Incidental Mutation 'R7571:Acan'
ID585829
Institutional Source Beutler Lab
Gene Symbol Acan
Ensembl Gene ENSMUSG00000030607
Gene Nameaggrecan
SynonymsAgc1, b2b183Clo, Cspg1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7571 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location79053483-79115099 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 79086267 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 154 (V154M)
Ref Sequence ENSEMBL: ENSMUSP00000032835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032835]
Predicted Effect probably damaging
Transcript: ENSMUST00000032835
AA Change: V154M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032835
Gene: ENSMUSG00000030607
AA Change: V154M

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 46 135 3.46e-7 SMART
LINK 151 248 1.76e-59 SMART
LINK 252 350 4.13e-65 SMART
LINK 485 582 1.03e-51 SMART
LINK 586 684 9.58e-61 SMART
low complexity region 767 794 N/A INTRINSIC
low complexity region 845 859 N/A INTRINSIC
low complexity region 890 904 N/A INTRINSIC
low complexity region 913 930 N/A INTRINSIC
low complexity region 966 987 N/A INTRINSIC
low complexity region 1455 1468 N/A INTRINSIC
low complexity region 1484 1495 N/A INTRINSIC
low complexity region 1707 1720 N/A INTRINSIC
low complexity region 1808 1823 N/A INTRINSIC
low complexity region 1904 1915 N/A INTRINSIC
CLECT 1922 2043 2.13e-37 SMART
CCP 2049 2105 9.32e-11 SMART
low complexity region 2118 2130 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Spontaneous mutations in this gene lead to dwarfism, cartilage, skeletal and limb anomalies, craniofacial defects, hearing loss and neonatal death due to respiratory failure. Homozygotes for an ENU-induced allele show cardiomyopathy as well as cleft palate, disproportionate dwarfism and brachypodia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C02Rik A T 5: 30,482,158 E143V possibly damaging Het
Abca16 A T 7: 120,519,988 N985I probably benign Het
Abi3bp T A 16: 56,630,982 probably null Het
Acad12 A T 5: 121,607,194 Y309* probably null Het
Acadsb G T 7: 131,443,554 R405L probably damaging Het
Adam22 G A 5: 8,082,160 R894* probably null Het
Ahnak A T 19: 9,000,786 K90* probably null Het
Ak4 T C 4: 101,460,542 I103T probably benign Het
Ap4e1 C T 2: 127,019,336 L132F probably damaging Het
Apol7b C T 15: 77,423,477 V273I probably benign Het
Arhgef37 T A 18: 61,504,332 I420F probably damaging Het
Atg13 C T 2: 91,680,342 probably null Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Cabin1 A T 10: 75,646,666 S2148T probably damaging Het
Cacna1i T C 15: 80,375,336 V1269A probably damaging Het
Cdipt T C 7: 126,979,622 I195T probably benign Het
Ces2b A T 8: 104,835,009 H245L probably damaging Het
Clstn1 T G 4: 149,646,287 M825R probably benign Het
Cntn3 G A 6: 102,278,403 T178I probably damaging Het
Col7a1 A G 9: 108,982,707 M2789V probably null Het
Col9a2 A T 4: 121,039,784 I24F unknown Het
Cpne2 T C 8: 94,551,780 M134T probably benign Het
Cpt1b A G 15: 89,421,343 probably null Het
Crocc T C 4: 141,046,049 probably null Het
Cts8 T C 13: 61,248,167 Y330C probably damaging Het
Cwc22 T C 2: 77,917,067 D434G probably benign Het
Cyp3a13 T C 5: 137,898,863 I396M possibly damaging Het
D430042O09Rik C T 7: 125,708,021 probably benign Het
D5Ertd577e A T 5: 95,482,960 N232I probably damaging Het
Ddr2 A T 1: 170,001,851 I278N probably benign Het
Dnaaf5 A G 5: 139,170,208 E548G possibly damaging Het
Dync2h1 A G 9: 7,002,623 L3808P probably damaging Het
Faf2 T A 13: 54,650,214 W209R probably damaging Het
Fam129a T C 1: 151,718,297 V911A probably benign Het
Fam208b T C 13: 3,575,292 T1553A probably benign Het
Fbln2 A T 6: 91,268,575 E992D probably damaging Het
Fdxacb1 T A 9: 50,771,793 V352D probably damaging Het
Flg2 G T 3: 93,219,996 G2072* probably null Het
Flii A T 11: 60,721,136 L347Q probably damaging Het
Fndc3a A T 14: 72,589,896 H116Q probably damaging Het
Fnta A T 8: 26,015,465 M39K probably benign Het
Gabra4 A G 5: 71,571,992 S482P probably benign Het
Gapdhs G A 7: 30,737,958 P61S unknown Het
Gm10153 A T 7: 142,189,664 C242* probably null Het
Gp1ba A G 11: 70,640,094 I229V unknown Het
Grap2 T A 15: 80,643,704 L117Q probably damaging Het
Grik5 A G 7: 25,013,885 I766T possibly damaging Het
Hrh3 A T 2: 180,101,286 I183N probably damaging Het
Htr5a C A 5: 27,842,895 Y149* probably null Het
Ibtk T C 9: 85,722,300 I527V probably benign Het
Il33 T A 19: 29,956,941 S184R probably damaging Het
Kansl3 T A 1: 36,365,587 Q94L possibly damaging Het
Kcnh6 A G 11: 106,017,416 D286G probably benign Het
Kmt2e T A 5: 23,478,587 M281K probably damaging Het
Lrp2 T A 2: 69,516,403 H833L probably damaging Het
Meis1 A T 11: 18,941,702 V282E probably damaging Het
Mfsd8 T G 3: 40,830,662 D240A probably damaging Het
Muc5b A G 7: 141,847,249 T534A unknown Het
Myo18b G A 5: 112,830,328 L1243F probably damaging Het
Nefl A G 14: 68,084,674 I238V probably benign Het
Nexn T A 3: 152,253,647 I62F possibly damaging Het
Notch4 T C 17: 34,583,574 L1323P probably damaging Het
Olfr493 A T 7: 108,346,482 F166L probably benign Het
Olfr555 T C 7: 102,659,051 S77P probably damaging Het
Olfr906 T C 9: 38,488,656 V209A probably benign Het
Patj C A 4: 98,568,980 H1244N probably damaging Het
Peg10 T A 6: 4,756,082 D219E unknown Het
Pi4kb G T 3: 94,999,114 probably null Het
Piezo1 A G 8: 122,498,418 F614S Het
Pisd T A 5: 32,737,337 N372Y probably damaging Het
Piwil4 T C 9: 14,734,597 D178G probably benign Het
Plekho1 G T 3: 95,989,254 P301Q probably damaging Het
Pop1 T A 15: 34,528,947 W738R probably null Het
Ppp4r1 C T 17: 65,810,616 P125L possibly damaging Het
Prdm9 T A 17: 15,563,264 N13I probably damaging Het
Psd4 T G 2: 24,407,011 V932G probably damaging Het
Ptger3 T C 3: 157,641,775 S355P probably benign Het
Ptprb T C 10: 116,339,430 V823A probably damaging Het
Ptprj C T 2: 90,455,186 V841I probably benign Het
Ranbp3 T C 17: 56,707,923 S281P probably benign Het
Rasal3 T A 17: 32,395,861 M541L possibly damaging Het
Rassf1 A G 9: 107,551,783 T63A possibly damaging Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rgs4 G A 1: 169,744,358 T124I probably damaging Het
Rspo2 T A 15: 43,169,976 probably benign Het
Scgn T C 13: 23,953,914 D258G probably damaging Het
Shkbp1 A G 7: 27,347,131 S403P possibly damaging Het
Slc25a13 A G 6: 6,052,785 L525P probably damaging Het
Snd1 G T 6: 28,526,203 K193N possibly damaging Het
Sntg2 C T 12: 30,175,202 A516T probably damaging Het
Stard13 A G 5: 151,059,502 I699T probably damaging Het
Svil T A 18: 5,114,636 V1984D probably damaging Het
Swt1 A G 1: 151,394,719 S582P probably benign Het
Sypl2 A G 3: 108,214,538 *265Q probably null Het
Taar8a T A 10: 24,077,408 Y303* probably null Het
Tlr2 T A 3: 83,836,542 I745F probably damaging Het
Tnrc6b A G 15: 80,929,393 T1784A probably benign Het
Tpo C A 12: 30,119,432 M101I probably benign Het
Trpm2 G T 10: 77,937,950 R544S probably benign Het
Ttc14 A G 3: 33,809,251 R603G unknown Het
Tubgcp6 A C 15: 89,100,722 V1694G probably damaging Het
Uba6 C A 5: 86,147,111 K356N probably benign Het
Usp16 T C 16: 87,464,835 V113A possibly damaging Het
Vcam1 G A 3: 116,114,383 Q677* probably null Het
Vmn1r238 T A 18: 3,122,721 E231V probably damaging Het
Vmn1r70 T C 7: 10,633,944 F120L probably benign Het
Vmn2r116 T A 17: 23,384,856 probably null Het
Vmn2r5 A T 3: 64,504,404 C248S probably damaging Het
Vmn2r87 A T 10: 130,479,071 D215E probably damaging Het
Xkr4 T G 1: 3,670,688 I221L probably benign Het
Zfp366 T C 13: 99,246,387 I686T probably benign Het
Zfp398 T A 6: 47,866,732 C573S probably damaging Het
Other mutations in Acan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Acan APN 7 79097824 missense probably benign 0.00
IGL01118:Acan APN 7 79098653 missense possibly damaging 0.78
IGL01145:Acan APN 7 79099282 missense probably damaging 1.00
IGL01308:Acan APN 7 79099249 missense probably damaging 0.98
IGL01520:Acan APN 7 79084570 missense probably damaging 0.96
IGL02069:Acan APN 7 79092752 missense possibly damaging 0.83
IGL02629:Acan APN 7 79111979 missense possibly damaging 0.90
IGL02713:Acan APN 7 79100244 missense possibly damaging 0.90
IGL03001:Acan APN 7 79111294 missense probably damaging 0.99
IGL03081:Acan APN 7 79098543 missense probably benign 0.01
Hollowleg UTSW 7 79098348 nonsense probably null
Sublimate UTSW 7 79111320 missense probably damaging 0.97
Vacuo UTSW 7 79088307 critical splice donor site probably null
IGL03147:Acan UTSW 7 79091056 missense probably damaging 1.00
R0281:Acan UTSW 7 79100285 missense probably damaging 1.00
R0372:Acan UTSW 7 79100601 missense probably benign 0.00
R0599:Acan UTSW 7 79111290 splice site probably benign
R0827:Acan UTSW 7 79099671 missense probably benign 0.00
R0835:Acan UTSW 7 79114232 missense probably damaging 0.96
R1496:Acan UTSW 7 79100804 missense probably benign 0.06
R1716:Acan UTSW 7 79082198 missense unknown
R1761:Acan UTSW 7 79094085 nonsense probably null
R1848:Acan UTSW 7 79099035 missense probably benign
R2002:Acan UTSW 7 79100793 missense probably damaging 1.00
R2025:Acan UTSW 7 79101222 missense probably benign
R2167:Acan UTSW 7 79099957 missense probably benign 0.41
R2189:Acan UTSW 7 79098091 missense probably damaging 1.00
R2303:Acan UTSW 7 79099957 missense probably benign 0.41
R2496:Acan UTSW 7 79111317 missense probably damaging 1.00
R2971:Acan UTSW 7 79099699 missense possibly damaging 0.46
R4004:Acan UTSW 7 79100687 missense probably damaging 1.00
R4669:Acan UTSW 7 79101142 missense probably benign 0.01
R4732:Acan UTSW 7 79098609 missense probably damaging 0.99
R4733:Acan UTSW 7 79098609 missense probably damaging 0.99
R4742:Acan UTSW 7 79100769 missense probably benign 0.41
R4750:Acan UTSW 7 79092718 missense probably damaging 1.00
R5022:Acan UTSW 7 79092808 critical splice donor site probably null
R5122:Acan UTSW 7 79100661 missense probably damaging 0.99
R5190:Acan UTSW 7 79098541 missense probably benign 0.03
R5220:Acan UTSW 7 79088297 missense probably damaging 0.96
R5414:Acan UTSW 7 79100988 missense probably benign 0.00
R5525:Acan UTSW 7 79099983 missense probably benign
R5655:Acan UTSW 7 79100043 missense possibly damaging 0.89
R5662:Acan UTSW 7 79100107 missense possibly damaging 0.78
R5748:Acan UTSW 7 79089699 missense probably damaging 0.98
R5758:Acan UTSW 7 79101214 missense possibly damaging 0.67
R5996:Acan UTSW 7 79111320 missense probably damaging 0.97
R6057:Acan UTSW 7 79099782 missense probably null
R6503:Acan UTSW 7 79097832 missense probably benign 0.04
R6529:Acan UTSW 7 79089731 missense probably benign 0.16
R6887:Acan UTSW 7 79092483 missense probably damaging 1.00
R7041:Acan UTSW 7 79098348 nonsense probably null
R7193:Acan UTSW 7 79086342 missense probably damaging 1.00
R7220:Acan UTSW 7 79108148 missense
R7263:Acan UTSW 7 79092318 missense probably damaging 0.98
R7376:Acan UTSW 7 79088307 critical splice donor site probably null
R7502:Acan UTSW 7 79094203 missense probably damaging 1.00
R7709:Acan UTSW 7 79089608 missense probably damaging 1.00
R7835:Acan UTSW 7 79099875 missense probably benign 0.08
R8051:Acan UTSW 7 79100779 missense probably damaging 0.96
R8131:Acan UTSW 7 79091338 missense possibly damaging 0.92
R8138:Acan UTSW 7 79098427 missense probably benign 0.12
R8324:Acan UTSW 7 79091056 missense probably damaging 1.00
RF008:Acan UTSW 7 79092400 missense possibly damaging 0.83
Z1088:Acan UTSW 7 79088200 nonsense probably null
Z1088:Acan UTSW 7 79100110 missense probably benign 0.41
Z1088:Acan UTSW 7 79111354 missense probably benign
Z1176:Acan UTSW 7 79111354 missense probably benign
Z1177:Acan UTSW 7 79094170 missense probably damaging 0.96
Z1177:Acan UTSW 7 79100137 missense probably damaging 0.99
Z1177:Acan UTSW 7 79111354 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCAAGAGCAAACTTCAGTTG -3'
(R):5'- AGTCTCACCTGACTGTCTGG -3'

Sequencing Primer
(F):5'- CTAAGGATCTATTGGCAGCCGATC -3'
(R):5'- GTCAGCCAGCCAGCCTG -3'
Posted On2019-10-17