Incidental Mutation 'R7571:Kmt2e'
ID 585807
Institutional Source Beutler Lab
Gene Symbol Kmt2e
Ensembl Gene ENSMUSG00000029004
Gene Name lysine (K)-specific methyltransferase 2E
Synonyms 9530077A04Rik, 1810033J14Rik, D230038D11Rik, Mll5
MMRRC Submission 045711-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7571 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 23639439-23709233 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 23683585 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 281 (M281K)
Ref Sequence ENSEMBL: ENSMUSP00000092569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094962] [ENSMUST00000115128] [ENSMUST00000196889]
AlphaFold Q3UG20
Predicted Effect probably damaging
Transcript: ENSMUST00000094962
AA Change: M281K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092569
Gene: ENSMUSG00000029004
AA Change: M281K

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 100 109 N/A INTRINSIC
PHD 120 164 4.25e-8 SMART
SET 328 453 2.13e-26 SMART
low complexity region 487 503 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 854 867 N/A INTRINSIC
low complexity region 882 908 N/A INTRINSIC
low complexity region 933 945 N/A INTRINSIC
low complexity region 951 960 N/A INTRINSIC
low complexity region 1184 1197 N/A INTRINSIC
low complexity region 1214 1237 N/A INTRINSIC
low complexity region 1294 1312 N/A INTRINSIC
low complexity region 1348 1367 N/A INTRINSIC
internal_repeat_1 1434 1496 6.13e-7 PROSPERO
low complexity region 1506 1518 N/A INTRINSIC
low complexity region 1625 1641 N/A INTRINSIC
low complexity region 1677 1705 N/A INTRINSIC
low complexity region 1720 1731 N/A INTRINSIC
internal_repeat_1 1783 1842 6.13e-7 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000115128
AA Change: M281K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110781
Gene: ENSMUSG00000029004
AA Change: M281K

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 100 109 N/A INTRINSIC
PHD 120 164 4.25e-8 SMART
SET 328 453 2.13e-26 SMART
low complexity region 487 503 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 854 867 N/A INTRINSIC
low complexity region 882 908 N/A INTRINSIC
low complexity region 933 945 N/A INTRINSIC
low complexity region 951 960 N/A INTRINSIC
low complexity region 1184 1197 N/A INTRINSIC
low complexity region 1214 1237 N/A INTRINSIC
low complexity region 1294 1312 N/A INTRINSIC
low complexity region 1348 1367 N/A INTRINSIC
internal_repeat_1 1434 1496 6.13e-7 PROSPERO
low complexity region 1506 1518 N/A INTRINSIC
low complexity region 1625 1641 N/A INTRINSIC
low complexity region 1677 1705 N/A INTRINSIC
low complexity region 1720 1731 N/A INTRINSIC
internal_repeat_1 1783 1842 6.13e-7 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000196889
AA Change: M281K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142568
Gene: ENSMUSG00000029004
AA Change: M281K

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 100 109 N/A INTRINSIC
PHD 120 164 2.7e-10 SMART
Blast:SET 216 327 6e-61 BLAST
Blast:SET 328 377 3e-26 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myeloid/lymphoid or mixed-lineage leukemia (MLL) family and encodes a protein with an N-terminal PHD zinc finger and a central SET domain. Overexpression of the protein inhibits cell cycle progression. Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal and postnatal lethality, reduced fertility and growth, and abnormal lymphopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,119,211 (GRCm39) N985I probably benign Het
Abi3bp T A 16: 56,451,345 (GRCm39) probably null Het
Acad12 A T 5: 121,745,257 (GRCm39) Y309* probably null Het
Acadsb G T 7: 131,045,283 (GRCm39) R405L probably damaging Het
Acan G A 7: 78,736,015 (GRCm39) V154M probably damaging Het
Adam22 G A 5: 8,132,160 (GRCm39) R894* probably null Het
Ahnak A T 19: 8,978,150 (GRCm39) K90* probably null Het
Ak4 T C 4: 101,317,739 (GRCm39) I103T probably benign Het
Ap4e1 C T 2: 126,861,256 (GRCm39) L132F probably damaging Het
Apol7b C T 15: 77,307,677 (GRCm39) V273I probably benign Het
Arhgef37 T A 18: 61,637,403 (GRCm39) I420F probably damaging Het
Atg13 C T 2: 91,510,687 (GRCm39) probably null Het
Bach1 G A 16: 87,516,179 (GRCm39) R240Q probably benign Het
Cabin1 A T 10: 75,482,500 (GRCm39) S2148T probably damaging Het
Cacna1i T C 15: 80,259,537 (GRCm39) V1269A probably damaging Het
Cdipt T C 7: 126,578,794 (GRCm39) I195T probably benign Het
Ces2b A T 8: 105,561,641 (GRCm39) H245L probably damaging Het
Cimip2c A T 5: 30,639,502 (GRCm39) E143V possibly damaging Het
Clstn1 T G 4: 149,730,744 (GRCm39) M825R probably benign Het
Cntn3 G A 6: 102,255,364 (GRCm39) T178I probably damaging Het
Col7a1 A G 9: 108,811,775 (GRCm39) M2789V probably null Het
Col9a2 A T 4: 120,896,981 (GRCm39) I24F unknown Het
Cpne2 T C 8: 95,278,408 (GRCm39) M134T probably benign Het
Cpt1b A G 15: 89,305,546 (GRCm39) probably null Het
Crocc T C 4: 140,773,360 (GRCm39) probably null Het
Cts8 T C 13: 61,395,981 (GRCm39) Y330C probably damaging Het
Cwc22 T C 2: 77,747,411 (GRCm39) D434G probably benign Het
Cyp3a13 T C 5: 137,897,125 (GRCm39) I396M possibly damaging Het
Ddr2 A T 1: 169,829,420 (GRCm39) I278N probably benign Het
Dnaaf5 A G 5: 139,155,963 (GRCm39) E548G possibly damaging Het
Dync2h1 A G 9: 7,002,623 (GRCm39) L3808P probably damaging Het
Faf2 T A 13: 54,798,027 (GRCm39) W209R probably damaging Het
Fbln2 A T 6: 91,245,557 (GRCm39) E992D probably damaging Het
Fdxacb1 T A 9: 50,683,093 (GRCm39) V352D probably damaging Het
Flg2 G T 3: 93,127,303 (GRCm39) G2072* probably null Het
Flii A T 11: 60,611,962 (GRCm39) L347Q probably damaging Het
Fndc3a A T 14: 72,827,336 (GRCm39) H116Q probably damaging Het
Fnta A T 8: 26,505,493 (GRCm39) M39K probably benign Het
Gabra4 A G 5: 71,729,335 (GRCm39) S482P probably benign Het
Gapdhs G A 7: 30,437,383 (GRCm39) P61S unknown Het
Gm10153 A T 7: 141,743,401 (GRCm39) C242* probably null Het
Gp1ba A G 11: 70,530,920 (GRCm39) I229V unknown Het
Grap2 T A 15: 80,527,905 (GRCm39) L117Q probably damaging Het
Grik5 A G 7: 24,713,310 (GRCm39) I766T possibly damaging Het
Hrh3 A T 2: 179,743,079 (GRCm39) I183N probably damaging Het
Htr5a C A 5: 28,047,893 (GRCm39) Y149* probably null Het
Ibtk T C 9: 85,604,353 (GRCm39) I527V probably benign Het
Il33 T A 19: 29,934,341 (GRCm39) S184R probably damaging Het
Kansl3 T A 1: 36,404,668 (GRCm39) Q94L possibly damaging Het
Katnip C T 7: 125,307,193 (GRCm39) probably benign Het
Kcnh6 A G 11: 105,908,242 (GRCm39) D286G probably benign Het
Lrp2 T A 2: 69,346,747 (GRCm39) H833L probably damaging Het
Meis1 A T 11: 18,891,702 (GRCm39) V282E probably damaging Het
Mfsd8 T G 3: 40,785,097 (GRCm39) D240A probably damaging Het
Muc5b A G 7: 141,400,986 (GRCm39) T534A unknown Het
Myo18b G A 5: 112,978,194 (GRCm39) L1243F probably damaging Het
Nefl A G 14: 68,322,123 (GRCm39) I238V probably benign Het
Nexn T A 3: 151,959,284 (GRCm39) I62F possibly damaging Het
Niban1 T C 1: 151,594,048 (GRCm39) V911A probably benign Het
Notch4 T C 17: 34,802,548 (GRCm39) L1323P probably damaging Het
Or51h1 T C 7: 102,308,258 (GRCm39) S77P probably damaging Het
Or5p68 A T 7: 107,945,689 (GRCm39) F166L probably benign Het
Or8b1 T C 9: 38,399,952 (GRCm39) V209A probably benign Het
Patj C A 4: 98,457,217 (GRCm39) H1244N probably damaging Het
Peg10 T A 6: 4,756,082 (GRCm39) D219E unknown Het
Pi4kb G T 3: 94,906,425 (GRCm39) probably null Het
Piezo1 A G 8: 123,225,157 (GRCm39) F614S Het
Pisd T A 5: 32,894,681 (GRCm39) N372Y probably damaging Het
Piwil4 T C 9: 14,645,893 (GRCm39) D178G probably benign Het
Plekho1 G T 3: 95,896,566 (GRCm39) P301Q probably damaging Het
Pop1 T A 15: 34,529,093 (GRCm39) W738R probably null Het
Ppp4r1 C T 17: 66,117,611 (GRCm39) P125L possibly damaging Het
Pramel48 A T 5: 95,630,819 (GRCm39) N232I probably damaging Het
Prdm9 T A 17: 15,783,526 (GRCm39) N13I probably damaging Het
Psd4 T G 2: 24,297,023 (GRCm39) V932G probably damaging Het
Ptger3 T C 3: 157,347,412 (GRCm39) S355P probably benign Het
Ptprb T C 10: 116,175,335 (GRCm39) V823A probably damaging Het
Ptprj C T 2: 90,285,530 (GRCm39) V841I probably benign Het
Ranbp3 T C 17: 57,014,923 (GRCm39) S281P probably benign Het
Rasal3 T A 17: 32,614,835 (GRCm39) M541L possibly damaging Het
Rassf1 A G 9: 107,428,982 (GRCm39) T63A possibly damaging Het
Rcor3 C A 1: 191,822,173 (GRCm39) G8V probably damaging Het
Rgs4 G A 1: 169,571,927 (GRCm39) T124I probably damaging Het
Rspo2 T A 15: 43,033,372 (GRCm39) probably benign Het
Scgn T C 13: 24,137,897 (GRCm39) D258G probably damaging Het
Shkbp1 A G 7: 27,046,556 (GRCm39) S403P possibly damaging Het
Slc25a13 A G 6: 6,052,785 (GRCm39) L525P probably damaging Het
Snd1 G T 6: 28,526,202 (GRCm39) K193N possibly damaging Het
Sntg2 C T 12: 30,225,201 (GRCm39) A516T probably damaging Het
Stard13 A G 5: 150,982,967 (GRCm39) I699T probably damaging Het
Svil T A 18: 5,114,636 (GRCm39) V1984D probably damaging Het
Swt1 A G 1: 151,270,470 (GRCm39) S582P probably benign Het
Sypl2 A G 3: 108,121,854 (GRCm39) *265Q probably null Het
Taar8a T A 10: 23,953,306 (GRCm39) Y303* probably null Het
Tasor2 T C 13: 3,625,292 (GRCm39) T1553A probably benign Het
Tlr2 T A 3: 83,743,849 (GRCm39) I745F probably damaging Het
Tnrc6b A G 15: 80,813,594 (GRCm39) T1784A probably benign Het
Tpo C A 12: 30,169,431 (GRCm39) M101I probably benign Het
Trpm2 G T 10: 77,773,784 (GRCm39) R544S probably benign Het
Ttc14 A G 3: 33,863,400 (GRCm39) R603G unknown Het
Tubgcp6 A C 15: 88,984,925 (GRCm39) V1694G probably damaging Het
Uba6 C A 5: 86,294,970 (GRCm39) K356N probably benign Het
Usp16 T C 16: 87,261,723 (GRCm39) V113A possibly damaging Het
Vcam1 G A 3: 115,908,032 (GRCm39) Q677* probably null Het
Vmn1r238 T A 18: 3,122,721 (GRCm39) E231V probably damaging Het
Vmn1r70 T C 7: 10,367,871 (GRCm39) F120L probably benign Het
Vmn2r116 T A 17: 23,603,830 (GRCm39) probably null Het
Vmn2r5 A T 3: 64,411,825 (GRCm39) C248S probably damaging Het
Vmn2r87 A T 10: 130,314,940 (GRCm39) D215E probably damaging Het
Xkr4 T G 1: 3,740,911 (GRCm39) I221L probably benign Het
Zfp366 T C 13: 99,382,895 (GRCm39) I686T probably benign Het
Zfp398 T A 6: 47,843,666 (GRCm39) C573S probably damaging Het
Other mutations in Kmt2e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Kmt2e APN 5 23,697,356 (GRCm39) missense probably damaging 0.99
IGL01330:Kmt2e APN 5 23,702,946 (GRCm39) missense possibly damaging 0.95
IGL01457:Kmt2e APN 5 23,707,017 (GRCm39) missense possibly damaging 0.62
IGL01691:Kmt2e APN 5 23,702,089 (GRCm39) missense probably benign
IGL02274:Kmt2e APN 5 23,705,758 (GRCm39) missense probably benign 0.00
IGL02934:Kmt2e APN 5 23,702,882 (GRCm39) missense probably damaging 0.97
IGL02964:Kmt2e APN 5 23,672,098 (GRCm39) splice site probably benign
IGL03011:Kmt2e APN 5 23,702,540 (GRCm39) missense probably damaging 1.00
IGL03291:Kmt2e APN 5 23,704,289 (GRCm39) missense probably damaging 1.00
R0035:Kmt2e UTSW 5 23,690,619 (GRCm39) splice site probably benign
R0446:Kmt2e UTSW 5 23,702,532 (GRCm39) splice site probably null
R0498:Kmt2e UTSW 5 23,683,970 (GRCm39) nonsense probably null
R0699:Kmt2e UTSW 5 23,678,581 (GRCm39) missense probably benign 0.01
R0701:Kmt2e UTSW 5 23,678,581 (GRCm39) missense probably benign 0.01
R0761:Kmt2e UTSW 5 23,708,032 (GRCm39) nonsense probably null
R1110:Kmt2e UTSW 5 23,707,653 (GRCm39) missense probably damaging 1.00
R1295:Kmt2e UTSW 5 23,707,402 (GRCm39) missense probably damaging 0.99
R1432:Kmt2e UTSW 5 23,655,319 (GRCm39) missense probably benign 0.39
R1495:Kmt2e UTSW 5 23,704,325 (GRCm39) missense possibly damaging 0.83
R1505:Kmt2e UTSW 5 23,705,533 (GRCm39) missense probably null 0.01
R1623:Kmt2e UTSW 5 23,687,500 (GRCm39) missense probably damaging 1.00
R1675:Kmt2e UTSW 5 23,687,451 (GRCm39) nonsense probably null
R1691:Kmt2e UTSW 5 23,669,847 (GRCm39) missense probably damaging 1.00
R1778:Kmt2e UTSW 5 23,697,362 (GRCm39) missense probably damaging 1.00
R1820:Kmt2e UTSW 5 23,678,545 (GRCm39) missense probably damaging 1.00
R1846:Kmt2e UTSW 5 23,704,484 (GRCm39) intron probably benign
R1912:Kmt2e UTSW 5 23,697,393 (GRCm39) missense probably benign 0.07
R2070:Kmt2e UTSW 5 23,706,993 (GRCm39) missense probably benign
R2195:Kmt2e UTSW 5 23,707,194 (GRCm39) splice site probably null
R2571:Kmt2e UTSW 5 23,706,885 (GRCm39) missense probably benign 0.08
R3901:Kmt2e UTSW 5 23,706,640 (GRCm39) missense probably benign 0.02
R3902:Kmt2e UTSW 5 23,706,640 (GRCm39) missense probably benign 0.02
R3905:Kmt2e UTSW 5 23,706,624 (GRCm39) missense probably benign 0.01
R3906:Kmt2e UTSW 5 23,706,624 (GRCm39) missense probably benign 0.01
R3909:Kmt2e UTSW 5 23,706,624 (GRCm39) missense probably benign 0.01
R3956:Kmt2e UTSW 5 23,701,023 (GRCm39) missense probably benign 0.00
R4242:Kmt2e UTSW 5 23,707,820 (GRCm39) unclassified probably benign
R4299:Kmt2e UTSW 5 23,669,912 (GRCm39) missense probably damaging 1.00
R4448:Kmt2e UTSW 5 23,669,788 (GRCm39) missense possibly damaging 0.80
R4528:Kmt2e UTSW 5 23,678,556 (GRCm39) missense possibly damaging 0.69
R4574:Kmt2e UTSW 5 23,697,405 (GRCm39) missense possibly damaging 0.60
R4719:Kmt2e UTSW 5 23,697,313 (GRCm39) missense probably damaging 1.00
R4754:Kmt2e UTSW 5 23,687,439 (GRCm39) missense possibly damaging 0.88
R4787:Kmt2e UTSW 5 23,668,081 (GRCm39) missense possibly damaging 0.65
R4812:Kmt2e UTSW 5 23,707,585 (GRCm39) missense possibly damaging 0.86
R4853:Kmt2e UTSW 5 23,707,339 (GRCm39) missense probably damaging 1.00
R5138:Kmt2e UTSW 5 23,707,693 (GRCm39) missense probably damaging 0.99
R5306:Kmt2e UTSW 5 23,704,331 (GRCm39) missense probably damaging 0.98
R5659:Kmt2e UTSW 5 23,702,805 (GRCm39) missense probably damaging 0.99
R5907:Kmt2e UTSW 5 23,669,704 (GRCm39) missense probably damaging 1.00
R5920:Kmt2e UTSW 5 23,704,440 (GRCm39) missense possibly damaging 0.50
R6280:Kmt2e UTSW 5 23,704,514 (GRCm39) missense possibly damaging 0.48
R6353:Kmt2e UTSW 5 23,698,243 (GRCm39) missense probably damaging 1.00
R6375:Kmt2e UTSW 5 23,704,517 (GRCm39) missense probably benign
R6553:Kmt2e UTSW 5 23,668,024 (GRCm39) missense probably damaging 0.99
R6572:Kmt2e UTSW 5 23,702,579 (GRCm39) missense possibly damaging 0.66
R6678:Kmt2e UTSW 5 23,704,293 (GRCm39) missense possibly damaging 0.54
R6791:Kmt2e UTSW 5 23,704,474 (GRCm39) intron probably benign
R6792:Kmt2e UTSW 5 23,704,474 (GRCm39) intron probably benign
R6794:Kmt2e UTSW 5 23,704,474 (GRCm39) intron probably benign
R6797:Kmt2e UTSW 5 23,687,505 (GRCm39) missense possibly damaging 0.82
R6947:Kmt2e UTSW 5 23,702,543 (GRCm39) missense probably damaging 1.00
R7023:Kmt2e UTSW 5 23,705,485 (GRCm39) missense possibly damaging 0.46
R7036:Kmt2e UTSW 5 23,683,741 (GRCm39) missense probably null 1.00
R7173:Kmt2e UTSW 5 23,669,855 (GRCm39) missense probably damaging 1.00
R7202:Kmt2e UTSW 5 23,697,292 (GRCm39) unclassified probably benign
R7563:Kmt2e UTSW 5 23,705,271 (GRCm39) missense probably damaging 1.00
R7604:Kmt2e UTSW 5 23,706,763 (GRCm39) missense not run
R7722:Kmt2e UTSW 5 23,702,016 (GRCm39) missense probably benign 0.00
R7758:Kmt2e UTSW 5 23,701,068 (GRCm39) missense possibly damaging 0.92
R7794:Kmt2e UTSW 5 23,669,714 (GRCm39) missense probably damaging 1.00
R8137:Kmt2e UTSW 5 23,706,952 (GRCm39) missense probably damaging 1.00
R8341:Kmt2e UTSW 5 23,704,451 (GRCm39) missense probably damaging 0.98
R8383:Kmt2e UTSW 5 23,690,539 (GRCm39) missense probably benign 0.08
R8400:Kmt2e UTSW 5 23,702,090 (GRCm39) missense probably benign 0.17
R8546:Kmt2e UTSW 5 23,686,242 (GRCm39) missense probably damaging 1.00
R8750:Kmt2e UTSW 5 23,698,215 (GRCm39) missense probably benign
R8786:Kmt2e UTSW 5 23,669,864 (GRCm39) missense probably damaging 1.00
R9211:Kmt2e UTSW 5 23,669,770 (GRCm39) missense possibly damaging 0.83
R9660:Kmt2e UTSW 5 23,683,617 (GRCm39) missense probably damaging 1.00
R9786:Kmt2e UTSW 5 23,702,982 (GRCm39) missense probably benign 0.16
RF026:Kmt2e UTSW 5 23,683,507 (GRCm39) critical splice acceptor site probably benign
RF028:Kmt2e UTSW 5 23,683,507 (GRCm39) critical splice acceptor site probably benign
RF040:Kmt2e UTSW 5 23,683,507 (GRCm39) critical splice acceptor site probably benign
RF042:Kmt2e UTSW 5 23,683,507 (GRCm39) critical splice acceptor site probably benign
Z1177:Kmt2e UTSW 5 23,686,206 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CAGCTTAGATAGGCAATCACTATAGC -3'
(R):5'- ACATAATACAGAGGCAGTTCCC -3'

Sequencing Primer
(F):5'- GGCAATCACTATAGCTTTATATCCTC -3'
(R):5'- GCAGTTCCCTAAGGCTTTGACAAG -3'
Posted On 2019-10-17