Incidental Mutation 'R0620:Miga2'
ID 58576
Institutional Source Beutler Lab
Gene Symbol Miga2
Ensembl Gene ENSMUSG00000026858
Gene Name mitoguardin 2
Synonyms Fam73b, 5730472N09Rik, R74766
MMRRC Submission 038809-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0620 (G1)
Quality Score 207
Status Validated
Chromosome 2
Chromosomal Location 30254245-30275533 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) T to A at 30271756 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000077977] [ENSMUST00000100214] [ENSMUST00000140075] [ENSMUST00000175864]
AlphaFold Q8BK03
Predicted Effect probably benign
Transcript: ENSMUST00000077977
SMART Domains Protein: ENSMUSP00000077127
Gene: ENSMUSG00000026858

DomainStartEndE-ValueType
Pfam:DUF2217 30 568 5.6e-242 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100214
SMART Domains Protein: ENSMUSP00000097787
Gene: ENSMUSG00000026858

DomainStartEndE-ValueType
Pfam:DUF2217 31 568 6.9e-228 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125610
Predicted Effect probably benign
Transcript: ENSMUST00000140075
SMART Domains Protein: ENSMUSP00000135519
Gene: ENSMUSG00000026858

DomainStartEndE-ValueType
Pfam:DUF2217 30 393 5.1e-125 PFAM
low complexity region 409 420 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175864
SMART Domains Protein: ENSMUSP00000135812
Gene: ENSMUSG00000026858

DomainStartEndE-ValueType
Pfam:DUF2217 1 73 1.5e-46 PFAM
Pfam:DUF2217 70 114 7.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176517
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 100% (74/74)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 T C 6: 92,835,094 (GRCm39) T679A possibly damaging Het
Ahr T C 12: 35,558,193 (GRCm39) T276A probably benign Het
Akap9 A T 5: 4,114,136 (GRCm39) Q3138H probably damaging Het
Armt1 T A 10: 4,382,689 (GRCm39) F7I probably benign Het
B3galt2 A G 1: 143,521,878 (GRCm39) R5G probably damaging Het
Bod1l T C 5: 41,958,576 (GRCm39) N2750S probably benign Het
Cadps2 T A 6: 23,583,395 (GRCm39) E365V probably damaging Het
Cd200r3 T A 16: 44,778,080 (GRCm39) probably null Het
Cemip2 T A 19: 21,795,335 (GRCm39) S743T probably benign Het
Cst7 T A 2: 150,417,806 (GRCm39) probably benign Het
Defb30 A T 14: 63,287,212 (GRCm39) probably benign Het
Dido1 C T 2: 180,301,644 (GRCm39) G2087S probably benign Het
Dio2 A G 12: 90,704,845 (GRCm39) Y72H probably benign Het
Dnah11 C T 12: 117,951,204 (GRCm39) E3035K probably damaging Het
Dnajb13 T C 7: 100,152,456 (GRCm39) K287E possibly damaging Het
Dnajc11 G A 4: 152,058,085 (GRCm39) V244I possibly damaging Het
Ect2 C T 3: 27,193,801 (GRCm39) A226T probably damaging Het
Ercc8 G A 13: 108,310,595 (GRCm39) probably null Het
Fam120b T A 17: 15,623,189 (GRCm39) M389K probably benign Het
Fam151a A G 4: 106,605,128 (GRCm39) M497V probably benign Het
Fam186b C A 15: 99,178,009 (GRCm39) G439V probably benign Het
Fank1 A G 7: 133,478,494 (GRCm39) Y185C probably damaging Het
Gart T C 16: 91,427,490 (GRCm39) probably benign Het
Glb1l T C 1: 75,176,364 (GRCm39) Y572C probably damaging Het
Gm11563 C T 11: 99,549,263 (GRCm39) A164T unknown Het
Gnb4 C T 3: 32,645,356 (GRCm39) V112I probably benign Het
Gsdmc3 T A 15: 63,731,542 (GRCm39) D330V probably damaging Het
H2-DMa C T 17: 34,356,934 (GRCm39) T144M probably damaging Het
Haus6 A T 4: 86,501,751 (GRCm39) F707I possibly damaging Het
Hmcn1 T A 1: 150,469,767 (GRCm39) T4971S probably benign Het
Ints6 A T 14: 62,934,208 (GRCm39) F766L probably benign Het
Kdm5d T A Y: 927,330 (GRCm39) M650K probably damaging Het
Kif21b T C 1: 136,087,166 (GRCm39) F881S possibly damaging Het
Klrk1 C A 6: 129,591,598 (GRCm39) Q176H possibly damaging Het
Ky T C 9: 102,414,820 (GRCm39) V244A probably benign Het
Mia2 T A 12: 59,201,205 (GRCm39) L191M possibly damaging Het
Mtss2 C T 8: 111,464,580 (GRCm39) P322S probably damaging Het
Nalcn A G 14: 123,536,553 (GRCm39) probably benign Het
Ncbp3 T A 11: 72,940,671 (GRCm39) probably benign Het
Nprl3 G A 11: 32,184,876 (GRCm39) L378F probably damaging Het
Ntrk2 A T 13: 58,994,635 (GRCm39) M184L probably benign Het
Or11g1 G T 14: 50,651,154 (GRCm39) C51F probably benign Het
Or9e1 T G 11: 58,732,269 (GRCm39) C110G probably damaging Het
Osbpl9 T C 4: 108,940,325 (GRCm39) E287G probably damaging Het
Parva T C 7: 112,175,618 (GRCm39) F250L probably damaging Het
Pcdhb11 C T 18: 37,554,864 (GRCm39) Q65* probably null Het
Phtf1 A G 3: 103,901,081 (GRCm39) T377A probably damaging Het
Pkp4 G A 2: 59,152,987 (GRCm39) V612I possibly damaging Het
Plscr2 C A 9: 92,169,707 (GRCm39) S52R probably benign Het
Pnisr C T 4: 21,874,092 (GRCm39) probably benign Het
Pole2 A C 12: 69,256,653 (GRCm39) S291A probably damaging Het
Ppp2r5d A G 17: 46,994,944 (GRCm39) F586L probably benign Het
Prrx1 G A 1: 163,085,385 (GRCm39) R182C probably damaging Het
Ptprs A G 17: 56,736,103 (GRCm39) I110T possibly damaging Het
Rasgrf2 G A 13: 92,067,936 (GRCm39) probably benign Het
Resf1 A T 6: 149,229,873 (GRCm39) Q973L probably damaging Het
Riox2 T C 16: 59,312,255 (GRCm39) V464A probably benign Het
Robo2 A G 16: 73,764,690 (GRCm39) V646A possibly damaging Het
Ros1 T A 10: 51,994,444 (GRCm39) I1279F probably damaging Het
Siglec1 G A 2: 130,916,188 (GRCm39) T1254M probably benign Het
Snx7 T C 3: 117,640,324 (GRCm39) N62D probably damaging Het
Sp100 G A 1: 85,587,588 (GRCm39) probably null Het
Stil A T 4: 114,864,356 (GRCm39) I86L possibly damaging Het
Tbc1d16 T A 11: 119,099,864 (GRCm39) D170V probably benign Het
Trappc13 G A 13: 104,297,589 (GRCm39) T105M probably damaging Het
Trhr T A 15: 44,092,896 (GRCm39) S378T probably benign Het
Ttc7b T C 12: 100,466,332 (GRCm39) probably null Het
Vegfc A T 8: 54,610,174 (GRCm39) Y110F probably benign Het
Vmn1r184 C A 7: 25,966,602 (GRCm39) P116H possibly damaging Het
Vmn2r5 A T 3: 64,411,235 (GRCm39) C444* probably null Het
Zfp341 A G 2: 154,476,193 (GRCm39) E460G possibly damaging Het
Zfp819 T A 7: 43,265,868 (GRCm39) V41E probably benign Het
Other mutations in Miga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Miga2 APN 2 30,257,729 (GRCm39) missense probably benign 0.04
IGL01353:Miga2 APN 2 30,261,245 (GRCm39) critical splice donor site probably null
IGL01679:Miga2 APN 2 30,268,262 (GRCm39) missense probably benign 0.07
IGL03113:Miga2 APN 2 30,274,022 (GRCm39) missense possibly damaging 0.96
uncertain UTSW 2 30,261,208 (GRCm39) missense probably benign 0.00
R1698:Miga2 UTSW 2 30,268,009 (GRCm39) missense probably damaging 1.00
R1729:Miga2 UTSW 2 30,258,980 (GRCm39) missense probably damaging 1.00
R1994:Miga2 UTSW 2 30,272,000 (GRCm39) missense probably damaging 1.00
R2377:Miga2 UTSW 2 30,274,002 (GRCm39) nonsense probably null
R2891:Miga2 UTSW 2 30,268,306 (GRCm39) splice site probably null
R2892:Miga2 UTSW 2 30,268,306 (GRCm39) splice site probably null
R2893:Miga2 UTSW 2 30,268,306 (GRCm39) splice site probably null
R3788:Miga2 UTSW 2 30,261,237 (GRCm39) nonsense probably null
R4042:Miga2 UTSW 2 30,257,738 (GRCm39) missense possibly damaging 0.87
R5214:Miga2 UTSW 2 30,261,208 (GRCm39) missense probably benign 0.00
R5750:Miga2 UTSW 2 30,261,577 (GRCm39) missense probably damaging 1.00
R5928:Miga2 UTSW 2 30,258,875 (GRCm39) splice site probably benign
R6134:Miga2 UTSW 2 30,261,229 (GRCm39) missense probably benign 0.00
R6209:Miga2 UTSW 2 30,271,674 (GRCm39) missense probably damaging 1.00
R6860:Miga2 UTSW 2 30,261,175 (GRCm39) missense probably benign 0.15
R7373:Miga2 UTSW 2 30,272,083 (GRCm39) missense probably damaging 1.00
R7884:Miga2 UTSW 2 30,261,216 (GRCm39) missense probably benign 0.02
R8370:Miga2 UTSW 2 30,265,755 (GRCm39) frame shift probably null
R8371:Miga2 UTSW 2 30,265,755 (GRCm39) frame shift probably null
R8374:Miga2 UTSW 2 30,265,755 (GRCm39) frame shift probably null
R8847:Miga2 UTSW 2 30,273,990 (GRCm39) missense probably damaging 0.99
R9060:Miga2 UTSW 2 30,271,735 (GRCm39) missense probably damaging 1.00
R9253:Miga2 UTSW 2 30,261,239 (GRCm39) missense probably benign 0.18
R9286:Miga2 UTSW 2 30,273,609 (GRCm39) missense probably benign 0.33
R9526:Miga2 UTSW 2 30,268,400 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- ACAACCCAGCCTGCTTGTGAATC -3'
(R):5'- GGCATCCATGAGGATGAAGTCCAG -3'

Sequencing Primer
(F):5'- ATCTTATCCAACTGGGTCACAGG -3'
(R):5'- AGGGGCATCTAGAGCTACC -3'
Posted On 2013-07-11