Incidental Mutation 'R7571:Flg2'
ID 585794
Institutional Source Beutler Lab
Gene Symbol Flg2
Ensembl Gene ENSMUSG00000049133
Gene Name filaggrin family member 2
Synonyms EG229574
MMRRC Submission 045711-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R7571 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 93104585-93128698 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 93127303 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Stop codon at position 2072 (G2072*)
Ref Sequence ENSEMBL: ENSMUSP00000096482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098884]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000098884
AA Change: G2072*
SMART Domains Protein: ENSMUSP00000096482
Gene: ENSMUSG00000049133
AA Change: G2072*

DomainStartEndE-ValueType
Pfam:S_100 4 46 1.2e-17 PFAM
low complexity region 58 70 N/A INTRINSIC
low complexity region 110 121 N/A INTRINSIC
low complexity region 131 146 N/A INTRINSIC
low complexity region 207 223 N/A INTRINSIC
internal_repeat_2 230 347 7.36e-7 PROSPERO
internal_repeat_2 349 466 7.36e-7 PROSPERO
internal_repeat_3 366 392 6.93e-6 PROSPERO
internal_repeat_6 419 471 4.17e-5 PROSPERO
low complexity region 474 550 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 593 679 N/A INTRINSIC
low complexity region 680 705 N/A INTRINSIC
low complexity region 719 748 N/A INTRINSIC
low complexity region 749 768 N/A INTRINSIC
low complexity region 772 800 N/A INTRINSIC
internal_repeat_5 804 825 4.17e-5 PROSPERO
internal_repeat_3 810 836 6.93e-6 PROSPERO
low complexity region 846 860 N/A INTRINSIC
low complexity region 863 885 N/A INTRINSIC
internal_repeat_5 895 919 4.17e-5 PROSPERO
internal_repeat_4 899 939 1.7e-5 PROSPERO
internal_repeat_1 944 1461 8.08e-127 PROSPERO
internal_repeat_6 1335 1386 4.17e-5 PROSPERO
low complexity region 1465 1485 N/A INTRINSIC
internal_repeat_1 1486 2009 8.08e-127 PROSPERO
internal_repeat_4 2123 2173 1.7e-5 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,119,211 (GRCm39) N985I probably benign Het
Abi3bp T A 16: 56,451,345 (GRCm39) probably null Het
Acad12 A T 5: 121,745,257 (GRCm39) Y309* probably null Het
Acadsb G T 7: 131,045,283 (GRCm39) R405L probably damaging Het
Acan G A 7: 78,736,015 (GRCm39) V154M probably damaging Het
Adam22 G A 5: 8,132,160 (GRCm39) R894* probably null Het
Ahnak A T 19: 8,978,150 (GRCm39) K90* probably null Het
Ak4 T C 4: 101,317,739 (GRCm39) I103T probably benign Het
Ap4e1 C T 2: 126,861,256 (GRCm39) L132F probably damaging Het
Apol7b C T 15: 77,307,677 (GRCm39) V273I probably benign Het
Arhgef37 T A 18: 61,637,403 (GRCm39) I420F probably damaging Het
Atg13 C T 2: 91,510,687 (GRCm39) probably null Het
Bach1 G A 16: 87,516,179 (GRCm39) R240Q probably benign Het
Cabin1 A T 10: 75,482,500 (GRCm39) S2148T probably damaging Het
Cacna1i T C 15: 80,259,537 (GRCm39) V1269A probably damaging Het
Cdipt T C 7: 126,578,794 (GRCm39) I195T probably benign Het
Ces2b A T 8: 105,561,641 (GRCm39) H245L probably damaging Het
Cimip2c A T 5: 30,639,502 (GRCm39) E143V possibly damaging Het
Clstn1 T G 4: 149,730,744 (GRCm39) M825R probably benign Het
Cntn3 G A 6: 102,255,364 (GRCm39) T178I probably damaging Het
Col7a1 A G 9: 108,811,775 (GRCm39) M2789V probably null Het
Col9a2 A T 4: 120,896,981 (GRCm39) I24F unknown Het
Cpne2 T C 8: 95,278,408 (GRCm39) M134T probably benign Het
Cpt1b A G 15: 89,305,546 (GRCm39) probably null Het
Crocc T C 4: 140,773,360 (GRCm39) probably null Het
Cts8 T C 13: 61,395,981 (GRCm39) Y330C probably damaging Het
Cwc22 T C 2: 77,747,411 (GRCm39) D434G probably benign Het
Cyp3a13 T C 5: 137,897,125 (GRCm39) I396M possibly damaging Het
Ddr2 A T 1: 169,829,420 (GRCm39) I278N probably benign Het
Dnaaf5 A G 5: 139,155,963 (GRCm39) E548G possibly damaging Het
Dync2h1 A G 9: 7,002,623 (GRCm39) L3808P probably damaging Het
Faf2 T A 13: 54,798,027 (GRCm39) W209R probably damaging Het
Fbln2 A T 6: 91,245,557 (GRCm39) E992D probably damaging Het
Fdxacb1 T A 9: 50,683,093 (GRCm39) V352D probably damaging Het
Flii A T 11: 60,611,962 (GRCm39) L347Q probably damaging Het
Fndc3a A T 14: 72,827,336 (GRCm39) H116Q probably damaging Het
Fnta A T 8: 26,505,493 (GRCm39) M39K probably benign Het
Gabra4 A G 5: 71,729,335 (GRCm39) S482P probably benign Het
Gapdhs G A 7: 30,437,383 (GRCm39) P61S unknown Het
Gm10153 A T 7: 141,743,401 (GRCm39) C242* probably null Het
Gp1ba A G 11: 70,530,920 (GRCm39) I229V unknown Het
Grap2 T A 15: 80,527,905 (GRCm39) L117Q probably damaging Het
Grik5 A G 7: 24,713,310 (GRCm39) I766T possibly damaging Het
Hrh3 A T 2: 179,743,079 (GRCm39) I183N probably damaging Het
Htr5a C A 5: 28,047,893 (GRCm39) Y149* probably null Het
Ibtk T C 9: 85,604,353 (GRCm39) I527V probably benign Het
Il33 T A 19: 29,934,341 (GRCm39) S184R probably damaging Het
Kansl3 T A 1: 36,404,668 (GRCm39) Q94L possibly damaging Het
Katnip C T 7: 125,307,193 (GRCm39) probably benign Het
Kcnh6 A G 11: 105,908,242 (GRCm39) D286G probably benign Het
Kmt2e T A 5: 23,683,585 (GRCm39) M281K probably damaging Het
Lrp2 T A 2: 69,346,747 (GRCm39) H833L probably damaging Het
Meis1 A T 11: 18,891,702 (GRCm39) V282E probably damaging Het
Mfsd8 T G 3: 40,785,097 (GRCm39) D240A probably damaging Het
Muc5b A G 7: 141,400,986 (GRCm39) T534A unknown Het
Myo18b G A 5: 112,978,194 (GRCm39) L1243F probably damaging Het
Nefl A G 14: 68,322,123 (GRCm39) I238V probably benign Het
Nexn T A 3: 151,959,284 (GRCm39) I62F possibly damaging Het
Niban1 T C 1: 151,594,048 (GRCm39) V911A probably benign Het
Notch4 T C 17: 34,802,548 (GRCm39) L1323P probably damaging Het
Or51h1 T C 7: 102,308,258 (GRCm39) S77P probably damaging Het
Or5p68 A T 7: 107,945,689 (GRCm39) F166L probably benign Het
Or8b1 T C 9: 38,399,952 (GRCm39) V209A probably benign Het
Patj C A 4: 98,457,217 (GRCm39) H1244N probably damaging Het
Peg10 T A 6: 4,756,082 (GRCm39) D219E unknown Het
Pi4kb G T 3: 94,906,425 (GRCm39) probably null Het
Piezo1 A G 8: 123,225,157 (GRCm39) F614S Het
Pisd T A 5: 32,894,681 (GRCm39) N372Y probably damaging Het
Piwil4 T C 9: 14,645,893 (GRCm39) D178G probably benign Het
Plekho1 G T 3: 95,896,566 (GRCm39) P301Q probably damaging Het
Pop1 T A 15: 34,529,093 (GRCm39) W738R probably null Het
Ppp4r1 C T 17: 66,117,611 (GRCm39) P125L possibly damaging Het
Pramel48 A T 5: 95,630,819 (GRCm39) N232I probably damaging Het
Prdm9 T A 17: 15,783,526 (GRCm39) N13I probably damaging Het
Psd4 T G 2: 24,297,023 (GRCm39) V932G probably damaging Het
Ptger3 T C 3: 157,347,412 (GRCm39) S355P probably benign Het
Ptprb T C 10: 116,175,335 (GRCm39) V823A probably damaging Het
Ptprj C T 2: 90,285,530 (GRCm39) V841I probably benign Het
Ranbp3 T C 17: 57,014,923 (GRCm39) S281P probably benign Het
Rasal3 T A 17: 32,614,835 (GRCm39) M541L possibly damaging Het
Rassf1 A G 9: 107,428,982 (GRCm39) T63A possibly damaging Het
Rcor3 C A 1: 191,822,173 (GRCm39) G8V probably damaging Het
Rgs4 G A 1: 169,571,927 (GRCm39) T124I probably damaging Het
Rspo2 T A 15: 43,033,372 (GRCm39) probably benign Het
Scgn T C 13: 24,137,897 (GRCm39) D258G probably damaging Het
Shkbp1 A G 7: 27,046,556 (GRCm39) S403P possibly damaging Het
Slc25a13 A G 6: 6,052,785 (GRCm39) L525P probably damaging Het
Snd1 G T 6: 28,526,202 (GRCm39) K193N possibly damaging Het
Sntg2 C T 12: 30,225,201 (GRCm39) A516T probably damaging Het
Stard13 A G 5: 150,982,967 (GRCm39) I699T probably damaging Het
Svil T A 18: 5,114,636 (GRCm39) V1984D probably damaging Het
Swt1 A G 1: 151,270,470 (GRCm39) S582P probably benign Het
Sypl2 A G 3: 108,121,854 (GRCm39) *265Q probably null Het
Taar8a T A 10: 23,953,306 (GRCm39) Y303* probably null Het
Tasor2 T C 13: 3,625,292 (GRCm39) T1553A probably benign Het
Tlr2 T A 3: 83,743,849 (GRCm39) I745F probably damaging Het
Tnrc6b A G 15: 80,813,594 (GRCm39) T1784A probably benign Het
Tpo C A 12: 30,169,431 (GRCm39) M101I probably benign Het
Trpm2 G T 10: 77,773,784 (GRCm39) R544S probably benign Het
Ttc14 A G 3: 33,863,400 (GRCm39) R603G unknown Het
Tubgcp6 A C 15: 88,984,925 (GRCm39) V1694G probably damaging Het
Uba6 C A 5: 86,294,970 (GRCm39) K356N probably benign Het
Usp16 T C 16: 87,261,723 (GRCm39) V113A possibly damaging Het
Vcam1 G A 3: 115,908,032 (GRCm39) Q677* probably null Het
Vmn1r238 T A 18: 3,122,721 (GRCm39) E231V probably damaging Het
Vmn1r70 T C 7: 10,367,871 (GRCm39) F120L probably benign Het
Vmn2r116 T A 17: 23,603,830 (GRCm39) probably null Het
Vmn2r5 A T 3: 64,411,825 (GRCm39) C248S probably damaging Het
Vmn2r87 A T 10: 130,314,940 (GRCm39) D215E probably damaging Het
Xkr4 T G 1: 3,740,911 (GRCm39) I221L probably benign Het
Zfp366 T C 13: 99,382,895 (GRCm39) I686T probably benign Het
Zfp398 T A 6: 47,843,666 (GRCm39) C573S probably damaging Het
Other mutations in Flg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Flg2 APN 3 93,109,416 (GRCm39) nonsense probably null
IGL00092:Flg2 APN 3 93,127,162 (GRCm39) missense possibly damaging 0.90
IGL00985:Flg2 APN 3 93,110,585 (GRCm39) missense unknown
IGL01077:Flg2 APN 3 93,127,513 (GRCm39) missense unknown
IGL01093:Flg2 APN 3 93,109,678 (GRCm39) missense unknown
IGL01120:Flg2 APN 3 93,108,475 (GRCm39) missense probably damaging 0.99
IGL01473:Flg2 APN 3 93,110,327 (GRCm39) missense unknown
IGL01584:Flg2 APN 3 93,122,777 (GRCm39) missense unknown
IGL01584:Flg2 APN 3 93,120,773 (GRCm39) missense unknown
IGL01686:Flg2 APN 3 93,109,591 (GRCm39) missense unknown
IGL02207:Flg2 APN 3 93,127,435 (GRCm39) missense unknown
IGL02294:Flg2 APN 3 93,111,053 (GRCm39) missense unknown
IGL02418:Flg2 APN 3 93,108,361 (GRCm39) missense probably benign 0.26
IGL02581:Flg2 APN 3 93,127,199 (GRCm39) missense unknown
IGL02719:Flg2 APN 3 93,127,438 (GRCm39) nonsense probably null
IGL02795:Flg2 APN 3 93,110,920 (GRCm39) missense unknown
IGL02893:Flg2 APN 3 93,110,920 (GRCm39) missense unknown
IGL02958:Flg2 APN 3 93,110,920 (GRCm39) missense unknown
IGL03060:Flg2 APN 3 93,110,920 (GRCm39) missense unknown
IGL03088:Flg2 APN 3 93,110,498 (GRCm39) missense unknown
IGL03165:Flg2 APN 3 93,121,918 (GRCm39) missense unknown
IGL03342:Flg2 APN 3 93,108,542 (GRCm39) missense probably damaging 1.00
IGL03352:Flg2 APN 3 93,109,801 (GRCm39) missense unknown
IGL02796:Flg2 UTSW 3 93,110,920 (GRCm39) missense unknown
IGL02837:Flg2 UTSW 3 93,109,044 (GRCm39) missense probably damaging 1.00
PIT4618001:Flg2 UTSW 3 93,111,088 (GRCm39) missense unknown
R0087:Flg2 UTSW 3 93,109,738 (GRCm39) missense unknown
R0233:Flg2 UTSW 3 93,109,104 (GRCm39) nonsense probably null
R0233:Flg2 UTSW 3 93,109,104 (GRCm39) nonsense probably null
R0315:Flg2 UTSW 3 93,122,029 (GRCm39) missense unknown
R0390:Flg2 UTSW 3 93,107,662 (GRCm39) splice site probably benign
R0462:Flg2 UTSW 3 93,108,744 (GRCm39) missense probably benign 0.18
R0553:Flg2 UTSW 3 93,110,891 (GRCm39) missense unknown
R0828:Flg2 UTSW 3 93,110,639 (GRCm39) missense unknown
R1006:Flg2 UTSW 3 93,108,514 (GRCm39) missense probably benign 0.41
R1444:Flg2 UTSW 3 93,109,620 (GRCm39) missense unknown
R1497:Flg2 UTSW 3 93,127,076 (GRCm39) missense unknown
R1518:Flg2 UTSW 3 93,110,445 (GRCm39) missense unknown
R1737:Flg2 UTSW 3 93,110,928 (GRCm39) missense unknown
R1780:Flg2 UTSW 3 93,110,306 (GRCm39) missense unknown
R1797:Flg2 UTSW 3 93,108,283 (GRCm39) missense probably damaging 1.00
R2065:Flg2 UTSW 3 93,109,538 (GRCm39) missense unknown
R2168:Flg2 UTSW 3 93,109,244 (GRCm39) missense probably damaging 1.00
R2220:Flg2 UTSW 3 93,109,492 (GRCm39) missense unknown
R2292:Flg2 UTSW 3 93,127,984 (GRCm39) missense unknown
R2327:Flg2 UTSW 3 93,110,913 (GRCm39) nonsense probably null
R2512:Flg2 UTSW 3 93,109,082 (GRCm39) missense probably damaging 1.00
R3177:Flg2 UTSW 3 93,122,195 (GRCm39) missense unknown
R3277:Flg2 UTSW 3 93,122,195 (GRCm39) missense unknown
R3522:Flg2 UTSW 3 93,127,334 (GRCm39) missense unknown
R3779:Flg2 UTSW 3 93,109,730 (GRCm39) missense unknown
R3926:Flg2 UTSW 3 93,110,522 (GRCm39) missense unknown
R4082:Flg2 UTSW 3 93,110,828 (GRCm39) missense unknown
R4407:Flg2 UTSW 3 93,122,176 (GRCm39) missense unknown
R5152:Flg2 UTSW 3 93,122,284 (GRCm39) missense unknown
R5253:Flg2 UTSW 3 93,108,119 (GRCm39) missense probably damaging 1.00
R5290:Flg2 UTSW 3 93,127,873 (GRCm39) missense unknown
R5464:Flg2 UTSW 3 93,109,277 (GRCm39) missense possibly damaging 0.73
R5539:Flg2 UTSW 3 93,127,753 (GRCm39) missense unknown
R5622:Flg2 UTSW 3 93,109,871 (GRCm39) missense unknown
R5788:Flg2 UTSW 3 93,108,296 (GRCm39) missense probably benign 0.41
R5792:Flg2 UTSW 3 93,110,804 (GRCm39) missense unknown
R5831:Flg2 UTSW 3 93,107,541 (GRCm39) missense probably damaging 1.00
R5877:Flg2 UTSW 3 93,110,756 (GRCm39) missense unknown
R6041:Flg2 UTSW 3 93,127,668 (GRCm39) missense probably benign 0.01
R6189:Flg2 UTSW 3 93,127,381 (GRCm39) missense unknown
R6214:Flg2 UTSW 3 93,109,166 (GRCm39) missense possibly damaging 0.83
R6215:Flg2 UTSW 3 93,109,166 (GRCm39) missense possibly damaging 0.83
R6239:Flg2 UTSW 3 93,108,579 (GRCm39) missense probably benign 0.36
R6288:Flg2 UTSW 3 93,111,092 (GRCm39) missense unknown
R6413:Flg2 UTSW 3 93,127,683 (GRCm39) missense unknown
R6457:Flg2 UTSW 3 93,127,789 (GRCm39) missense unknown
R6468:Flg2 UTSW 3 93,121,728 (GRCm39) missense unknown
R6667:Flg2 UTSW 3 93,109,068 (GRCm39) missense possibly damaging 0.88
R6930:Flg2 UTSW 3 93,108,642 (GRCm39) nonsense probably null
R6996:Flg2 UTSW 3 93,110,256 (GRCm39) missense unknown
R6996:Flg2 UTSW 3 93,109,977 (GRCm39) missense unknown
R7100:Flg2 UTSW 3 93,111,018 (GRCm39) missense unknown
R7133:Flg2 UTSW 3 93,127,069 (GRCm39) missense unknown
R7180:Flg2 UTSW 3 93,110,140 (GRCm39) missense unknown
R7325:Flg2 UTSW 3 93,110,679 (GRCm39) missense unknown
R7349:Flg2 UTSW 3 93,127,513 (GRCm39) missense unknown
R7531:Flg2 UTSW 3 93,108,177 (GRCm39) missense probably damaging 0.99
R7684:Flg2 UTSW 3 93,126,956 (GRCm39) missense unknown
R7810:Flg2 UTSW 3 93,107,548 (GRCm39) missense possibly damaging 0.70
R7853:Flg2 UTSW 3 93,128,054 (GRCm39) missense unknown
R8031:Flg2 UTSW 3 93,127,521 (GRCm39) missense unknown
R8078:Flg2 UTSW 3 93,107,582 (GRCm39) missense probably damaging 1.00
R8142:Flg2 UTSW 3 93,122,782 (GRCm39) nonsense probably null
R8156:Flg2 UTSW 3 93,127,390 (GRCm39) missense unknown
R8172:Flg2 UTSW 3 93,108,468 (GRCm39) missense possibly damaging 0.94
R8204:Flg2 UTSW 3 93,110,074 (GRCm39) missense unknown
R8262:Flg2 UTSW 3 93,127,517 (GRCm39) missense unknown
R8269:Flg2 UTSW 3 93,109,187 (GRCm39) missense possibly damaging 0.68
R8290:Flg2 UTSW 3 93,110,069 (GRCm39) missense unknown
R8444:Flg2 UTSW 3 93,107,585 (GRCm39) missense probably damaging 0.97
R8670:Flg2 UTSW 3 93,108,791 (GRCm39) missense probably damaging 0.97
R8755:Flg2 UTSW 3 93,108,120 (GRCm39) missense probably damaging 1.00
R9039:Flg2 UTSW 3 93,110,899 (GRCm39) missense unknown
R9116:Flg2 UTSW 3 93,109,591 (GRCm39) missense unknown
R9214:Flg2 UTSW 3 93,110,884 (GRCm39) missense unknown
R9231:Flg2 UTSW 3 93,109,508 (GRCm39) missense unknown
R9553:Flg2 UTSW 3 93,121,901 (GRCm39) missense unknown
R9607:Flg2 UTSW 3 93,108,719 (GRCm39) missense probably damaging 0.98
R9735:Flg2 UTSW 3 93,127,669 (GRCm39) missense unknown
R9752:Flg2 UTSW 3 93,108,467 (GRCm39) missense probably damaging 0.98
Z1177:Flg2 UTSW 3 93,110,045 (GRCm39) missense unknown
Z1177:Flg2 UTSW 3 93,109,727 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TGGCAATCAAAGTGTACCATAAGC -3'
(R):5'- TGCCCTCTAGTTGTACTATTGGAC -3'

Sequencing Primer
(F):5'- TCCAGTCAATCCTCGAGAC -3'
(R):5'- AGATTGTAATAATCAACTGACTGGTC -3'
Posted On 2019-10-17