Incidental Mutation 'R7571:Xkr4'
ID585776
Institutional Source Beutler Lab
Gene Symbol Xkr4
Ensembl Gene ENSMUSG00000051951
Gene NameX-linked Kx blood group related 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7571 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location3205901-3671498 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 3670688 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 221 (I221L)
Ref Sequence ENSEMBL: ENSMUSP00000070648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070533]
Predicted Effect probably benign
Transcript: ENSMUST00000070533
AA Change: I221L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000070648
Gene: ENSMUSG00000051951
AA Change: I221L

DomainStartEndE-ValueType
low complexity region 49 99 N/A INTRINSIC
Pfam:XK-related 111 513 2.6e-128 PFAM
low complexity region 573 586 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C02Rik A T 5: 30,482,158 E143V possibly damaging Het
Abca16 A T 7: 120,519,988 N985I probably benign Het
Abi3bp T A 16: 56,630,982 probably null Het
Acad12 A T 5: 121,607,194 Y309* probably null Het
Acadsb G T 7: 131,443,554 R405L probably damaging Het
Acan G A 7: 79,086,267 V154M probably damaging Het
Adam22 G A 5: 8,082,160 R894* probably null Het
Ahnak A T 19: 9,000,786 K90* probably null Het
Ak4 T C 4: 101,460,542 I103T probably benign Het
Ap4e1 C T 2: 127,019,336 L132F probably damaging Het
Apol7b C T 15: 77,423,477 V273I probably benign Het
Arhgef37 T A 18: 61,504,332 I420F probably damaging Het
Atg13 C T 2: 91,680,342 probably null Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Cabin1 A T 10: 75,646,666 S2148T probably damaging Het
Cacna1i T C 15: 80,375,336 V1269A probably damaging Het
Cdipt T C 7: 126,979,622 I195T probably benign Het
Ces2b A T 8: 104,835,009 H245L probably damaging Het
Clstn1 T G 4: 149,646,287 M825R probably benign Het
Cntn3 G A 6: 102,278,403 T178I probably damaging Het
Col7a1 A G 9: 108,982,707 M2789V probably null Het
Col9a2 A T 4: 121,039,784 I24F unknown Het
Cpne2 T C 8: 94,551,780 M134T probably benign Het
Cpt1b A G 15: 89,421,343 probably null Het
Crocc T C 4: 141,046,049 probably null Het
Cts8 T C 13: 61,248,167 Y330C probably damaging Het
Cwc22 T C 2: 77,917,067 D434G probably benign Het
Cyp3a13 T C 5: 137,898,863 I396M possibly damaging Het
D430042O09Rik C T 7: 125,708,021 probably benign Het
D5Ertd577e A T 5: 95,482,960 N232I probably damaging Het
Ddr2 A T 1: 170,001,851 I278N probably benign Het
Dnaaf5 A G 5: 139,170,208 E548G possibly damaging Het
Dync2h1 A G 9: 7,002,623 L3808P probably damaging Het
Faf2 T A 13: 54,650,214 W209R probably damaging Het
Fam129a T C 1: 151,718,297 V911A probably benign Het
Fam208b T C 13: 3,575,292 T1553A probably benign Het
Fbln2 A T 6: 91,268,575 E992D probably damaging Het
Fdxacb1 T A 9: 50,771,793 V352D probably damaging Het
Flg2 G T 3: 93,219,996 G2072* probably null Het
Flii A T 11: 60,721,136 L347Q probably damaging Het
Fndc3a A T 14: 72,589,896 H116Q probably damaging Het
Fnta A T 8: 26,015,465 M39K probably benign Het
Gabra4 A G 5: 71,571,992 S482P probably benign Het
Gapdhs G A 7: 30,737,958 P61S unknown Het
Gm10153 A T 7: 142,189,664 C242* probably null Het
Gp1ba A G 11: 70,640,094 I229V unknown Het
Grap2 T A 15: 80,643,704 L117Q probably damaging Het
Grik5 A G 7: 25,013,885 I766T possibly damaging Het
Hrh3 A T 2: 180,101,286 I183N probably damaging Het
Htr5a C A 5: 27,842,895 Y149* probably null Het
Ibtk T C 9: 85,722,300 I527V probably benign Het
Il33 T A 19: 29,956,941 S184R probably damaging Het
Kansl3 T A 1: 36,365,587 Q94L possibly damaging Het
Kcnh6 A G 11: 106,017,416 D286G probably benign Het
Kmt2e T A 5: 23,478,587 M281K probably damaging Het
Lrp2 T A 2: 69,516,403 H833L probably damaging Het
Meis1 A T 11: 18,941,702 V282E probably damaging Het
Mfsd8 T G 3: 40,830,662 D240A probably damaging Het
Muc5b A G 7: 141,847,249 T534A unknown Het
Myo18b G A 5: 112,830,328 L1243F probably damaging Het
Nefl A G 14: 68,084,674 I238V probably benign Het
Nexn T A 3: 152,253,647 I62F possibly damaging Het
Notch4 T C 17: 34,583,574 L1323P probably damaging Het
Olfr493 A T 7: 108,346,482 F166L probably benign Het
Olfr555 T C 7: 102,659,051 S77P probably damaging Het
Olfr906 T C 9: 38,488,656 V209A probably benign Het
Patj C A 4: 98,568,980 H1244N probably damaging Het
Peg10 T A 6: 4,756,082 D219E unknown Het
Pi4kb G T 3: 94,999,114 probably null Het
Piezo1 A G 8: 122,498,418 F614S Het
Pisd T A 5: 32,737,337 N372Y probably damaging Het
Piwil4 T C 9: 14,734,597 D178G probably benign Het
Plekho1 G T 3: 95,989,254 P301Q probably damaging Het
Pop1 T A 15: 34,528,947 W738R probably null Het
Ppp4r1 C T 17: 65,810,616 P125L possibly damaging Het
Prdm9 T A 17: 15,563,264 N13I probably damaging Het
Psd4 T G 2: 24,407,011 V932G probably damaging Het
Ptger3 T C 3: 157,641,775 S355P probably benign Het
Ptprb T C 10: 116,339,430 V823A probably damaging Het
Ptprj C T 2: 90,455,186 V841I probably benign Het
Ranbp3 T C 17: 56,707,923 S281P probably benign Het
Rasal3 T A 17: 32,395,861 M541L possibly damaging Het
Rassf1 A G 9: 107,551,783 T63A possibly damaging Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rgs4 G A 1: 169,744,358 T124I probably damaging Het
Rspo2 T A 15: 43,169,976 probably benign Het
Scgn T C 13: 23,953,914 D258G probably damaging Het
Shkbp1 A G 7: 27,347,131 S403P possibly damaging Het
Slc25a13 A G 6: 6,052,785 L525P probably damaging Het
Snd1 G T 6: 28,526,203 K193N possibly damaging Het
Sntg2 C T 12: 30,175,202 A516T probably damaging Het
Stard13 A G 5: 151,059,502 I699T probably damaging Het
Svil T A 18: 5,114,636 V1984D probably damaging Het
Swt1 A G 1: 151,394,719 S582P probably benign Het
Sypl2 A G 3: 108,214,538 *265Q probably null Het
Taar8a T A 10: 24,077,408 Y303* probably null Het
Tlr2 T A 3: 83,836,542 I745F probably damaging Het
Tnrc6b A G 15: 80,929,393 T1784A probably benign Het
Tpo C A 12: 30,119,432 M101I probably benign Het
Trpm2 G T 10: 77,937,950 R544S probably benign Het
Ttc14 A G 3: 33,809,251 R603G unknown Het
Tubgcp6 A C 15: 89,100,722 V1694G probably damaging Het
Uba6 C A 5: 86,147,111 K356N probably benign Het
Usp16 T C 16: 87,464,835 V113A possibly damaging Het
Vcam1 G A 3: 116,114,383 Q677* probably null Het
Vmn1r238 T A 18: 3,122,721 E231V probably damaging Het
Vmn1r70 T C 7: 10,633,944 F120L probably benign Het
Vmn2r116 T A 17: 23,384,856 probably null Het
Vmn2r5 A T 3: 64,504,404 C248S probably damaging Het
Vmn2r87 A T 10: 130,479,071 D215E probably damaging Het
Zfp366 T C 13: 99,246,387 I686T probably benign Het
Zfp398 T A 6: 47,866,732 C573S probably damaging Het
Other mutations in Xkr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03398:Xkr4 APN 1 3216575 missense probably damaging 1.00
R0200:Xkr4 UTSW 1 3670663 missense probably benign 0.00
R0829:Xkr4 UTSW 1 3671246 missense possibly damaging 0.59
R0830:Xkr4 UTSW 1 3670745 missense possibly damaging 0.48
R0959:Xkr4 UTSW 1 3216674 missense probably damaging 1.00
R1242:Xkr4 UTSW 1 3216137 missense probably damaging 1.00
R1257:Xkr4 UTSW 1 3216813 missense probably benign 0.29
R2002:Xkr4 UTSW 1 3671095 missense probably benign
R3896:Xkr4 UTSW 1 3216191 missense probably damaging 0.99
R4006:Xkr4 UTSW 1 3421775 missense probably benign 0.01
R4173:Xkr4 UTSW 1 3216488 missense probably damaging 1.00
R4770:Xkr4 UTSW 1 3216491 missense probably damaging 1.00
R4868:Xkr4 UTSW 1 3216851 missense probably damaging 1.00
R5103:Xkr4 UTSW 1 3670688 missense probably benign
R5548:Xkr4 UTSW 1 3216930 missense probably damaging 1.00
R5602:Xkr4 UTSW 1 3216528 missense probably benign 0.18
R5608:Xkr4 UTSW 1 3671380 start gained probably benign
R5668:Xkr4 UTSW 1 3671035 missense probably damaging 1.00
R5901:Xkr4 UTSW 1 3216678 missense probably damaging 0.99
R6296:Xkr4 UTSW 1 3216570 missense probably benign 0.01
R6302:Xkr4 UTSW 1 3216738 missense probably damaging 0.99
R6326:Xkr4 UTSW 1 3671038 missense possibly damaging 0.75
R6341:Xkr4 UTSW 1 3670778 missense probably benign
R6911:Xkr4 UTSW 1 3671321 missense possibly damaging 0.91
R7086:Xkr4 UTSW 1 3216962 missense probably damaging 1.00
R7249:Xkr4 UTSW 1 3216810 missense probably damaging 1.00
R7881:Xkr4 UTSW 1 3216264 missense probably damaging 1.00
R7952:Xkr4 UTSW 1 3670619 missense possibly damaging 0.94
R8332:Xkr4 UTSW 1 3421899 missense probably damaging 1.00
Z1176:Xkr4 UTSW 1 3670981 missense probably damaging 1.00
Z1176:Xkr4 UTSW 1 3670982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCATGCAAAAGTAGAACAGTGGAC -3'
(R):5'- TGCAAGTGTTCAGCTTCCG -3'

Sequencing Primer
(F):5'- GCATGTAGGAACAGTAGTAGTCTCTC -3'
(R):5'- CCGCTGGTTTGTGCATGATTTC -3'
Posted On2019-10-17