaging 0.63
R1983:Fam208b UTSW 13 3,574,853 (GRCm38) missense possibly damaging 0.92
R2016:Fam208b UTSW 13 3,576,770 (GRCm38) missense probably benign 0.41
R2017:Fam208b UTSW 13 3,576,770 (GRCm38) missense probably benign 0.41
R2220:Fam208b UTSW 13 3,581,872 (GRCm38) missense probably benign 0.00
R2513:Fam208b UTSW 13 3,582,150 (GRCm38) missense possibly damaging 0.53
R2898:Fam208b UTSW 13 3,585,122 (GRCm38) missense possibly damaging 0.82
R2904:Fam208b UTSW 13 3,582,185 (GRCm38) missense possibly damaging 0.53
R3149:Fam208b UTSW 13 3,574,359 (GRCm38) missense probably damaging 0.98
R3623:Fam208b UTSW 13 3,595,556 (GRCm38) missense probably benign
R3624:Fam208b UTSW 13 3,595,556 (GRCm38) missense probably benign
R3725:Fam208b UTSW 13 3,590,538 (GRCm38) missense probably benign 0.33
R3835:Fam208b UTSW 13 3,575,292 (GRCm38) missense probably benign 0.01
R3890:Fam208b UTSW 13 3,596,785 (GRCm38) missense probably damaging 0.96
R4023:Fam208b UTSW 13 3,584,554 (GRCm38) missense probably damaging 0.99
R4024:Fam208b UTSW 13 3,584,554 (GRCm38) missense probably damaging 0.99
R4025:Fam208b UTSW 13 3,584,554 (GRCm38) missense probably damaging 0.99
R4050:Fam208b UTSW 13 3,573,507 (GRCm38) missense probably benign 0.09
R4308:Fam208b UTSW 13 3,569,498 (GRCm38) missense probably damaging 0.97
R4484:Fam208b UTSW 13 3,581,831 (GRCm38) missense probably benign 0.12
R4674:Fam208b UTSW 13 3,573,686 (GRCm38) missense possibly damaging 0.69
R4718:Fam208b UTSW 13 3,574,495 (GRCm38) missense probably benign 0.00
R4745:Fam208b UTSW 13 3,590,069 (GRCm38) missense probably benign 0.26
R4776:Fam208b UTSW 13 3,570,391 (GRCm38) missense probably damaging 1.00
R4839:Fam208b UTSW 13 3,584,807 (GRCm38) missense probably damaging 0.96
R4855:Fam208b UTSW 13 3,566,680 (GRCm38) splice site probably null
R5049:Fam208b UTSW 13 3,574,000 (GRCm38) missense probably benign 0.00
R5076:Fam208b UTSW 13 3,576,357 (GRCm38) missense probably benign 0.41
R5287:Fam208b UTSW 13 3,575,744 (GRCm38) missense probably benign 0.41
R5298:Fam208b UTSW 13 3,595,613 (GRCm38) splice site probably null
R5379:Fam208b UTSW 13 3,588,496 (GRCm38) missense probably benign 0.41
R5512:Fam208b UTSW 13 3,595,517 (GRCm38) missense probably damaging 0.99
R5624:Fam208b UTSW 13 3,584,996 (GRCm38) missense possibly damaging 0.66
R5750:Fam208b UTSW 13 3,573,642 (GRCm38) nonsense probably null
R6114:Fam208b UTSW 13 3,590,081 (GRCm38) missense probably damaging 1.00
R6118:Fam208b UTSW 13 3,581,891 (GRCm38) missense possibly damaging 0.76
R6119:Fam208b UTSW 13 3,581,891 (GRCm38) missense possibly damaging 0.76
R6269:Fam208b UTSW 13 3,581,891 (GRCm38) missense possibly damaging 0.76
R6270:Fam208b UTSW 13 3,581,891 (GRCm38) missense possibly damaging 0.76
R6271:Fam208b UTSW 13 3,581,891 (GRCm38) missense possibly damaging 0.76
R6272:Fam208b UTSW 13 3,581,891 (GRCm38) missense possibly damaging 0.76
R6525:Fam208b UTSW 13 3,576,540 (GRCm38) nonsense probably null
R6550:Fam208b UTSW 13 3,590,519 (GRCm38) missense possibly damaging 0.85
R6714:Fam208b UTSW 13 3,594,189 (GRCm38) missense probably benign 0.00
R6797:Fam208b UTSW 13 3,576,769 (GRCm38) missense probably benign 0.26
R6967:Fam208b UTSW 13 3,574,819 (GRCm38) missense probably benign 0.22
R7016:Fam208b UTSW 13 3,576,857 (GRCm38) missense possibly damaging 0.92
R7219:Fam208b UTSW 13 3,590,521 (GRCm38) missense probably damaging 0.99
R7454:Fam208b UTSW 13 3,585,332 (GRCm38) missense probably benign 0.21
R7571:Fam208b UTSW 13 3,575,292 (GRCm38) missense probably benign 0.01
R7580:Fam208b UTSW 13 3,574,752 (GRCm38) missense probably damaging 0.99
R7587:Fam208b UTSW 13 3,568,849 (GRCm38) missense possibly damaging 0.83
R7657:Fam208b UTSW 13 3,573,777 (GRCm38) missense probably damaging 0.98
R7810:Fam208b UTSW 13 3,575,714 (GRCm38) missense possibly damaging 0.61
R7909:Fam208b UTSW 13 3,573,765 (GRCm38) missense possibly damaging 0.93
R7924:Fam208b UTSW 13 3,594,331 (GRCm38) missense possibly damaging 0.92
R7945:Fam208b UTSW 13 3,576,085 (GRCm38) missense probably benign
R8005:Fam208b UTSW 13 3,575,681 (GRCm38) missense probably benign
R8067:Fam208b UTSW 13 3,569,602 (GRCm38) missense probably benign
R8112:Fam208b UTSW 13 3,569,516 (GRCm38) missense probably damaging 1.00
R8162:Fam208b UTSW 13 3,599,691 (GRCm38) missense probably damaging 0.96
R8170:Fam208b UTSW 13 3,574,881 (GRCm38) nonsense probably null
R8240:Fam208b UTSW 13 3,574,388 (GRCm38) missense probably benign
R8263:Fam208b UTSW 13 3,590,016 (GRCm38) missense probably benign 0.03
R8263:Fam208b UTSW 13 3,575,286 (GRCm38) missense possibly damaging 0.70
R8477:Fam208b UTSW 13 3,575,079 (GRCm38) missense probably benign 0.18
R9022:Fam208b UTSW 13 3,576,659 (GRCm38) missense probably benign
R9140:Fam208b UTSW 13 3,588,441 (GRCm38) missense probably benign 0.04
R9167:Fam208b UTSW 13 3,574,724 (GRCm38) missense probably benign
R9527:Fam208b UTSW 13 3,585,191 (GRCm38) missense possibly damaging 0.61
R9535:Fam208b UTSW 13 3,573,559 (GRCm38) missense possibly damaging 0.69
R9711:Fam208b UTSW 13 3,599,667 (GRCm38) missense probably benign
X0024:Fam208b UTSW 13 3,599,837 (GRCm38) missense probably null 0.99
X0025:Fam208b UTSW 13 3,576,827 (GRCm38) missense probably benign 0.15
X0066:Fam208b UTSW 13 3,588,441 (GRCm38) missense probably benign 0.04
Z1176:Fam208b UTSW 13 3,588,429 (GRCm38) missense probably damaging 0.98
Z1176:Fam208b UTSW 13 3,576,636 (GRCm38) missense probably benign 0.01
Z1177:Fam208b UTSW 13 3,574,234 (GRCm38) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGACAACACCTGCCACGTAG -3'
(R):5'- AAGTCAGACTGTTCCATTCCACC -3'

Sequencing Primer
(F):5'- TGCCACGTAGCACACAGG -3'
(R):5'- GTTCCATTCCACCTCAATAAACTG -3'
Posted On 2019-10-17