Mutagenetix > Incidental Mutations

Incidental Mutation 'R0620:Siglec1'

58578

Institutional Source

Beutler Lab

Gene Symbol

Siglec1

Ensembl Gene

ENSMUSG00000027322

Gene Name

sialic acid binding Ig-like lectin 1, sialoadhesin

Synonyms

Sn, CD169, Siglec-1

MMRRC Submission

038809-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.086) question?

Stock #

R0620 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

131069220-131086765 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 131074268 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 1254 (T1254M)

Ref Sequence

ENSEMBL: ENSMUSP00000028794 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028794] [ENSMUST00000110227]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000028794
AA Change: T1254M

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000028794
Gene: ENSMUSG00000027322
AA Change: T1254M

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
IG	32	142	2.92e-5	SMART
Pfam:C2-set_2	148	235	9.4e-18	PFAM
IGc2	260	319	8.78e-9	SMART
IGc2	344	404	4.07e-4	SMART
IGc2	431	505	3.3e-4	SMART
IGc2	529	589	5.75e-4	SMART
IGc2	622	698	3.54e-4	SMART
low complexity region	700	705	N/A	INTRINSIC
IG	716	795	3.35e-5	SMART
IG	804	896	6.51e-3	SMART
IGc2	909	969	4.13e-5	SMART
IG_like	1001	1076	6.78e-2	SMART
low complexity region	1077	1088	N/A	INTRINSIC
IG	1094	1171	4.32e-8	SMART
IG_like	1185	1250	1.94e-2	SMART
IG	1268	1345	1.36e-5	SMART
IG_like	1354	1447	1.45e1	SMART
IG_like	1365	1435	4.51e-2	SMART
IG	1454	1534	4.56e-7	SMART
IG_like	1549	1624	1.21e-1	SMART
transmembrane domain	1647	1669	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110227
AA Change: T1254M

PolyPhen 2 Score 0.281 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000105856
Gene: ENSMUSG00000027322
AA Change: T1254M

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
IG	32	142	2.92e-5	SMART
Pfam:C2-set_2	148	235	7e-17	PFAM
IGc2	260	319	8.78e-9	SMART
IGc2	344	404	4.07e-4	SMART
IGc2	431	505	3.3e-4	SMART
IGc2	529	589	5.75e-4	SMART
IGc2	622	698	3.54e-4	SMART
low complexity region	700	705	N/A	INTRINSIC
IG	716	795	3.35e-5	SMART
IG	804	896	6.51e-3	SMART
IGc2	909	969	4.13e-5	SMART
IG_like	1001	1076	6.78e-2	SMART
low complexity region	1077	1088	N/A	INTRINSIC
IG	1094	1171	4.32e-8	SMART
IG_like	1185	1250	1.94e-2	SMART
IG	1268	1345	1.36e-5	SMART
IG_like	1354	1447	1.45e1	SMART
IG_like	1365	1435	4.51e-2	SMART
IG	1454	1534	4.56e-7	SMART

Meta Mutation Damage Score

0.1316

Coding Region Coverage

1x: 99.4%
3x: 99.0%
10x: 97.8%
20x: 96.1%

Validation Efficiency

100% (74/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin superfamily. The encoded protein is a lectin-like adhesion molecule that binds glycoconjugate ligands on cell surfaces in a sialic acid-dependent manner. It is a type I transmembrane protein expressed only by a subpopulation of macrophages and is involved in mediating cell-cell interactions. Alternative splicing produces a transcript variant encoding an isoform that is soluble rather than membrane-bound; however, the full-length nature of this variant has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene display subtle changes in B- and T-cell populations and decreased IgM levels. Mice homozygous for a knock-out or knock-in allele exhibit impaired phagocytosis of sialylated C. jejuni. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	A	T	6: 149,328,375	Q973L	probably damaging	Het
Adamts9	T	C	6: 92,858,113	T679A	possibly damaging	Het
Ahr	T	C	12: 35,508,194	T276A	probably benign	Het
Akap9	A	T	5: 4,064,136	Q3138H	probably damaging	Het
Armt1	T	A	10: 4,432,689	F7I	probably benign	Het
B3galt2	A	G	1: 143,646,140	R5G	probably damaging	Het
Bod1l	T	C	5: 41,801,233	N2750S	probably benign	Het
Cadps2	T	A	6: 23,583,396	E365V	probably damaging	Het
Cd200r3	T	A	16: 44,957,717		probably null	Het
Cst7	T	A	2: 150,575,886		probably benign	Het
Defb30	A	T	14: 63,049,763		probably benign	Het
Dido1	C	T	2: 180,659,851	G2087S	probably benign	Het
Dio2	A	G	12: 90,738,071	Y72H	probably benign	Het
Dnah11	C	T	12: 117,987,469	E3035K	probably damaging	Het
Dnajb13	T	C	7: 100,503,249	K287E	possibly damaging	Het
Dnajc11	G	A	4: 151,973,628	V244I	possibly damaging	Het
Ect2	C	T	3: 27,139,652	A226T	probably damaging	Het
Ercc8	G	A	13: 108,174,061		probably null	Het
Fam120b	T	A	17: 15,402,927	M389K	probably benign	Het
Fam151a	A	G	4: 106,747,931	M497V	probably benign	Het
Fam186b	C	A	15: 99,280,128	G439V	probably benign	Het
Fank1	A	G	7: 133,876,765	Y185C	probably damaging	Het
Gart	T	C	16: 91,630,602		probably benign	Het
Glb1l	T	C	1: 75,199,720	Y572C	probably damaging	Het
Gm11563	C	T	11: 99,658,437	A164T	unknown	Het
Gnb4	C	T	3: 32,591,207	V112I	probably benign	Het
Gsdmc3	T	A	15: 63,859,693	D330V	probably damaging	Het
H2-DMa	C	T	17: 34,137,960	T144M	probably damaging	Het
Haus6	A	T	4: 86,583,514	F707I	possibly damaging	Het
Hmcn1	T	A	1: 150,594,016	T4971S	probably benign	Het
Ints6	A	T	14: 62,696,759	F766L	probably benign	Het
Kdm5d	T	A	Y: 927,330	M650K	probably damaging	Het
Kif21b	T	C	1: 136,159,428	F881S	possibly damaging	Het
Klrk1	C	A	6: 129,614,635	Q176H	possibly damaging	Het
Ky	T	C	9: 102,537,621	V244A	probably benign	Het
Mia2	T	A	12: 59,154,419	L191M	possibly damaging	Het
Miga2	T	A	2: 30,381,744		probably benign	Het
Mtss1l	C	T	8: 110,737,948	P322S	probably damaging	Het
Nalcn	A	G	14: 123,299,141		probably benign	Het
Ncbp3	T	A	11: 73,049,845		probably benign	Het
Nprl3	G	A	11: 32,234,876	L378F	probably damaging	Het
Ntrk2	A	T	13: 58,846,821	M184L	probably benign	Het
Olfr311	T	G	11: 58,841,443	C110G	probably damaging	Het
Olfr738	G	T	14: 50,413,697	C51F	probably benign	Het
Osbpl9	T	C	4: 109,083,128	E287G	probably damaging	Het
Parva	T	C	7: 112,576,411	F250L	probably damaging	Het
Pcdhb11	C	T	18: 37,421,811	Q65*	probably null	Het
Phtf1	A	G	3: 103,993,765	T377A	probably damaging	Het
Pkp4	G	A	2: 59,322,643	V612I	possibly damaging	Het
Plscr2	C	A	9: 92,287,654	S52R	probably benign	Het
Pnisr	C	T	4: 21,874,092		probably benign	Het
Pole2	A	C	12: 69,209,879	S291A	probably damaging	Het
Ppp2r5d	A	G	17: 46,684,018	F586L	probably benign	Het
Prrx1	G	A	1: 163,257,816	R182C	probably damaging	Het
Ptprs	A	G	17: 56,429,103	I110T	possibly damaging	Het
Rasgrf2	G	A	13: 91,919,817		probably benign	Het
Riox2	T	C	16: 59,491,892	V464A	probably benign	Het
Robo2	A	G	16: 73,967,802	V646A	possibly damaging	Het
Ros1	T	A	10: 52,118,348	I1279F	probably damaging	Het
Snx7	T	C	3: 117,846,675	N62D	probably damaging	Het
Sp100	G	A	1: 85,659,867		probably null	Het
Stil	A	T	4: 115,007,159	I86L	possibly damaging	Het
Tbc1d16	T	A	11: 119,209,038	D170V	probably benign	Het
Tmem2	T	A	19: 21,817,971	S743T	probably benign	Het
Trappc13	G	A	13: 104,161,081	T105M	probably damaging	Het
Trhr	T	A	15: 44,229,500	S378T	probably benign	Het
Ttc7b	T	C	12: 100,500,073		probably null	Het
Vegfc	A	T	8: 54,157,139	Y110F	probably benign	Het
Vmn1r184	C	A	7: 26,267,177	P116H	possibly damaging	Het
Vmn2r5	A	T	3: 64,503,814	C444*	probably null	Het
Zfp341	A	G	2: 154,634,273	E460G	possibly damaging	Het
Zfp819	T	A	7: 43,616,444	V41E	probably benign	Het

Other mutations in Siglec1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Siglec1	APN	2	131079325	missense	probably benign	0.03
IGL01092:Siglec1	APN	2	131079217	missense	probably damaging	1.00
IGL01115:Siglec1	APN	2	131074502	missense	probably benign	0.01
IGL01324:Siglec1	APN	2	131085541	missense	probably damaging	1.00
IGL01330:Siglec1	APN	2	131083536	missense	probably damaging	1.00
IGL01330:Siglec1	APN	2	131075005	nonsense	probably null
IGL01558:Siglec1	APN	2	131078499	missense	probably damaging	0.96
IGL01632:Siglec1	APN	2	131083820	missense	probably benign	0.03
IGL01768:Siglec1	APN	2	131074394	missense	probably benign
IGL02399:Siglec1	APN	2	131071178	missense	probably benign	0.16
IGL02558:Siglec1	APN	2	131074995	missense	possibly damaging	0.88
IGL02794:Siglec1	APN	2	131075969	missense	possibly damaging	0.86
IGL02839:Siglec1	APN	2	131084932	missense	possibly damaging	0.82
aggressor	UTSW	2	131083941	nonsense	probably null
boris	UTSW	2	131079377	nonsense	probably null
espia	UTSW	2	131072744	missense	probably damaging	0.98
hoodlum	UTSW	2	131072747	missense	possibly damaging	0.88
microfische	UTSW	2	131086095	missense	possibly damaging	0.73
K3955:Siglec1	UTSW	2	131081439	missense	probably benign	0.00
P0038:Siglec1	UTSW	2	131081439	missense	probably benign	0.00
PIT4576001:Siglec1	UTSW	2	131078161	missense	probably damaging	1.00
PIT4677001:Siglec1	UTSW	2	131072757	missense	probably damaging	1.00
R0003:Siglec1	UTSW	2	131075060	missense	probably benign	0.00
R0048:Siglec1	UTSW	2	131073397	missense	possibly damaging	0.65
R0048:Siglec1	UTSW	2	131073397	missense	possibly damaging	0.65
R0243:Siglec1	UTSW	2	131085476	missense	probably damaging	1.00
R0276:Siglec1	UTSW	2	131083941	nonsense	probably null
R0379:Siglec1	UTSW	2	131074525	splice site	probably benign
R0464:Siglec1	UTSW	2	131079359	missense	probably damaging	1.00
R0507:Siglec1	UTSW	2	131074525	splice site	probably benign
R0560:Siglec1	UTSW	2	131070346	missense	probably benign	0.02
R0621:Siglec1	UTSW	2	131074268	missense	probably benign	0.30
R0853:Siglec1	UTSW	2	131085022	missense	probably damaging	0.98
R1079:Siglec1	UTSW	2	131079377	nonsense	probably null
R1169:Siglec1	UTSW	2	131074827	missense	probably damaging	0.97
R1205:Siglec1	UTSW	2	131080464	missense	possibly damaging	0.94
R1293:Siglec1	UTSW	2	131073531	missense	probably benign	0.00
R1470:Siglec1	UTSW	2	131070387	missense	probably benign	0.19
R1470:Siglec1	UTSW	2	131070387	missense	probably benign	0.19
R1533:Siglec1	UTSW	2	131076158	missense	probably benign
R1717:Siglec1	UTSW	2	131073956	missense	possibly damaging	0.92
R1717:Siglec1	UTSW	2	131084012	missense	probably damaging	1.00
R1744:Siglec1	UTSW	2	131081299	missense	probably damaging	1.00
R1852:Siglec1	UTSW	2	131081500	missense	probably damaging	0.98
R1941:Siglec1	UTSW	2	131078131	missense	possibly damaging	0.94
R2011:Siglec1	UTSW	2	131083357	missense	probably damaging	1.00
R2012:Siglec1	UTSW	2	131083357	missense	probably damaging	1.00
R2128:Siglec1	UTSW	2	131080497	missense	probably damaging	1.00
R2278:Siglec1	UTSW	2	131071337	missense	probably benign	0.28
R2403:Siglec1	UTSW	2	131074475	missense	possibly damaging	0.65
R2449:Siglec1	UTSW	2	131078725	missense	probably benign	0.44
R2885:Siglec1	UTSW	2	131072747	missense	possibly damaging	0.88
R4213:Siglec1	UTSW	2	131074118	missense	probably damaging	1.00
R4274:Siglec1	UTSW	2	131085814	missense	probably benign	0.00
R4679:Siglec1	UTSW	2	131073411	missense	possibly damaging	0.87
R4715:Siglec1	UTSW	2	131074436	missense	probably damaging	1.00
R4782:Siglec1	UTSW	2	131075923	missense	probably damaging	1.00
R4896:Siglec1	UTSW	2	131069869	missense	probably benign	0.21
R4993:Siglec1	UTSW	2	131073361	missense	possibly damaging	0.93
R5004:Siglec1	UTSW	2	131069869	missense	probably benign	0.21
R5004:Siglec1	UTSW	2	131073411	missense	possibly damaging	0.87
R5105:Siglec1	UTSW	2	131080400	missense	possibly damaging	0.69
R5137:Siglec1	UTSW	2	131081344	missense	probably damaging	1.00
R5153:Siglec1	UTSW	2	131085577	missense	probably damaging	0.99
R5311:Siglec1	UTSW	2	131079316	missense	probably damaging	1.00
R5600:Siglec1	UTSW	2	131085583	missense	probably benign	0.01
R5682:Siglec1	UTSW	2	131084010	missense	probably damaging	1.00
R5732:Siglec1	UTSW	2	131074268	missense	probably benign	0.30
R5870:Siglec1	UTSW	2	131072847	missense	probably damaging	0.99
R5898:Siglec1	UTSW	2	131073633	missense	probably damaging	1.00
R5909:Siglec1	UTSW	2	131077964	missense	probably damaging	1.00
R6488:Siglec1	UTSW	2	131081307	missense	probably damaging	0.99
R6920:Siglec1	UTSW	2	131078077	nonsense	probably null
R7064:Siglec1	UTSW	2	131083914	missense	probably benign	0.00
R7270:Siglec1	UTSW	2	131081551	missense	possibly damaging	0.67
R7355:Siglec1	UTSW	2	131080451	missense	probably benign	0.02
R7400:Siglec1	UTSW	2	131086095	missense	possibly damaging	0.73
R7470:Siglec1	UTSW	2	131075824	missense	probably benign	0.00
R7568:Siglec1	UTSW	2	131072682	missense	probably damaging	1.00
R7781:Siglec1	UTSW	2	131081338	missense	probably damaging	1.00
R7853:Siglec1	UTSW	2	131081292	missense	probably damaging	1.00
R7999:Siglec1	UTSW	2	131071163	missense	probably benign	0.28
R8191:Siglec1	UTSW	2	131085679	missense	probably damaging	1.00
R8274:Siglec1	UTSW	2	131083910	missense	probably benign
R8345:Siglec1	UTSW	2	131078578	missense	possibly damaging	0.95
R8670:Siglec1	UTSW	2	131081467	missense	probably damaging	1.00
R8814:Siglec1	UTSW	2	131072744	missense	probably damaging	0.98
R9102:Siglec1	UTSW	2	131073469	missense	probably benign	0.01
R9311:Siglec1	UTSW	2	131074093	missense	probably damaging	1.00
R9416:Siglec1	UTSW	2	131083470	missense	probably benign	0.01
X0024:Siglec1	UTSW	2	131080491	missense	probably damaging	1.00
Z1176:Siglec1	UTSW	2	131078745	missense	probably damaging	0.99
Z1176:Siglec1	UTSW	2	131080524	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- GGCCATTGTGAAACCAGGCATAGAG -3'
(R):5'- GTGGTAGTTCCAGCACCATGTGAAG -3'

Sequencing Primer
(F):5'- GTCCTCGCAGGTCACTG -3'
(R):5'- GCAAACTGGTCTCTGTGTAAC -3'

Posted On

2013-07-11