Incidental Mutation 'R7571:Ak4'
ID585802
Institutional Source Beutler Lab
Gene Symbol Ak4
Ensembl Gene ENSMUSG00000028527
Gene Nameadenylate kinase 4
SynonymsAk-3, Ak3l1, Ak4, Ak-4, D4Ertd274e
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R7571 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location101419277-101466995 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101460542 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 103 (I103T)
Ref Sequence ENSEMBL: ENSMUSP00000102558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102780] [ENSMUST00000106945] [ENSMUST00000106946] [ENSMUST00000131397] [ENSMUST00000133055]
Predicted Effect probably benign
Transcript: ENSMUST00000102780
AA Change: I103T

PolyPhen 2 Score 0.322 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099841
Gene: ENSMUSG00000028527
AA Change: I103T

DomainStartEndE-ValueType
Pfam:AAA_17 7 193 3.2e-12 PFAM
Pfam:AAA_18 9 133 8.7e-11 PFAM
Pfam:ADK 10 190 2e-50 PFAM
Pfam:ADK_lid 126 161 3.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106945
AA Change: I103T

PolyPhen 2 Score 0.322 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102558
Gene: ENSMUSG00000028527
AA Change: I103T

DomainStartEndE-ValueType
Pfam:AAA_17 7 193 3.2e-12 PFAM
Pfam:AAA_18 9 133 8.7e-11 PFAM
Pfam:ADK 10 190 2e-50 PFAM
Pfam:ADK_lid 126 161 3.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106946
AA Change: I103T

PolyPhen 2 Score 0.322 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102559
Gene: ENSMUSG00000028527
AA Change: I103T

DomainStartEndE-ValueType
Pfam:AAA_17 7 179 1.1e-7 PFAM
Pfam:Cytidylate_kin 8 55 3.5e-7 PFAM
Pfam:AAA_18 9 134 4.5e-11 PFAM
Pfam:ADK 10 190 1.8e-50 PFAM
Pfam:ADK_lid 126 161 1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131397
AA Change: I103T

PolyPhen 2 Score 0.322 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000115456
Gene: ENSMUSG00000028527
AA Change: I103T

DomainStartEndE-ValueType
Pfam:AAA_17 7 115 1.1e-11 PFAM
Pfam:AAA_18 9 115 3.6e-8 PFAM
Pfam:ADK 10 115 1.7e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133055
AA Change: I63T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115454
Gene: ENSMUSG00000028527
AA Change: I63T

DomainStartEndE-ValueType
Pfam:AAA_17 7 111 2.2e-10 PFAM
Pfam:ADK 10 48 2.9e-16 PFAM
Pfam:ADK 47 122 5.8e-9 PFAM
Pfam:ADK_lid 86 121 1.1e-18 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000121112
Gene: ENSMUSG00000028527
AA Change: I33T

DomainStartEndE-ValueType
Pfam:ADK 1 108 2.1e-20 PFAM
Pfam:ADK_lid 57 82 9.3e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the adenylate kinase family of enzymes. The encoded protein is localized to the mitochondrial matrix. Adenylate kinases regulate the adenine and guanine nucleotide compositions within a cell by catalyzing the reversible transfer of phosphate group among these nucleotides. Five isozymes of adenylate kinase have been identified in vertebrates. Expression of these isozymes is tissue-specific and developmentally regulated. A pseudogene for this gene has been located on chromosome 17. Three transcript variants encoding the same protein have been identified for this gene. Sequence alignment suggests that the gene defined by NM_013410, NM_203464, and NM_001005353 is located on chromosome 1. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C02Rik A T 5: 30,482,158 E143V possibly damaging Het
Abca16 A T 7: 120,519,988 N985I probably benign Het
Abi3bp T A 16: 56,630,982 probably null Het
Acad12 A T 5: 121,607,194 Y309* probably null Het
Acadsb G T 7: 131,443,554 R405L probably damaging Het
Acan G A 7: 79,086,267 V154M probably damaging Het
Adam22 G A 5: 8,082,160 R894* probably null Het
Ahnak A T 19: 9,000,786 K90* probably null Het
Ap4e1 C T 2: 127,019,336 L132F probably damaging Het
Apol7b C T 15: 77,423,477 V273I probably benign Het
Arhgef37 T A 18: 61,504,332 I420F probably damaging Het
Atg13 C T 2: 91,680,342 probably null Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Cabin1 A T 10: 75,646,666 S2148T probably damaging Het
Cacna1i T C 15: 80,375,336 V1269A probably damaging Het
Cdipt T C 7: 126,979,622 I195T probably benign Het
Ces2b A T 8: 104,835,009 H245L probably damaging Het
Clstn1 T G 4: 149,646,287 M825R probably benign Het
Cntn3 G A 6: 102,278,403 T178I probably damaging Het
Col7a1 A G 9: 108,982,707 M2789V probably null Het
Col9a2 A T 4: 121,039,784 I24F unknown Het
Cpne2 T C 8: 94,551,780 M134T probably benign Het
Cpt1b A G 15: 89,421,343 probably null Het
Crocc T C 4: 141,046,049 probably null Het
Cts8 T C 13: 61,248,167 Y330C probably damaging Het
Cwc22 T C 2: 77,917,067 D434G probably benign Het
Cyp3a13 T C 5: 137,898,863 I396M possibly damaging Het
D430042O09Rik C T 7: 125,708,021 probably benign Het
D5Ertd577e A T 5: 95,482,960 N232I probably damaging Het
Ddr2 A T 1: 170,001,851 I278N probably benign Het
Dnaaf5 A G 5: 139,170,208 E548G possibly damaging Het
Dync2h1 A G 9: 7,002,623 L3808P probably damaging Het
Faf2 T A 13: 54,650,214 W209R probably damaging Het
Fam129a T C 1: 151,718,297 V911A probably benign Het
Fam208b T C 13: 3,575,292 T1553A probably benign Het
Fbln2 A T 6: 91,268,575 E992D probably damaging Het
Fdxacb1 T A 9: 50,771,793 V352D probably damaging Het
Flg2 G T 3: 93,219,996 G2072* probably null Het
Flii A T 11: 60,721,136 L347Q probably damaging Het
Fndc3a A T 14: 72,589,896 H116Q probably damaging Het
Fnta A T 8: 26,015,465 M39K probably benign Het
Gabra4 A G 5: 71,571,992 S482P probably benign Het
Gapdhs G A 7: 30,737,958 P61S unknown Het
Gm10153 A T 7: 142,189,664 C242* probably null Het
Gp1ba A G 11: 70,640,094 I229V unknown Het
Grap2 T A 15: 80,643,704 L117Q probably damaging Het
Grik5 A G 7: 25,013,885 I766T possibly damaging Het
Hrh3 A T 2: 180,101,286 I183N probably damaging Het
Htr5a C A 5: 27,842,895 Y149* probably null Het
Ibtk T C 9: 85,722,300 I527V probably benign Het
Il33 T A 19: 29,956,941 S184R probably damaging Het
Kansl3 T A 1: 36,365,587 Q94L possibly damaging Het
Kcnh6 A G 11: 106,017,416 D286G probably benign Het
Kmt2e T A 5: 23,478,587 M281K probably damaging Het
Lrp2 T A 2: 69,516,403 H833L probably damaging Het
Meis1 A T 11: 18,941,702 V282E probably damaging Het
Mfsd8 T G 3: 40,830,662 D240A probably damaging Het
Muc5b A G 7: 141,847,249 T534A unknown Het
Myo18b G A 5: 112,830,328 L1243F probably damaging Het
Nefl A G 14: 68,084,674 I238V probably benign Het
Nexn T A 3: 152,253,647 I62F possibly damaging Het
Notch4 T C 17: 34,583,574 L1323P probably damaging Het
Olfr493 A T 7: 108,346,482 F166L probably benign Het
Olfr555 T C 7: 102,659,051 S77P probably damaging Het
Olfr906 T C 9: 38,488,656 V209A probably benign Het
Patj C A 4: 98,568,980 H1244N probably damaging Het
Peg10 T A 6: 4,756,082 D219E unknown Het
Pi4kb G T 3: 94,999,114 probably null Het
Piezo1 A G 8: 122,498,418 F614S Het
Pisd T A 5: 32,737,337 N372Y probably damaging Het
Piwil4 T C 9: 14,734,597 D178G probably benign Het
Plekho1 G T 3: 95,989,254 P301Q probably damaging Het
Pop1 T A 15: 34,528,947 W738R probably null Het
Ppp4r1 C T 17: 65,810,616 P125L possibly damaging Het
Prdm9 T A 17: 15,563,264 N13I probably damaging Het
Psd4 T G 2: 24,407,011 V932G probably damaging Het
Ptger3 T C 3: 157,641,775 S355P probably benign Het
Ptprb T C 10: 116,339,430 V823A probably damaging Het
Ptprj C T 2: 90,455,186 V841I probably benign Het
Ranbp3 T C 17: 56,707,923 S281P probably benign Het
Rasal3 T A 17: 32,395,861 M541L possibly damaging Het
Rassf1 A G 9: 107,551,783 T63A possibly damaging Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rgs4 G A 1: 169,744,358 T124I probably damaging Het
Rspo2 T A 15: 43,169,976 probably benign Het
Scgn T C 13: 23,953,914 D258G probably damaging Het
Shkbp1 A G 7: 27,347,131 S403P possibly damaging Het
Slc25a13 A G 6: 6,052,785 L525P probably damaging Het
Snd1 G T 6: 28,526,203 K193N possibly damaging Het
Sntg2 C T 12: 30,175,202 A516T probably damaging Het
Stard13 A G 5: 151,059,502 I699T probably damaging Het
Svil T A 18: 5,114,636 V1984D probably damaging Het
Swt1 A G 1: 151,394,719 S582P probably benign Het
Sypl2 A G 3: 108,214,538 *265Q probably null Het
Taar8a T A 10: 24,077,408 Y303* probably null Het
Tlr2 T A 3: 83,836,542 I745F probably damaging Het
Tnrc6b A G 15: 80,929,393 T1784A probably benign Het
Tpo C A 12: 30,119,432 M101I probably benign Het
Trpm2 G T 10: 77,937,950 R544S probably benign Het
Ttc14 A G 3: 33,809,251 R603G unknown Het
Tubgcp6 A C 15: 89,100,722 V1694G probably damaging Het
Uba6 C A 5: 86,147,111 K356N probably benign Het
Usp16 T C 16: 87,464,835 V113A possibly damaging Het
Vcam1 G A 3: 116,114,383 Q677* probably null Het
Vmn1r238 T A 18: 3,122,721 E231V probably damaging Het
Vmn1r70 T C 7: 10,633,944 F120L probably benign Het
Vmn2r116 T A 17: 23,384,856 probably null Het
Vmn2r5 A T 3: 64,504,404 C248S probably damaging Het
Vmn2r87 A T 10: 130,479,071 D215E probably damaging Het
Xkr4 T G 1: 3,670,688 I221L probably benign Het
Zfp366 T C 13: 99,246,387 I686T probably benign Het
Zfp398 T A 6: 47,866,732 C573S probably damaging Het
Other mutations in Ak4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Ak4 APN 4 101447189 nonsense probably null
IGL03077:Ak4 APN 4 101419951 missense probably damaging 0.98
R1903:Ak4 UTSW 4 101463636 missense possibly damaging 0.47
R5423:Ak4 UTSW 4 101460563 missense probably damaging 1.00
R6309:Ak4 UTSW 4 101463662 missense probably benign
R6936:Ak4 UTSW 4 101447259 missense probably benign 0.00
R8057:Ak4 UTSW 4 101460653 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTAGACCAAGCATAGAAGCTGG -3'
(R):5'- CCTATGCTGTTTGGCCAATG -3'

Sequencing Primer
(F):5'- AGCTGGGCTATAAAAGAGTATACAG -3'
(R):5'- ACCTCCAGACACCTCATACTCCTG -3'
Posted On2019-10-17