Incidental Mutation 'R0620:Siglec1'
ID 58578
Institutional Source Beutler Lab
Gene Symbol Siglec1
Ensembl Gene ENSMUSG00000027322
Gene Name sialic acid binding Ig-like lectin 1, sialoadhesin
Synonyms Sn, CD169, Siglec-1
MMRRC Submission 038809-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock # R0620 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 131069220-131086765 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 131074268 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 1254 (T1254M)
Ref Sequence ENSEMBL: ENSMUSP00000028794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028794] [ENSMUST00000110227]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000028794
AA Change: T1254M

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000028794
Gene: ENSMUSG00000027322
AA Change: T1254M

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 32 142 2.92e-5 SMART
Pfam:C2-set_2 148 235 9.4e-18 PFAM
IGc2 260 319 8.78e-9 SMART
IGc2 344 404 4.07e-4 SMART
IGc2 431 505 3.3e-4 SMART
IGc2 529 589 5.75e-4 SMART
IGc2 622 698 3.54e-4 SMART
low complexity region 700 705 N/A INTRINSIC
IG 716 795 3.35e-5 SMART
IG 804 896 6.51e-3 SMART
IGc2 909 969 4.13e-5 SMART
IG_like 1001 1076 6.78e-2 SMART
low complexity region 1077 1088 N/A INTRINSIC
IG 1094 1171 4.32e-8 SMART
IG_like 1185 1250 1.94e-2 SMART
IG 1268 1345 1.36e-5 SMART
IG_like 1354 1447 1.45e1 SMART
IG_like 1365 1435 4.51e-2 SMART
IG 1454 1534 4.56e-7 SMART
IG_like 1549 1624 1.21e-1 SMART
transmembrane domain 1647 1669 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110227
AA Change: T1254M

PolyPhen 2 Score 0.281 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000105856
Gene: ENSMUSG00000027322
AA Change: T1254M

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 32 142 2.92e-5 SMART
Pfam:C2-set_2 148 235 7e-17 PFAM
IGc2 260 319 8.78e-9 SMART
IGc2 344 404 4.07e-4 SMART
IGc2 431 505 3.3e-4 SMART
IGc2 529 589 5.75e-4 SMART
IGc2 622 698 3.54e-4 SMART
low complexity region 700 705 N/A INTRINSIC
IG 716 795 3.35e-5 SMART
IG 804 896 6.51e-3 SMART
IGc2 909 969 4.13e-5 SMART
IG_like 1001 1076 6.78e-2 SMART
low complexity region 1077 1088 N/A INTRINSIC
IG 1094 1171 4.32e-8 SMART
IG_like 1185 1250 1.94e-2 SMART
IG 1268 1345 1.36e-5 SMART
IG_like 1354 1447 1.45e1 SMART
IG_like 1365 1435 4.51e-2 SMART
IG 1454 1534 4.56e-7 SMART
Meta Mutation Damage Score 0.1316 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin superfamily. The encoded protein is a lectin-like adhesion molecule that binds glycoconjugate ligands on cell surfaces in a sialic acid-dependent manner. It is a type I transmembrane protein expressed only by a subpopulation of macrophages and is involved in mediating cell-cell interactions. Alternative splicing produces a transcript variant encoding an isoform that is soluble rather than membrane-bound; however, the full-length nature of this variant has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene display subtle changes in B- and T-cell populations and decreased IgM levels. Mice homozygous for a knock-out or knock-in allele exhibit impaired phagocytosis of sialylated C. jejuni. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,328,375 Q973L probably damaging Het
Adamts9 T C 6: 92,858,113 T679A possibly damaging Het
Ahr T C 12: 35,508,194 T276A probably benign Het
Akap9 A T 5: 4,064,136 Q3138H probably damaging Het
Armt1 T A 10: 4,432,689 F7I probably benign Het
B3galt2 A G 1: 143,646,140 R5G probably damaging Het
Bod1l T C 5: 41,801,233 N2750S probably benign Het
Cadps2 T A 6: 23,583,396 E365V probably damaging Het
Cd200r3 T A 16: 44,957,717 probably null Het
Cst7 T A 2: 150,575,886 probably benign Het
Defb30 A T 14: 63,049,763 probably benign Het
Dido1 C T 2: 180,659,851 G2087S probably benign Het
Dio2 A G 12: 90,738,071 Y72H probably benign Het
Dnah11 C T 12: 117,987,469 E3035K probably damaging Het
Dnajb13 T C 7: 100,503,249 K287E possibly damaging Het
Dnajc11 G A 4: 151,973,628 V244I possibly damaging Het
Ect2 C T 3: 27,139,652 A226T probably damaging Het
Ercc8 G A 13: 108,174,061 probably null Het
Fam120b T A 17: 15,402,927 M389K probably benign Het
Fam151a A G 4: 106,747,931 M497V probably benign Het
Fam186b C A 15: 99,280,128 G439V probably benign Het
Fank1 A G 7: 133,876,765 Y185C probably damaging Het
Gart T C 16: 91,630,602 probably benign Het
Glb1l T C 1: 75,199,720 Y572C probably damaging Het
Gm11563 C T 11: 99,658,437 A164T unknown Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
Gsdmc3 T A 15: 63,859,693 D330V probably damaging Het
H2-DMa C T 17: 34,137,960 T144M probably damaging Het
Haus6 A T 4: 86,583,514 F707I possibly damaging Het
Hmcn1 T A 1: 150,594,016 T4971S probably benign Het
Ints6 A T 14: 62,696,759 F766L probably benign Het
Kdm5d T A Y: 927,330 M650K probably damaging Het
Kif21b T C 1: 136,159,428 F881S possibly damaging Het
Klrk1 C A 6: 129,614,635 Q176H possibly damaging Het
Ky T C 9: 102,537,621 V244A probably benign Het
Mia2 T A 12: 59,154,419 L191M possibly damaging Het
Miga2 T A 2: 30,381,744 probably benign Het
Mtss1l C T 8: 110,737,948 P322S probably damaging Het
Nalcn A G 14: 123,299,141 probably benign Het
Ncbp3 T A 11: 73,049,845 probably benign Het
Nprl3 G A 11: 32,234,876 L378F probably damaging Het
Ntrk2 A T 13: 58,846,821 M184L probably benign Het
Olfr311 T G 11: 58,841,443 C110G probably damaging Het
Olfr738 G T 14: 50,413,697 C51F probably benign Het
Osbpl9 T C 4: 109,083,128 E287G probably damaging Het
Parva T C 7: 112,576,411 F250L probably damaging Het
Pcdhb11 C T 18: 37,421,811 Q65* probably null Het
Phtf1 A G 3: 103,993,765 T377A probably damaging Het
Pkp4 G A 2: 59,322,643 V612I possibly damaging Het
Plscr2 C A 9: 92,287,654 S52R probably benign Het
Pnisr C T 4: 21,874,092 probably benign Het
Pole2 A C 12: 69,209,879 S291A probably damaging Het
Ppp2r5d A G 17: 46,684,018 F586L probably benign Het
Prrx1 G A 1: 163,257,816 R182C probably damaging Het
Ptprs A G 17: 56,429,103 I110T possibly damaging Het
Rasgrf2 G A 13: 91,919,817 probably benign Het
Riox2 T C 16: 59,491,892 V464A probably benign Het
Robo2 A G 16: 73,967,802 V646A possibly damaging Het
Ros1 T A 10: 52,118,348 I1279F probably damaging Het
Snx7 T C 3: 117,846,675 N62D probably damaging Het
Sp100 G A 1: 85,659,867 probably null Het
Stil A T 4: 115,007,159 I86L possibly damaging Het
Tbc1d16 T A 11: 119,209,038 D170V probably benign Het
Tmem2 T A 19: 21,817,971 S743T probably benign Het
Trappc13 G A 13: 104,161,081 T105M probably damaging Het
Trhr T A 15: 44,229,500 S378T probably benign Het
Ttc7b T C 12: 100,500,073 probably null Het
Vegfc A T 8: 54,157,139 Y110F probably benign Het
Vmn1r184 C A 7: 26,267,177 P116H possibly damaging Het
Vmn2r5 A T 3: 64,503,814 C444* probably null Het
Zfp341 A G 2: 154,634,273 E460G possibly damaging Het
Zfp819 T A 7: 43,616,444 V41E probably benign Het
Other mutations in Siglec1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Siglec1 APN 2 131079325 missense probably benign 0.03
IGL01092:Siglec1 APN 2 131079217 missense probably damaging 1.00
IGL01115:Siglec1 APN 2 131074502 missense probably benign 0.01
IGL01324:Siglec1 APN 2 131085541 missense probably damaging 1.00
IGL01330:Siglec1 APN 2 131083536 missense probably damaging 1.00
IGL01330:Siglec1 APN 2 131075005 nonsense probably null
IGL01558:Siglec1 APN 2 131078499 missense probably damaging 0.96
IGL01632:Siglec1 APN 2 131083820 missense probably benign 0.03
IGL01768:Siglec1 APN 2 131074394 missense probably benign
IGL02399:Siglec1 APN 2 131071178 missense probably benign 0.16
IGL02558:Siglec1 APN 2 131074995 missense possibly damaging 0.88
IGL02794:Siglec1 APN 2 131075969 missense possibly damaging 0.86
IGL02839:Siglec1 APN 2 131084932 missense possibly damaging 0.82
aggressor UTSW 2 131083941 nonsense probably null
boris UTSW 2 131079377 nonsense probably null
espia UTSW 2 131072744 missense probably damaging 0.98
hoodlum UTSW 2 131072747 missense possibly damaging 0.88
microfische UTSW 2 131086095 missense possibly damaging 0.73
K3955:Siglec1 UTSW 2 131081439 missense probably benign 0.00
P0038:Siglec1 UTSW 2 131081439 missense probably benign 0.00
PIT4576001:Siglec1 UTSW 2 131078161 missense probably damaging 1.00
PIT4677001:Siglec1 UTSW 2 131072757 missense probably damaging 1.00
R0003:Siglec1 UTSW 2 131075060 missense probably benign 0.00
R0048:Siglec1 UTSW 2 131073397 missense possibly damaging 0.65
R0048:Siglec1 UTSW 2 131073397 missense possibly damaging 0.65
R0243:Siglec1 UTSW 2 131085476 missense probably damaging 1.00
R0276:Siglec1 UTSW 2 131083941 nonsense probably null
R0379:Siglec1 UTSW 2 131074525 splice site probably benign
R0464:Siglec1 UTSW 2 131079359 missense probably damaging 1.00
R0507:Siglec1 UTSW 2 131074525 splice site probably benign
R0560:Siglec1 UTSW 2 131070346 missense probably benign 0.02
R0621:Siglec1 UTSW 2 131074268 missense probably benign 0.30
R0853:Siglec1 UTSW 2 131085022 missense probably damaging 0.98
R1079:Siglec1 UTSW 2 131079377 nonsense probably null
R1169:Siglec1 UTSW 2 131074827 missense probably damaging 0.97
R1205:Siglec1 UTSW 2 131080464 missense possibly damaging 0.94
R1293:Siglec1 UTSW 2 131073531 missense probably benign 0.00
R1470:Siglec1 UTSW 2 131070387 missense probably benign 0.19
R1470:Siglec1 UTSW 2 131070387 missense probably benign 0.19
R1533:Siglec1 UTSW 2 131076158 missense probably benign
R1717:Siglec1 UTSW 2 131073956 missense possibly damaging 0.92
R1717:Siglec1 UTSW 2 131084012 missense probably damaging 1.00
R1744:Siglec1 UTSW 2 131081299 missense probably damaging 1.00
R1852:Siglec1 UTSW 2 131081500 missense probably damaging 0.98
R1941:Siglec1 UTSW 2 131078131 missense possibly damaging 0.94
R2011:Siglec1 UTSW 2 131083357 missense probably damaging 1.00
R2012:Siglec1 UTSW 2 131083357 missense probably damaging 1.00
R2128:Siglec1 UTSW 2 131080497 missense probably damaging 1.00
R2278:Siglec1 UTSW 2 131071337 missense probably benign 0.28
R2403:Siglec1 UTSW 2 131074475 missense possibly damaging 0.65
R2449:Siglec1 UTSW 2 131078725 missense probably benign 0.44
R2885:Siglec1 UTSW 2 131072747 missense possibly damaging 0.88
R4213:Siglec1 UTSW 2 131074118 missense probably damaging 1.00
R4274:Siglec1 UTSW 2 131085814 missense probably benign 0.00
R4679:Siglec1 UTSW 2 131073411 missense possibly damaging 0.87
R4715:Siglec1 UTSW 2 131074436 missense probably damaging 1.00
R4782:Siglec1 UTSW 2 131075923 missense probably damaging 1.00
R4896:Siglec1 UTSW 2 131069869 missense probably benign 0.21
R4993:Siglec1 UTSW 2 131073361 missense possibly damaging 0.93
R5004:Siglec1 UTSW 2 131069869 missense probably benign 0.21
R5004:Siglec1 UTSW 2 131073411 missense possibly damaging 0.87
R5105:Siglec1 UTSW 2 131080400 missense possibly damaging 0.69
R5137:Siglec1 UTSW 2 131081344 missense probably damaging 1.00
R5153:Siglec1 UTSW 2 131085577 missense probably damaging 0.99
R5311:Siglec1 UTSW 2 131079316 missense probably damaging 1.00
R5600:Siglec1 UTSW 2 131085583 missense probably benign 0.01
R5682:Siglec1 UTSW 2 131084010 missense probably damaging 1.00
R5732:Siglec1 UTSW 2 131074268 missense probably benign 0.30
R5870:Siglec1 UTSW 2 131072847 missense probably damaging 0.99
R5898:Siglec1 UTSW 2 131073633 missense probably damaging 1.00
R5909:Siglec1 UTSW 2 131077964 missense probably damaging 1.00
R6488:Siglec1 UTSW 2 131081307 missense probably damaging 0.99
R6920:Siglec1 UTSW 2 131078077 nonsense probably null
R7064:Siglec1 UTSW 2 131083914 missense probably benign 0.00
R7270:Siglec1 UTSW 2 131081551 missense possibly damaging 0.67
R7355:Siglec1 UTSW 2 131080451 missense probably benign 0.02
R7400:Siglec1 UTSW 2 131086095 missense possibly damaging 0.73
R7470:Siglec1 UTSW 2 131075824 missense probably benign 0.00
R7568:Siglec1 UTSW 2 131072682 missense probably damaging 1.00
R7781:Siglec1 UTSW 2 131081338 missense probably damaging 1.00
R7853:Siglec1 UTSW 2 131081292 missense probably damaging 1.00
R7999:Siglec1 UTSW 2 131071163 missense probably benign 0.28
R8191:Siglec1 UTSW 2 131085679 missense probably damaging 1.00
R8274:Siglec1 UTSW 2 131083910 missense probably benign
R8345:Siglec1 UTSW 2 131078578 missense possibly damaging 0.95
R8670:Siglec1 UTSW 2 131081467 missense probably damaging 1.00
R8814:Siglec1 UTSW 2 131072744 missense probably damaging 0.98
R9102:Siglec1 UTSW 2 131073469 missense probably benign 0.01
R9311:Siglec1 UTSW 2 131074093 missense probably damaging 1.00
R9416:Siglec1 UTSW 2 131083470 missense probably benign 0.01
X0024:Siglec1 UTSW 2 131080491 missense probably damaging 1.00
Z1176:Siglec1 UTSW 2 131078745 missense probably damaging 0.99
Z1176:Siglec1 UTSW 2 131080524 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GGCCATTGTGAAACCAGGCATAGAG -3'
(R):5'- GTGGTAGTTCCAGCACCATGTGAAG -3'

Sequencing Primer
(F):5'- GTCCTCGCAGGTCACTG -3'
(R):5'- GCAAACTGGTCTCTGTGTAAC -3'
Posted On 2013-07-11