Incidental Mutation 'R7571:Kmt2e'
ID585807
Institutional Source Beutler Lab
Gene Symbol Kmt2e
Ensembl Gene ENSMUSG00000029004
Gene Namelysine (K)-specific methyltransferase 2E
SynonymsD230038D11Rik, 9530077A04Rik, 1810033J14Rik, Mll5
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7571 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location23434441-23504235 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23478587 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 281 (M281K)
Ref Sequence ENSEMBL: ENSMUSP00000092569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094962] [ENSMUST00000115128] [ENSMUST00000196889]
Predicted Effect probably damaging
Transcript: ENSMUST00000094962
AA Change: M281K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092569
Gene: ENSMUSG00000029004
AA Change: M281K

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 100 109 N/A INTRINSIC
PHD 120 164 4.25e-8 SMART
SET 328 453 2.13e-26 SMART
low complexity region 487 503 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 854 867 N/A INTRINSIC
low complexity region 882 908 N/A INTRINSIC
low complexity region 933 945 N/A INTRINSIC
low complexity region 951 960 N/A INTRINSIC
low complexity region 1184 1197 N/A INTRINSIC
low complexity region 1214 1237 N/A INTRINSIC
low complexity region 1294 1312 N/A INTRINSIC
low complexity region 1348 1367 N/A INTRINSIC
internal_repeat_1 1434 1496 6.13e-7 PROSPERO
low complexity region 1506 1518 N/A INTRINSIC
low complexity region 1625 1641 N/A INTRINSIC
low complexity region 1677 1705 N/A INTRINSIC
low complexity region 1720 1731 N/A INTRINSIC
internal_repeat_1 1783 1842 6.13e-7 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000115128
AA Change: M281K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110781
Gene: ENSMUSG00000029004
AA Change: M281K

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 100 109 N/A INTRINSIC
PHD 120 164 4.25e-8 SMART
SET 328 453 2.13e-26 SMART
low complexity region 487 503 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 854 867 N/A INTRINSIC
low complexity region 882 908 N/A INTRINSIC
low complexity region 933 945 N/A INTRINSIC
low complexity region 951 960 N/A INTRINSIC
low complexity region 1184 1197 N/A INTRINSIC
low complexity region 1214 1237 N/A INTRINSIC
low complexity region 1294 1312 N/A INTRINSIC
low complexity region 1348 1367 N/A INTRINSIC
internal_repeat_1 1434 1496 6.13e-7 PROSPERO
low complexity region 1506 1518 N/A INTRINSIC
low complexity region 1625 1641 N/A INTRINSIC
low complexity region 1677 1705 N/A INTRINSIC
low complexity region 1720 1731 N/A INTRINSIC
internal_repeat_1 1783 1842 6.13e-7 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000196889
AA Change: M281K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142568
Gene: ENSMUSG00000029004
AA Change: M281K

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 100 109 N/A INTRINSIC
PHD 120 164 2.7e-10 SMART
Blast:SET 216 327 6e-61 BLAST
Blast:SET 328 377 3e-26 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myeloid/lymphoid or mixed-lineage leukemia (MLL) family and encodes a protein with an N-terminal PHD zinc finger and a central SET domain. Overexpression of the protein inhibits cell cycle progression. Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal and postnatal lethality, reduced fertility and growth, and abnormal lymphopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C02Rik A T 5: 30,482,158 E143V possibly damaging Het
Abca16 A T 7: 120,519,988 N985I probably benign Het
Abi3bp T A 16: 56,630,982 probably null Het
Acad12 A T 5: 121,607,194 Y309* probably null Het
Acadsb G T 7: 131,443,554 R405L probably damaging Het
Acan G A 7: 79,086,267 V154M probably damaging Het
Adam22 G A 5: 8,082,160 R894* probably null Het
Ahnak A T 19: 9,000,786 K90* probably null Het
Ak4 T C 4: 101,460,542 I103T probably benign Het
Ap4e1 C T 2: 127,019,336 L132F probably damaging Het
Apol7b C T 15: 77,423,477 V273I probably benign Het
Arhgef37 T A 18: 61,504,332 I420F probably damaging Het
Atg13 C T 2: 91,680,342 probably null Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Cabin1 A T 10: 75,646,666 S2148T probably damaging Het
Cacna1i T C 15: 80,375,336 V1269A probably damaging Het
Cdipt T C 7: 126,979,622 I195T probably benign Het
Ces2b A T 8: 104,835,009 H245L probably damaging Het
Clstn1 T G 4: 149,646,287 M825R probably benign Het
Cntn3 G A 6: 102,278,403 T178I probably damaging Het
Col7a1 A G 9: 108,982,707 M2789V probably null Het
Col9a2 A T 4: 121,039,784 I24F unknown Het
Cpne2 T C 8: 94,551,780 M134T probably benign Het
Cpt1b A G 15: 89,421,343 probably null Het
Crocc T C 4: 141,046,049 probably null Het
Cts8 T C 13: 61,248,167 Y330C probably damaging Het
Cwc22 T C 2: 77,917,067 D434G probably benign Het
Cyp3a13 T C 5: 137,898,863 I396M possibly damaging Het
D430042O09Rik C T 7: 125,708,021 probably benign Het
D5Ertd577e A T 5: 95,482,960 N232I probably damaging Het
Ddr2 A T 1: 170,001,851 I278N probably benign Het
Dnaaf5 A G 5: 139,170,208 E548G possibly damaging Het
Dync2h1 A G 9: 7,002,623 L3808P probably damaging Het
Faf2 T A 13: 54,650,214 W209R probably damaging Het
Fam129a T C 1: 151,718,297 V911A probably benign Het
Fam208b T C 13: 3,575,292 T1553A probably benign Het
Fbln2 A T 6: 91,268,575 E992D probably damaging Het
Fdxacb1 T A 9: 50,771,793 V352D probably damaging Het
Flg2 G T 3: 93,219,996 G2072* probably null Het
Flii A T 11: 60,721,136 L347Q probably damaging Het
Fndc3a A T 14: 72,589,896 H116Q probably damaging Het
Fnta A T 8: 26,015,465 M39K probably benign Het
Gabra4 A G 5: 71,571,992 S482P probably benign Het
Gapdhs G A 7: 30,737,958 P61S unknown Het
Gm10153 A T 7: 142,189,664 C242* probably null Het
Gp1ba A G 11: 70,640,094 I229V unknown Het
Grap2 T A 15: 80,643,704 L117Q probably damaging Het
Grik5 A G 7: 25,013,885 I766T possibly damaging Het
Hrh3 A T 2: 180,101,286 I183N probably damaging Het
Htr5a C A 5: 27,842,895 Y149* probably null Het
Ibtk T C 9: 85,722,300 I527V probably benign Het
Il33 T A 19: 29,956,941 S184R probably damaging Het
Kansl3 T A 1: 36,365,587 Q94L possibly damaging Het
Kcnh6 A G 11: 106,017,416 D286G probably benign Het
Lrp2 T A 2: 69,516,403 H833L probably damaging Het
Meis1 A T 11: 18,941,702 V282E probably damaging Het
Mfsd8 T G 3: 40,830,662 D240A probably damaging Het
Muc5b A G 7: 141,847,249 T534A unknown Het
Myo18b G A 5: 112,830,328 L1243F probably damaging Het
Nefl A G 14: 68,084,674 I238V probably benign Het
Nexn T A 3: 152,253,647 I62F possibly damaging Het
Notch4 T C 17: 34,583,574 L1323P probably damaging Het
Olfr493 A T 7: 108,346,482 F166L probably benign Het
Olfr555 T C 7: 102,659,051 S77P probably damaging Het
Olfr906 T C 9: 38,488,656 V209A probably benign Het
Patj C A 4: 98,568,980 H1244N probably damaging Het
Peg10 T A 6: 4,756,082 D219E unknown Het
Pi4kb G T 3: 94,999,114 probably null Het
Piezo1 A G 8: 122,498,418 F614S Het
Pisd T A 5: 32,737,337 N372Y probably damaging Het
Piwil4 T C 9: 14,734,597 D178G probably benign Het
Plekho1 G T 3: 95,989,254 P301Q probably damaging Het
Pop1 T A 15: 34,528,947 W738R probably null Het
Ppp4r1 C T 17: 65,810,616 P125L possibly damaging Het
Prdm9 T A 17: 15,563,264 N13I probably damaging Het
Psd4 T G 2: 24,407,011 V932G probably damaging Het
Ptger3 T C 3: 157,641,775 S355P probably benign Het
Ptprb T C 10: 116,339,430 V823A probably damaging Het
Ptprj C T 2: 90,455,186 V841I probably benign Het
Ranbp3 T C 17: 56,707,923 S281P probably benign Het
Rasal3 T A 17: 32,395,861 M541L possibly damaging Het
Rassf1 A G 9: 107,551,783 T63A possibly damaging Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rgs4 G A 1: 169,744,358 T124I probably damaging Het
Rspo2 T A 15: 43,169,976 probably benign Het
Scgn T C 13: 23,953,914 D258G probably damaging Het
Shkbp1 A G 7: 27,347,131 S403P possibly damaging Het
Slc25a13 A G 6: 6,052,785 L525P probably damaging Het
Snd1 G T 6: 28,526,203 K193N possibly damaging Het
Sntg2 C T 12: 30,175,202 A516T probably damaging Het
Stard13 A G 5: 151,059,502 I699T probably damaging Het
Svil T A 18: 5,114,636 V1984D probably damaging Het
Swt1 A G 1: 151,394,719 S582P probably benign Het
Sypl2 A G 3: 108,214,538 *265Q probably null Het
Taar8a T A 10: 24,077,408 Y303* probably null Het
Tlr2 T A 3: 83,836,542 I745F probably damaging Het
Tnrc6b A G 15: 80,929,393 T1784A probably benign Het
Tpo C A 12: 30,119,432 M101I probably benign Het
Trpm2 G T 10: 77,937,950 R544S probably benign Het
Ttc14 A G 3: 33,809,251 R603G unknown Het
Tubgcp6 A C 15: 89,100,722 V1694G probably damaging Het
Uba6 C A 5: 86,147,111 K356N probably benign Het
Usp16 T C 16: 87,464,835 V113A possibly damaging Het
Vcam1 G A 3: 116,114,383 Q677* probably null Het
Vmn1r238 T A 18: 3,122,721 E231V probably damaging Het
Vmn1r70 T C 7: 10,633,944 F120L probably benign Het
Vmn2r116 T A 17: 23,384,856 probably null Het
Vmn2r5 A T 3: 64,504,404 C248S probably damaging Het
Vmn2r87 A T 10: 130,479,071 D215E probably damaging Het
Xkr4 T G 1: 3,670,688 I221L probably benign Het
Zfp366 T C 13: 99,246,387 I686T probably benign Het
Zfp398 T A 6: 47,866,732 C573S probably damaging Het
Other mutations in Kmt2e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Kmt2e APN 5 23492358 missense probably damaging 0.99
IGL01330:Kmt2e APN 5 23497948 missense possibly damaging 0.95
IGL01457:Kmt2e APN 5 23502019 missense possibly damaging 0.62
IGL01691:Kmt2e APN 5 23497091 missense probably benign
IGL02274:Kmt2e APN 5 23500760 missense probably benign 0.00
IGL02934:Kmt2e APN 5 23497884 missense probably damaging 0.97
IGL02964:Kmt2e APN 5 23467100 splice site probably benign
IGL03011:Kmt2e APN 5 23497542 missense probably damaging 1.00
IGL03291:Kmt2e APN 5 23499291 missense probably damaging 1.00
R0035:Kmt2e UTSW 5 23485621 splice site probably benign
R0446:Kmt2e UTSW 5 23497534 splice site probably null
R0498:Kmt2e UTSW 5 23478972 nonsense probably null
R0699:Kmt2e UTSW 5 23473583 missense probably benign 0.01
R0701:Kmt2e UTSW 5 23473583 missense probably benign 0.01
R0761:Kmt2e UTSW 5 23503034 nonsense probably null
R1110:Kmt2e UTSW 5 23502655 missense probably damaging 1.00
R1295:Kmt2e UTSW 5 23502404 missense probably damaging 0.99
R1432:Kmt2e UTSW 5 23450321 missense probably benign 0.39
R1495:Kmt2e UTSW 5 23499327 missense possibly damaging 0.83
R1505:Kmt2e UTSW 5 23500535 missense probably null 0.01
R1623:Kmt2e UTSW 5 23482502 missense probably damaging 1.00
R1675:Kmt2e UTSW 5 23482453 nonsense probably null
R1691:Kmt2e UTSW 5 23464849 missense probably damaging 1.00
R1778:Kmt2e UTSW 5 23492364 missense probably damaging 1.00
R1820:Kmt2e UTSW 5 23473547 missense probably damaging 1.00
R1846:Kmt2e UTSW 5 23499486 intron probably benign
R1912:Kmt2e UTSW 5 23492395 missense probably benign 0.07
R2070:Kmt2e UTSW 5 23501995 missense probably benign
R2195:Kmt2e UTSW 5 23502196 unclassified probably null
R2571:Kmt2e UTSW 5 23501887 missense probably benign 0.08
R3901:Kmt2e UTSW 5 23501642 missense probably benign 0.02
R3902:Kmt2e UTSW 5 23501642 missense probably benign 0.02
R3905:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3906:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3909:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3956:Kmt2e UTSW 5 23496025 missense probably benign 0.00
R4242:Kmt2e UTSW 5 23502822 unclassified probably benign
R4299:Kmt2e UTSW 5 23464914 missense probably damaging 1.00
R4448:Kmt2e UTSW 5 23464790 missense possibly damaging 0.80
R4528:Kmt2e UTSW 5 23473558 missense possibly damaging 0.69
R4574:Kmt2e UTSW 5 23492407 missense possibly damaging 0.60
R4719:Kmt2e UTSW 5 23492315 missense probably damaging 1.00
R4754:Kmt2e UTSW 5 23482441 missense possibly damaging 0.88
R4787:Kmt2e UTSW 5 23463083 missense possibly damaging 0.65
R4812:Kmt2e UTSW 5 23502587 missense possibly damaging 0.86
R4853:Kmt2e UTSW 5 23502341 missense probably damaging 1.00
R5138:Kmt2e UTSW 5 23502695 missense probably damaging 0.99
R5306:Kmt2e UTSW 5 23499333 missense probably damaging 0.98
R5659:Kmt2e UTSW 5 23497807 missense probably damaging 0.99
R5907:Kmt2e UTSW 5 23464706 missense probably damaging 1.00
R5920:Kmt2e UTSW 5 23499442 missense possibly damaging 0.50
R6280:Kmt2e UTSW 5 23499516 missense possibly damaging 0.48
R6353:Kmt2e UTSW 5 23493245 missense probably damaging 1.00
R6375:Kmt2e UTSW 5 23499519 missense probably benign
R6553:Kmt2e UTSW 5 23463026 missense probably damaging 0.99
R6572:Kmt2e UTSW 5 23497581 missense possibly damaging 0.66
R6678:Kmt2e UTSW 5 23499295 missense possibly damaging 0.54
R6791:Kmt2e UTSW 5 23499476 intron probably benign
R6792:Kmt2e UTSW 5 23499476 intron probably benign
R6794:Kmt2e UTSW 5 23499476 intron probably benign
R6797:Kmt2e UTSW 5 23482507 missense possibly damaging 0.82
R6947:Kmt2e UTSW 5 23497545 missense probably damaging 1.00
R7023:Kmt2e UTSW 5 23500487 missense possibly damaging 0.46
R7036:Kmt2e UTSW 5 23478743 missense probably null 1.00
R7173:Kmt2e UTSW 5 23464857 missense probably damaging 1.00
R7202:Kmt2e UTSW 5 23492294 unclassified probably benign
R7563:Kmt2e UTSW 5 23500273 missense probably damaging 1.00
R7604:Kmt2e UTSW 5 23501765 missense not run
R7722:Kmt2e UTSW 5 23497018 missense probably benign 0.00
R7758:Kmt2e UTSW 5 23496070 missense possibly damaging 0.92
R7794:Kmt2e UTSW 5 23464716 missense probably damaging 1.00
RF026:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
RF028:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
RF040:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
RF042:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
Z1177:Kmt2e UTSW 5 23481208 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CAGCTTAGATAGGCAATCACTATAGC -3'
(R):5'- ACATAATACAGAGGCAGTTCCC -3'

Sequencing Primer
(F):5'- GGCAATCACTATAGCTTTATATCCTC -3'
(R):5'- GCAGTTCCCTAAGGCTTTGACAAG -3'
Posted On2019-10-17