Incidental Mutation 'R7570:Cyp2c69'
ID 585774
Institutional Source Beutler Lab
Gene Symbol Cyp2c69
Ensembl Gene ENSMUSG00000092008
Gene Name cytochrome P450, family 2, subfamily c, polypeptide 69
Synonyms AI098658
MMRRC Submission 045631-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R7570 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 39842660-39886769 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 39859898 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 293 (D293E)
Ref Sequence ENSEMBL: ENSMUSP00000132832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168838]
AlphaFold E9PXC3
Predicted Effect probably damaging
Transcript: ENSMUST00000168838
AA Change: D293E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132832
Gene: ENSMUSG00000092008
AA Change: D293E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 7e-152 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (104/106)
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik C T 6: 91,934,610 (GRCm38) T613I probably benign Het
Ajuba T C 14: 54,576,402 (GRCm38) E288G probably damaging Het
Ankrd12 C T 17: 65,985,360 (GRCm38) R1026K probably benign Het
Apol7b T C 15: 77,423,474 (GRCm38) T274A probably benign Het
Arid4a A T 12: 71,063,142 (GRCm38) R86* probably null Het
Asnsd1 C T 1: 53,348,258 (GRCm38) G70D probably damaging Het
Atg4c T A 4: 99,228,560 (GRCm38) V313D possibly damaging Het
Atp13a5 A C 16: 29,266,963 (GRCm38) C885G probably damaging Het
Bpifb9a A T 2: 154,262,263 (GRCm38) I209F possibly damaging Het
Bsn T C 9: 108,113,543 (GRCm38) D1670G probably damaging Het
Cct8 T A 16: 87,491,322 (GRCm38) I121F probably benign Het
Cd209a T G 8: 3,744,151 (GRCm38) D217A probably damaging Het
Cdk19 C T 10: 40,477,958 (GRCm38) S456L possibly damaging Het
Chd9 C T 8: 90,994,580 (GRCm38) H999Y unknown Het
Col5a1 G A 2: 27,951,383 (GRCm38) V339M unknown Het
Cr2 G A 1: 195,169,340 (GRCm38) R115* probably null Het
Cyb561 A T 11: 105,937,644 (GRCm38) F62I probably damaging Het
Cyp2c38 A T 19: 39,404,743 (GRCm38) N293K possibly damaging Het
Dcbld2 T A 16: 58,424,569 (GRCm38) C69S possibly damaging Het
Dcdc2a T C 13: 25,119,373 (GRCm38) S296P probably benign Het
Dmxl1 T A 18: 49,893,957 (GRCm38) I2044K possibly damaging Het
Dnah5 A G 15: 28,346,952 (GRCm38) D2527G probably damaging Het
Dnah6 T C 6: 73,149,430 (GRCm38) T1305A probably benign Het
Dnajc9 A G 14: 20,388,644 (GRCm38) V47A probably benign Het
Dnmt3b A G 2: 153,676,699 (GRCm38) Y594C probably damaging Het
Dph7 A G 2: 24,965,630 (GRCm38) D147G probably damaging Het
Drap1 T C 19: 5,423,352 (GRCm38) H164R possibly damaging Het
Dsg3 T A 18: 20,527,780 (GRCm38) V392E possibly damaging Het
Dxo A G 17: 34,837,640 (GRCm38) D81G probably benign Het
E230025N22Rik G T 18: 36,695,592 (GRCm38) T11K probably benign Het
Esyt1 A G 10: 128,518,932 (GRCm38) V533A possibly damaging Het
Etv3 T A 3: 87,536,031 (GRCm38) C307* probably null Het
Fam114a1 T A 5: 65,030,059 (GRCm38) probably null Het
Fam3c T A 6: 22,326,405 (GRCm38) probably benign Het
Fbn1 G T 2: 125,397,852 (GRCm38) T305K probably benign Het
Ggt1 A T 10: 75,585,594 (GRCm38) I484F probably damaging Het
Gpatch1 T C 7: 35,293,812 (GRCm38) D536G probably damaging Het
Gpx4 T C 10: 80,055,041 (GRCm38) I189T probably damaging Het
Gsr T A 8: 33,669,165 (GRCm38) C85S probably damaging Het
Gsta5 A T 9: 78,304,469 (GRCm38) D171V possibly damaging Het
Havcr1 T A 11: 46,770,542 (GRCm38) probably null Het
Heatr4 T C 12: 83,979,644 (GRCm38) T280A probably benign Het
Hmcn2 A T 2: 31,423,911 (GRCm38) E3532D probably benign Het
Hnrnpc T C 14: 52,075,099 (GRCm38) N308S possibly damaging Het
Ighv8-9 A G 12: 115,468,738 (GRCm38) V13A probably benign Het
Itgb2l A T 16: 96,426,239 (GRCm38) F535I probably benign Het
Kdm5a T G 6: 120,427,842 (GRCm38) D1348E probably damaging Het
Kndc1 CT C 7: 139,923,775 (GRCm38) probably null Het
Ky A G 9: 102,542,329 (GRCm38) I512V probably benign Het
Lamc1 A T 1: 153,243,275 (GRCm38) F866Y possibly damaging Het
Lbx1 C A 19: 45,235,248 (GRCm38) probably benign Het
Magel2 A G 7: 62,378,910 (GRCm38) T521A possibly damaging Het
Mgam A T 6: 40,746,433 (GRCm38) I491L probably benign Het
Mitd1 T C 1: 37,890,192 (GRCm38) E40G probably damaging Het
Mpzl3 A G 9: 45,070,687 (GRCm38) T218A probably benign Het
Mrpl42 A G 10: 95,480,965 (GRCm38) S77P probably benign Het
Mup5 C T 4: 61,834,674 (GRCm38) W37* probably null Het
Myh14 T C 7: 44,632,426 (GRCm38) I803V probably benign Het
Ncor2 T A 5: 125,030,089 (GRCm38) T744S Het
Ndufv3 A G 17: 31,527,622 (GRCm38) D162G probably damaging Het
Nostrin A G 2: 69,175,806 (GRCm38) E278G probably damaging Het
Nrxn1 T G 17: 90,162,379 (GRCm38) E1288A probably benign Het
Or4c11c A G 2: 88,831,128 (GRCm38) N4D possibly damaging Het
Or51b6b C A 7: 103,660,881 (GRCm38) R123L probably damaging Het
Or52h1 T A 7: 104,179,748 (GRCm38) Y220F probably damaging Het
Or8g55 A T 9: 39,873,455 (GRCm38) Y60F possibly damaging Het
Patj T A 4: 98,424,500 (GRCm38) probably null Het
Pcm1 T G 8: 41,267,344 (GRCm38) I314R possibly damaging Het
Pcsk6 A G 7: 66,033,898 (GRCm38) T754A probably benign Het
Pde2a A T 7: 101,502,834 (GRCm38) N326I probably benign Het
Plekhg4 T C 8: 105,378,684 (GRCm38) S594P possibly damaging Het
Plekhm3 T C 1: 64,937,906 (GRCm38) D135G probably damaging Het
Plin4 A T 17: 56,106,776 (GRCm38) M283K probably benign Het
Ppfia3 T C 7: 45,340,748 (GRCm38) probably null Het
Prdm9 T C 17: 15,555,652 (GRCm38) N179S probably benign Het
Prrt3 T C 6: 113,494,488 (GRCm38) S908G probably damaging Het
Psg22 C A 7: 18,722,735 (GRCm38) S181Y possibly damaging Het
Rcor3 C A 1: 192,137,876 (GRCm38) G8V probably damaging Het
Rp1l1 T A 14: 64,031,574 (GRCm38) C1536* probably null Het
Rpp25l T C 4: 41,712,529 (GRCm38) H82R probably damaging Het
Rps3a1 T A 3: 86,139,089 (GRCm38) M172L probably benign Het
Rtbdn T C 8: 84,952,927 (GRCm38) L110P probably damaging Het
Ryr1 T A 7: 29,078,585 (GRCm38) Q2169L probably damaging Het
Scn4a A T 11: 106,320,473 (GRCm38) C1573S possibly damaging Het
Sec16b A T 1: 157,531,395 (GRCm38) probably null Het
Serpina1a A T 12: 103,853,837 (GRCm38) D383E possibly damaging Het
Sh3gl3 T C 7: 82,285,077 (GRCm38) M262T probably benign Het
Sos2 G A 12: 69,590,880 (GRCm38) T1052M probably damaging Het
Spag16 G A 1: 69,996,841 (GRCm38) V343I probably benign Het
Spocd1 T G 4: 129,930,164 (GRCm38) D251E Het
Stc2 G T 11: 31,367,798 (GRCm38) N74K probably damaging Het
Tasor2 A G 13: 3,573,621 (GRCm38) Y2110H probably damaging Het
Thbs3 C T 3: 89,219,052 (GRCm38) Q227* probably null Het
Tmem92 A C 11: 94,778,990 (GRCm38) I105R probably benign Het
Tmod1 T A 4: 46,083,632 (GRCm38) N20K probably benign Het
Tns1 T C 1: 73,953,479 (GRCm38) D53G probably damaging Het
Tspan33 T A 6: 29,717,338 (GRCm38) L246Q probably damaging Het
Ttc16 A G 2: 32,768,968 (GRCm38) L392P probably damaging Het
Uggt1 T A 1: 36,185,838 (GRCm38) T572S probably benign Het
Usp17la A T 7: 104,860,397 (GRCm38) T70S probably damaging Het
Usp31 C T 7: 121,674,963 (GRCm38) R370H probably damaging Het
Wdr83 C T 8: 85,079,834 (GRCm38) V112M probably damaging Het
Zbtb25 T A 12: 76,369,592 (GRCm38) probably benign Het
Zfp110 T A 7: 12,849,340 (GRCm38) N638K possibly damaging Het
Zfp747l1 T A 7: 127,385,283 (GRCm38) S216C probably benign Het
Zfp820 T C 17: 21,819,013 (GRCm38) T445A probably benign Het
Other mutations in Cyp2c69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01873:Cyp2c69 APN 19 39,881,249 (GRCm38) splice site probably benign
IGL02127:Cyp2c69 APN 19 39,851,057 (GRCm38) missense probably damaging 0.99
IGL02945:Cyp2c69 APN 19 39,886,647 (GRCm38) missense possibly damaging 0.81
IGL03067:Cyp2c69 APN 19 39,881,093 (GRCm38) missense probably benign 0.29
IGL03069:Cyp2c69 APN 19 39,881,093 (GRCm38) missense probably benign 0.29
BB007:Cyp2c69 UTSW 19 39,842,990 (GRCm38) missense possibly damaging 0.47
BB017:Cyp2c69 UTSW 19 39,842,990 (GRCm38) missense possibly damaging 0.47
R0545:Cyp2c69 UTSW 19 39,886,661 (GRCm38) missense probably damaging 1.00
R1276:Cyp2c69 UTSW 19 39,876,224 (GRCm38) missense possibly damaging 0.47
R1468:Cyp2c69 UTSW 19 39,849,395 (GRCm38) missense probably damaging 1.00
R1468:Cyp2c69 UTSW 19 39,849,395 (GRCm38) missense probably damaging 1.00
R1534:Cyp2c69 UTSW 19 39,851,149 (GRCm38) missense probably benign
R1549:Cyp2c69 UTSW 19 39,842,986 (GRCm38) missense probably benign 0.11
R1703:Cyp2c69 UTSW 19 39,876,366 (GRCm38) missense probably benign 0.10
R1752:Cyp2c69 UTSW 19 39,881,153 (GRCm38) missense probably damaging 1.00
R1769:Cyp2c69 UTSW 19 39,876,371 (GRCm38) missense probably benign 0.00
R1843:Cyp2c69 UTSW 19 39,877,528 (GRCm38) missense probably benign 0.27
R1938:Cyp2c69 UTSW 19 39,849,366 (GRCm38) missense probably damaging 0.97
R2100:Cyp2c69 UTSW 19 39,886,686 (GRCm38) missense probably benign 0.11
R2366:Cyp2c69 UTSW 19 39,877,594 (GRCm38) missense probably benign 0.12
R2367:Cyp2c69 UTSW 19 39,877,594 (GRCm38) missense probably benign 0.12
R2440:Cyp2c69 UTSW 19 39,876,294 (GRCm38) missense probably benign 0.17
R2931:Cyp2c69 UTSW 19 39,849,483 (GRCm38) missense probably damaging 1.00
R3709:Cyp2c69 UTSW 19 39,851,223 (GRCm38) splice site probably benign
R3793:Cyp2c69 UTSW 19 39,881,156 (GRCm38) missense probably benign 0.44
R3898:Cyp2c69 UTSW 19 39,876,390 (GRCm38) missense probably benign 0.00
R4579:Cyp2c69 UTSW 19 39,881,186 (GRCm38) missense possibly damaging 0.89
R4707:Cyp2c69 UTSW 19 39,849,408 (GRCm38) missense probably benign 0.39
R4778:Cyp2c69 UTSW 19 39,877,594 (GRCm38) missense probably benign 0.12
R4779:Cyp2c69 UTSW 19 39,877,594 (GRCm38) missense probably benign 0.12
R4780:Cyp2c69 UTSW 19 39,877,594 (GRCm38) missense probably benign 0.12
R4838:Cyp2c69 UTSW 19 39,877,594 (GRCm38) missense probably benign 0.12
R4877:Cyp2c69 UTSW 19 39,877,612 (GRCm38) missense probably damaging 1.00
R5488:Cyp2c69 UTSW 19 39,851,159 (GRCm38) missense probably null 0.94
R5489:Cyp2c69 UTSW 19 39,851,159 (GRCm38) missense probably null 0.94
R6083:Cyp2c69 UTSW 19 39,849,456 (GRCm38) missense probably damaging 1.00
R6278:Cyp2c69 UTSW 19 39,843,063 (GRCm38) nonsense probably null
R6415:Cyp2c69 UTSW 19 39,842,921 (GRCm38) missense probably benign 0.44
R6732:Cyp2c69 UTSW 19 39,881,499 (GRCm38) missense probably benign
R6858:Cyp2c69 UTSW 19 39,877,565 (GRCm38) missense probably benign 0.19
R7023:Cyp2c69 UTSW 19 39,877,542 (GRCm38) missense probably benign 0.43
R7227:Cyp2c69 UTSW 19 39,881,166 (GRCm38) missense possibly damaging 0.77
R7228:Cyp2c69 UTSW 19 39,881,166 (GRCm38) missense possibly damaging 0.77
R7260:Cyp2c69 UTSW 19 39,842,900 (GRCm38) missense probably benign 0.00
R7262:Cyp2c69 UTSW 19 39,886,732 (GRCm38) start gained probably benign
R7479:Cyp2c69 UTSW 19 39,881,557 (GRCm38) missense probably benign 0.00
R7663:Cyp2c69 UTSW 19 39,877,509 (GRCm38) nonsense probably null
R7785:Cyp2c69 UTSW 19 39,851,166 (GRCm38) missense probably damaging 1.00
R7795:Cyp2c69 UTSW 19 39,876,219 (GRCm38) missense probably benign
R7920:Cyp2c69 UTSW 19 39,877,803 (GRCm38) splice site probably null
R7930:Cyp2c69 UTSW 19 39,842,990 (GRCm38) missense possibly damaging 0.47
R8203:Cyp2c69 UTSW 19 39,881,140 (GRCm38) missense probably damaging 1.00
R8888:Cyp2c69 UTSW 19 39,881,466 (GRCm38) missense possibly damaging 0.65
R8895:Cyp2c69 UTSW 19 39,881,466 (GRCm38) missense possibly damaging 0.65
R9530:Cyp2c69 UTSW 19 39,859,867 (GRCm38) missense possibly damaging 0.82
R9645:Cyp2c69 UTSW 19 39,881,149 (GRCm38) missense probably damaging 1.00
R9665:Cyp2c69 UTSW 19 39,851,060 (GRCm38) missense possibly damaging 0.73
R9753:Cyp2c69 UTSW 19 39,877,547 (GRCm38) missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- ATGGGACTGAAAGTTGAATACTGAC -3'
(R):5'- CTACACCACAGTCTCTGAAATGG -3'

Sequencing Primer
(F):5'- CATTTTGAATAACAATGTGCAGGAC -3'
(R):5'- GCCACTGATCAACATTTTAGATTCTG -3'
Posted On 2019-10-17