Incidental Mutation 'R7571:Dync2h1'
ID585842
Institutional Source Beutler Lab
Gene Symbol Dync2h1
Ensembl Gene ENSMUSG00000047193
Gene Namedynein cytoplasmic 2 heavy chain 1
Synonyms4432416O06Rik, DHC2, D030010H02Rik, D330044F14Rik, Dnchc2, DHC1b, b2b414Clo
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7571 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location6928503-7184446 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7002623 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 3808 (L3808P)
Ref Sequence ENSEMBL: ENSMUSP00000046733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048417] [ENSMUST00000140466] [ENSMUST00000147193]
Predicted Effect probably damaging
Transcript: ENSMUST00000048417
AA Change: L3808P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046733
Gene: ENSMUSG00000047193
AA Change: L3808P

DomainStartEndE-ValueType
Pfam:DHC_N1 187 676 1.6e-43 PFAM
Pfam:DHC_N2 1117 1523 4.1e-120 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2881 6.8e-27 PFAM
Pfam:MT 2894 3230 5.4e-28 PFAM
Pfam:AAA_9 3242 3471 1.1e-50 PFAM
Pfam:Dynein_heavy 3605 4304 2.3e-136 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000140466
AA Change: L3808P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120007
Gene: ENSMUSG00000047193
AA Change: L3808P

DomainStartEndE-ValueType
Pfam:DHC_N1 187 676 1.6e-43 PFAM
Pfam:DHC_N2 1117 1523 4.1e-120 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2881 6.8e-27 PFAM
Pfam:MT 2894 3230 5.4e-28 PFAM
Pfam:AAA_9 3242 3471 1.1e-50 PFAM
Pfam:Dynein_heavy 3605 4304 2.3e-136 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000147193
AA Change: L3815P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116679
Gene: ENSMUSG00000047193
AA Change: L3815P

DomainStartEndE-ValueType
Pfam:DHC_N1 188 674 4e-45 PFAM
Pfam:DHC_N2 1118 1521 5.5e-111 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2880 4.4e-27 PFAM
Pfam:MT 2894 3230 1.3e-27 PFAM
Pfam:AAA_9 3246 3477 1e-79 PFAM
Pfam:Dynein_heavy 3618 4310 8.5e-158 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large cytoplasmic dynein protein that is involved in retrograde transport in the cilium and has a role in intraflagellar transport, a process required for ciliary/flagellar assembly. Mutations in this gene cause a heterogeneous spectrum of conditions related to altered primary cilium function and often involve polydactyly, abnormal skeletogenesis, and polycystic kidneys. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for a gene trap allele show complete embryonic lethality with altered heart looping and brain morphology. Chemically induced mutants show randomized heart looping and polydactyly. Holoprosencephaly or exencephaly, micrognathia, and cardiac, renal, airway and eye defects may be observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C02Rik A T 5: 30,482,158 E143V possibly damaging Het
Abca16 A T 7: 120,519,988 N985I probably benign Het
Abi3bp T A 16: 56,630,982 probably null Het
Acad12 A T 5: 121,607,194 Y309* probably null Het
Acadsb G T 7: 131,443,554 R405L probably damaging Het
Acan G A 7: 79,086,267 V154M probably damaging Het
Adam22 G A 5: 8,082,160 R894* probably null Het
Ahnak A T 19: 9,000,786 K90* probably null Het
Ak4 T C 4: 101,460,542 I103T probably benign Het
Ap4e1 C T 2: 127,019,336 L132F probably damaging Het
Apol7b C T 15: 77,423,477 V273I probably benign Het
Arhgef37 T A 18: 61,504,332 I420F probably damaging Het
Atg13 C T 2: 91,680,342 probably null Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Cabin1 A T 10: 75,646,666 S2148T probably damaging Het
Cacna1i T C 15: 80,375,336 V1269A probably damaging Het
Cdipt T C 7: 126,979,622 I195T probably benign Het
Ces2b A T 8: 104,835,009 H245L probably damaging Het
Clstn1 T G 4: 149,646,287 M825R probably benign Het
Cntn3 G A 6: 102,278,403 T178I probably damaging Het
Col7a1 A G 9: 108,982,707 M2789V probably null Het
Col9a2 A T 4: 121,039,784 I24F unknown Het
Cpne2 T C 8: 94,551,780 M134T probably benign Het
Cpt1b A G 15: 89,421,343 probably null Het
Crocc T C 4: 141,046,049 probably null Het
Cts8 T C 13: 61,248,167 Y330C probably damaging Het
Cwc22 T C 2: 77,917,067 D434G probably benign Het
Cyp3a13 T C 5: 137,898,863 I396M possibly damaging Het
D430042O09Rik C T 7: 125,708,021 probably benign Het
D5Ertd577e A T 5: 95,482,960 N232I probably damaging Het
Ddr2 A T 1: 170,001,851 I278N probably benign Het
Dnaaf5 A G 5: 139,170,208 E548G possibly damaging Het
Faf2 T A 13: 54,650,214 W209R probably damaging Het
Fam129a T C 1: 151,718,297 V911A probably benign Het
Fam208b T C 13: 3,575,292 T1553A probably benign Het
Fbln2 A T 6: 91,268,575 E992D probably damaging Het
Fdxacb1 T A 9: 50,771,793 V352D probably damaging Het
Flg2 G T 3: 93,219,996 G2072* probably null Het
Flii A T 11: 60,721,136 L347Q probably damaging Het
Fndc3a A T 14: 72,589,896 H116Q probably damaging Het
Fnta A T 8: 26,015,465 M39K probably benign Het
Gabra4 A G 5: 71,571,992 S482P probably benign Het
Gapdhs G A 7: 30,737,958 P61S unknown Het
Gm10153 A T 7: 142,189,664 C242* probably null Het
Gp1ba A G 11: 70,640,094 I229V unknown Het
Grap2 T A 15: 80,643,704 L117Q probably damaging Het
Grik5 A G 7: 25,013,885 I766T possibly damaging Het
Hrh3 A T 2: 180,101,286 I183N probably damaging Het
Htr5a C A 5: 27,842,895 Y149* probably null Het
Ibtk T C 9: 85,722,300 I527V probably benign Het
Il33 T A 19: 29,956,941 S184R probably damaging Het
Kansl3 T A 1: 36,365,587 Q94L possibly damaging Het
Kcnh6 A G 11: 106,017,416 D286G probably benign Het
Kmt2e T A 5: 23,478,587 M281K probably damaging Het
Lrp2 T A 2: 69,516,403 H833L probably damaging Het
Meis1 A T 11: 18,941,702 V282E probably damaging Het
Mfsd8 T G 3: 40,830,662 D240A probably damaging Het
Muc5b A G 7: 141,847,249 T534A unknown Het
Myo18b G A 5: 112,830,328 L1243F probably damaging Het
Nefl A G 14: 68,084,674 I238V probably benign Het
Nexn T A 3: 152,253,647 I62F possibly damaging Het
Notch4 T C 17: 34,583,574 L1323P probably damaging Het
Olfr493 A T 7: 108,346,482 F166L probably benign Het
Olfr555 T C 7: 102,659,051 S77P probably damaging Het
Olfr906 T C 9: 38,488,656 V209A probably benign Het
Patj C A 4: 98,568,980 H1244N probably damaging Het
Peg10 T A 6: 4,756,082 D219E unknown Het
Pi4kb G T 3: 94,999,114 probably null Het
Piezo1 A G 8: 122,498,418 F614S Het
Pisd T A 5: 32,737,337 N372Y probably damaging Het
Piwil4 T C 9: 14,734,597 D178G probably benign Het
Plekho1 G T 3: 95,989,254 P301Q probably damaging Het
Pop1 T A 15: 34,528,947 W738R probably null Het
Ppp4r1 C T 17: 65,810,616 P125L possibly damaging Het
Prdm9 T A 17: 15,563,264 N13I probably damaging Het
Psd4 T G 2: 24,407,011 V932G probably damaging Het
Ptger3 T C 3: 157,641,775 S355P probably benign Het
Ptprb T C 10: 116,339,430 V823A probably damaging Het
Ptprj C T 2: 90,455,186 V841I probably benign Het
Ranbp3 T C 17: 56,707,923 S281P probably benign Het
Rasal3 T A 17: 32,395,861 M541L possibly damaging Het
Rassf1 A G 9: 107,551,783 T63A possibly damaging Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rgs4 G A 1: 169,744,358 T124I probably damaging Het
Rspo2 T A 15: 43,169,976 probably benign Het
Scgn T C 13: 23,953,914 D258G probably damaging Het
Shkbp1 A G 7: 27,347,131 S403P possibly damaging Het
Slc25a13 A G 6: 6,052,785 L525P probably damaging Het
Snd1 G T 6: 28,526,203 K193N possibly damaging Het
Sntg2 C T 12: 30,175,202 A516T probably damaging Het
Stard13 A G 5: 151,059,502 I699T probably damaging Het
Svil T A 18: 5,114,636 V1984D probably damaging Het
Swt1 A G 1: 151,394,719 S582P probably benign Het
Sypl2 A G 3: 108,214,538 *265Q probably null Het
Taar8a T A 10: 24,077,408 Y303* probably null Het
Tlr2 T A 3: 83,836,542 I745F probably damaging Het
Tnrc6b A G 15: 80,929,393 T1784A probably benign Het
Tpo C A 12: 30,119,432 M101I probably benign Het
Trpm2 G T 10: 77,937,950 R544S probably benign Het
Ttc14 A G 3: 33,809,251 R603G unknown Het
Tubgcp6 A C 15: 89,100,722 V1694G probably damaging Het
Uba6 C A 5: 86,147,111 K356N probably benign Het
Usp16 T C 16: 87,464,835 V113A possibly damaging Het
Vcam1 G A 3: 116,114,383 Q677* probably null Het
Vmn1r238 T A 18: 3,122,721 E231V probably damaging Het
Vmn1r70 T C 7: 10,633,944 F120L probably benign Het
Vmn2r116 T A 17: 23,384,856 probably null Het
Vmn2r5 A T 3: 64,504,404 C248S probably damaging Het
Vmn2r87 A T 10: 130,479,071 D215E probably damaging Het
Xkr4 T G 1: 3,670,688 I221L probably benign Het
Zfp366 T C 13: 99,246,387 I686T probably benign Het
Zfp398 T A 6: 47,866,732 C573S probably damaging Het
Other mutations in Dync2h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Dync2h1 APN 9 7158839 missense probably benign 0.42
IGL00310:Dync2h1 APN 9 7155072 splice site probably benign
IGL00499:Dync2h1 APN 9 7168700 missense possibly damaging 0.95
IGL00579:Dync2h1 APN 9 7035728 splice site probably benign
IGL00660:Dync2h1 APN 9 7075797 missense probably damaging 0.98
IGL00964:Dync2h1 APN 9 7174881 splice site probably benign
IGL01025:Dync2h1 APN 9 7162789 missense probably damaging 1.00
IGL01093:Dync2h1 APN 9 7145611 missense probably benign 0.01
IGL01108:Dync2h1 APN 9 7176771 missense possibly damaging 0.87
IGL01126:Dync2h1 APN 9 7116588 missense probably benign 0.00
IGL01474:Dync2h1 APN 9 7102493 missense probably benign 0.01
IGL01531:Dync2h1 APN 9 7071111 missense probably benign 0.11
IGL01548:Dync2h1 APN 9 7071922 missense probably damaging 1.00
IGL01621:Dync2h1 APN 9 7140897 critical splice donor site probably null
IGL01672:Dync2h1 APN 9 7118884 nonsense probably null
IGL01681:Dync2h1 APN 9 7142196 splice site probably null
IGL01685:Dync2h1 APN 9 7142297 missense probably damaging 1.00
IGL01724:Dync2h1 APN 9 7081077 missense probably benign 0.03
IGL01738:Dync2h1 APN 9 7114922 missense possibly damaging 0.77
IGL01783:Dync2h1 APN 9 7118822 unclassified probably benign
IGL01813:Dync2h1 APN 9 7122799 missense probably damaging 1.00
IGL01931:Dync2h1 APN 9 7114973 missense probably damaging 1.00
IGL01931:Dync2h1 APN 9 7011207 missense probably benign 0.33
IGL02105:Dync2h1 APN 9 7075892 missense probably damaging 1.00
IGL02137:Dync2h1 APN 9 7134349 missense probably benign
IGL02140:Dync2h1 APN 9 7147791 missense probably benign
IGL02175:Dync2h1 APN 9 7111548 missense possibly damaging 0.91
IGL02283:Dync2h1 APN 9 7125912 missense probably damaging 0.99
IGL02305:Dync2h1 APN 9 7122678 missense probably benign
IGL02342:Dync2h1 APN 9 7142246 missense probably damaging 1.00
IGL02367:Dync2h1 APN 9 7158926 missense probably damaging 0.98
IGL02458:Dync2h1 APN 9 7117422 missense probably damaging 1.00
IGL02563:Dync2h1 APN 9 7035700 missense possibly damaging 0.95
IGL02825:Dync2h1 APN 9 6955901 splice site probably benign
IGL02955:Dync2h1 APN 9 7142864 missense probably benign 0.00
IGL02992:Dync2h1 APN 9 7137074 missense probably benign 0.01
IGL02996:Dync2h1 APN 9 6935279 missense probably damaging 0.99
IGL03224:Dync2h1 APN 9 7076235 missense probably benign 0.32
IGL03226:Dync2h1 APN 9 7125918 missense probably benign
IGL03233:Dync2h1 APN 9 7101525 missense possibly damaging 0.90
deinonychus UTSW 9 7159478 splice site probably null
R0016:Dync2h1 UTSW 9 7144346 splice site probably benign
R0016:Dync2h1 UTSW 9 7144346 splice site probably benign
R0043:Dync2h1 UTSW 9 7005574 missense probably benign 0.05
R0109:Dync2h1 UTSW 9 7111487 missense probably damaging 1.00
R0109:Dync2h1 UTSW 9 7111487 missense probably damaging 1.00
R0121:Dync2h1 UTSW 9 7001327 splice site probably benign
R0277:Dync2h1 UTSW 9 7129046 missense probably benign
R0360:Dync2h1 UTSW 9 7113182 missense possibly damaging 0.62
R0362:Dync2h1 UTSW 9 7005487 splice site probably null
R0389:Dync2h1 UTSW 9 7167244 splice site probably null
R0443:Dync2h1 UTSW 9 7167244 splice site probably null
R0496:Dync2h1 UTSW 9 7155180 missense probably benign 0.42
R0506:Dync2h1 UTSW 9 7113153 missense probably benign 0.05
R0511:Dync2h1 UTSW 9 7122692 missense probably benign 0.00
R0540:Dync2h1 UTSW 9 7051480 missense probably benign 0.00
R0550:Dync2h1 UTSW 9 7120954 intron probably null
R0564:Dync2h1 UTSW 9 7139432 missense probably damaging 1.00
R0607:Dync2h1 UTSW 9 7051480 missense probably benign 0.00
R0699:Dync2h1 UTSW 9 7103680 missense probably benign 0.00
R0725:Dync2h1 UTSW 9 7015497 missense possibly damaging 0.93
R0835:Dync2h1 UTSW 9 7116642 critical splice acceptor site probably null
R0837:Dync2h1 UTSW 9 7077979 missense probably benign 0.07
R0894:Dync2h1 UTSW 9 7041734 splice site probably benign
R0938:Dync2h1 UTSW 9 7002658 missense probably benign 0.02
R1056:Dync2h1 UTSW 9 7147731 missense probably benign 0.15
R1081:Dync2h1 UTSW 9 7005488 critical splice donor site probably null
R1178:Dync2h1 UTSW 9 7101193 splice site probably benign
R1243:Dync2h1 UTSW 9 7120882 missense probably benign
R1295:Dync2h1 UTSW 9 7075752 splice site probably benign
R1304:Dync2h1 UTSW 9 7102318 missense probably damaging 1.00
R1387:Dync2h1 UTSW 9 7125816 missense probably benign
R1513:Dync2h1 UTSW 9 7103663 missense possibly damaging 0.74
R1557:Dync2h1 UTSW 9 7140911 missense probably damaging 1.00
R1568:Dync2h1 UTSW 9 7157553 missense probably null 0.02
R1570:Dync2h1 UTSW 9 7176926 missense probably benign 0.12
R1670:Dync2h1 UTSW 9 6993942 missense possibly damaging 0.82
R1713:Dync2h1 UTSW 9 7131891 missense probably benign
R1766:Dync2h1 UTSW 9 7015526 critical splice acceptor site probably null
R1773:Dync2h1 UTSW 9 7128256 missense probably damaging 1.00
R1786:Dync2h1 UTSW 9 7081084 missense probably damaging 1.00
R1848:Dync2h1 UTSW 9 7049166 missense probably benign 0.01
R1850:Dync2h1 UTSW 9 7001448 missense probably benign 0.00
R1935:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1936:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1937:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1939:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1940:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1944:Dync2h1 UTSW 9 7001377 missense probably damaging 1.00
R1976:Dync2h1 UTSW 9 7129045 missense probably benign
R2012:Dync2h1 UTSW 9 7169589 missense probably benign 0.00
R2020:Dync2h1 UTSW 9 7122772 missense probably damaging 0.99
R2020:Dync2h1 UTSW 9 7162925 missense probably benign 0.25
R2024:Dync2h1 UTSW 9 7129062 missense probably damaging 0.97
R2038:Dync2h1 UTSW 9 6967226 missense probably damaging 0.99
R2045:Dync2h1 UTSW 9 7160171 missense probably damaging 1.00
R2060:Dync2h1 UTSW 9 7162802 missense possibly damaging 0.92
R2094:Dync2h1 UTSW 9 7148735 missense probably benign 0.18
R2129:Dync2h1 UTSW 9 7175289 missense possibly damaging 0.94
R2130:Dync2h1 UTSW 9 7011253 missense probably damaging 1.00
R2136:Dync2h1 UTSW 9 7122772 missense probably damaging 0.99
R2164:Dync2h1 UTSW 9 7124797 missense probably damaging 1.00
R2242:Dync2h1 UTSW 9 7037828 splice site probably null
R2255:Dync2h1 UTSW 9 6955905 critical splice donor site probably null
R2357:Dync2h1 UTSW 9 7081053 missense probably benign 0.03
R2389:Dync2h1 UTSW 9 7122618 missense possibly damaging 0.82
R2412:Dync2h1 UTSW 9 7144246 missense probably benign 0.01
R2885:Dync2h1 UTSW 9 7102329 missense probably damaging 1.00
R2909:Dync2h1 UTSW 9 7049114 missense probably damaging 1.00
R3434:Dync2h1 UTSW 9 7011236 missense probably benign
R3719:Dync2h1 UTSW 9 7006882 splice site probably benign
R3723:Dync2h1 UTSW 9 7041658 missense probably benign 0.17
R3800:Dync2h1 UTSW 9 7101525 missense possibly damaging 0.90
R3803:Dync2h1 UTSW 9 6935293 missense probably benign 0.00
R3936:Dync2h1 UTSW 9 7001482 missense probably damaging 1.00
R3941:Dync2h1 UTSW 9 7124825 missense probably benign
R3950:Dync2h1 UTSW 9 7112061 nonsense probably null
R4004:Dync2h1 UTSW 9 7117404 missense probably damaging 1.00
R4091:Dync2h1 UTSW 9 7131881 missense probably benign 0.01
R4233:Dync2h1 UTSW 9 7134360 missense probably benign 0.02
R4302:Dync2h1 UTSW 9 7077880 missense probably benign 0.02
R4451:Dync2h1 UTSW 9 6983477 missense probably benign 0.02
R4512:Dync2h1 UTSW 9 7085009 nonsense probably null
R4596:Dync2h1 UTSW 9 6992595 missense probably benign
R4604:Dync2h1 UTSW 9 7140995 missense probably benign 0.00
R4614:Dync2h1 UTSW 9 7011290 missense probably benign 0.03
R4667:Dync2h1 UTSW 9 7051411 missense probably benign 0.00
R4671:Dync2h1 UTSW 9 7169640 missense possibly damaging 0.82
R4714:Dync2h1 UTSW 9 7118932 missense possibly damaging 0.86
R4716:Dync2h1 UTSW 9 7142648 critical splice donor site probably null
R4736:Dync2h1 UTSW 9 7006862 missense probably benign 0.00
R4807:Dync2h1 UTSW 9 7139422 missense probably benign 0.31
R4850:Dync2h1 UTSW 9 7134364 missense probably benign 0.14
R4862:Dync2h1 UTSW 9 7147717 missense probably benign
R4899:Dync2h1 UTSW 9 7131921 nonsense probably null
R4971:Dync2h1 UTSW 9 7131949 missense probably benign
R5040:Dync2h1 UTSW 9 6992625 missense probably benign 0.09
R5054:Dync2h1 UTSW 9 7085007 missense possibly damaging 0.63
R5274:Dync2h1 UTSW 9 7116540 missense probably benign 0.00
R5307:Dync2h1 UTSW 9 7155099 missense probably damaging 1.00
R5347:Dync2h1 UTSW 9 7129727 missense probably damaging 1.00
R5372:Dync2h1 UTSW 9 7176962 unclassified probably benign
R5384:Dync2h1 UTSW 9 7016791 missense probably damaging 0.99
R5385:Dync2h1 UTSW 9 7016791 missense probably damaging 0.99
R5394:Dync2h1 UTSW 9 7120899 nonsense probably null
R5402:Dync2h1 UTSW 9 7114949 missense probably damaging 1.00
R5446:Dync2h1 UTSW 9 7144217 missense probably benign
R5538:Dync2h1 UTSW 9 7168630 intron probably benign
R5551:Dync2h1 UTSW 9 7031718 missense possibly damaging 0.74
R5619:Dync2h1 UTSW 9 7118885 missense probably benign 0.02
R5621:Dync2h1 UTSW 9 7120909 missense possibly damaging 0.86
R5652:Dync2h1 UTSW 9 7116638 missense probably benign 0.45
R5655:Dync2h1 UTSW 9 7148659 missense probably benign 0.01
R5689:Dync2h1 UTSW 9 7169689 missense probably damaging 1.00
R5725:Dync2h1 UTSW 9 7169528 missense probably benign 0.21
R5742:Dync2h1 UTSW 9 7165762 missense possibly damaging 0.64
R5817:Dync2h1 UTSW 9 6996905 missense probably damaging 1.00
R5852:Dync2h1 UTSW 9 7011290 missense probably benign 0.03
R5898:Dync2h1 UTSW 9 7148717 missense probably benign 0.00
R5916:Dync2h1 UTSW 9 7102309 critical splice donor site probably null
R5939:Dync2h1 UTSW 9 7037801 missense probably damaging 0.99
R5942:Dync2h1 UTSW 9 7117466 nonsense probably null
R5982:Dync2h1 UTSW 9 6955986 missense probably benign 0.00
R6029:Dync2h1 UTSW 9 7157646 missense probably benign
R6125:Dync2h1 UTSW 9 7168706 missense probably damaging 1.00
R6209:Dync2h1 UTSW 9 7165677 missense probably benign 0.01
R6247:Dync2h1 UTSW 9 7135078 missense probably damaging 1.00
R6294:Dync2h1 UTSW 9 7084986 missense probably benign 0.01
R6328:Dync2h1 UTSW 9 7165717 missense probably benign 0.00
R6376:Dync2h1 UTSW 9 7165703 missense probably benign 0.21
R6394:Dync2h1 UTSW 9 7168331 missense probably damaging 0.99
R6539:Dync2h1 UTSW 9 7159478 splice site probably null
R6554:Dync2h1 UTSW 9 7037699 missense probably benign 0.39
R6559:Dync2h1 UTSW 9 7139501 missense possibly damaging 0.72
R6563:Dync2h1 UTSW 9 7120819 missense probably benign 0.27
R6807:Dync2h1 UTSW 9 7041718 missense probably benign 0.10
R6848:Dync2h1 UTSW 9 7159632 missense probably benign 0.22
R6901:Dync2h1 UTSW 9 7131855 missense probably damaging 1.00
R6921:Dync2h1 UTSW 9 7102549 missense probably benign
R6997:Dync2h1 UTSW 9 7168743 missense probably null 0.00
R7084:Dync2h1 UTSW 9 7113214 missense possibly damaging 0.72
R7113:Dync2h1 UTSW 9 7075788 missense probably benign 0.03
R7131:Dync2h1 UTSW 9 7075786 missense probably damaging 1.00
R7165:Dync2h1 UTSW 9 7050479 missense probably benign
R7196:Dync2h1 UTSW 9 7147715 nonsense probably null
R7208:Dync2h1 UTSW 9 7141059 missense probably damaging 1.00
R7225:Dync2h1 UTSW 9 7142756 missense probably benign
R7237:Dync2h1 UTSW 9 6993966 missense probably benign 0.00
R7243:Dync2h1 UTSW 9 7102405 missense possibly damaging 0.64
R7291:Dync2h1 UTSW 9 6929590 missense possibly damaging 0.69
R7293:Dync2h1 UTSW 9 7001454 missense possibly damaging 0.88
R7329:Dync2h1 UTSW 9 7011247 missense probably benign
R7351:Dync2h1 UTSW 9 7167145 missense probably damaging 1.00
R7358:Dync2h1 UTSW 9 7159479 critical splice donor site probably null
R7387:Dync2h1 UTSW 9 7157932 missense possibly damaging 0.68
R7446:Dync2h1 UTSW 9 7041720 missense probably benign 0.03
R7487:Dync2h1 UTSW 9 7132041 missense probably benign 0.26
R7488:Dync2h1 UTSW 9 7124855 missense probably benign 0.03
R7496:Dync2h1 UTSW 9 7135015 splice site probably null
R7501:Dync2h1 UTSW 9 7175336 missense possibly damaging 0.82
R7627:Dync2h1 UTSW 9 7101111 missense probably benign 0.00
R7639:Dync2h1 UTSW 9 7141254 missense probably damaging 0.97
R7653:Dync2h1 UTSW 9 7117570 missense probably benign
R7654:Dync2h1 UTSW 9 7122664 missense probably damaging 1.00
R7742:Dync2h1 UTSW 9 7076232 missense probably benign 0.00
R7755:Dync2h1 UTSW 9 7015490 missense probably benign 0.00
R7762:Dync2h1 UTSW 9 7129719 missense probably benign 0.01
R7790:Dync2h1 UTSW 9 7114914 missense probably damaging 0.96
R7834:Dync2h1 UTSW 9 7118953 missense probably benign 0.04
R7883:Dync2h1 UTSW 9 7005566 missense possibly damaging 0.80
R7917:Dync2h1 UTSW 9 7118953 missense probably benign 0.04
R7966:Dync2h1 UTSW 9 7005566 missense possibly damaging 0.80
X0009:Dync2h1 UTSW 9 7117576 missense possibly damaging 0.81
Z1176:Dync2h1 UTSW 9 7142361 missense probably damaging 0.99
Z1176:Dync2h1 UTSW 9 7168730 frame shift probably null
Z1177:Dync2h1 UTSW 9 7102427 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATTTTCTATTGTGGAATTTGGCTTC -3'
(R):5'- TGGATGTCAGCTCAGGGTAAC -3'

Sequencing Primer
(F):5'- CTATTGTGGAATTTGGCTTCTTTTC -3'
(R):5'- CAGGGTAACTGCTTTCAGATGC -3'
Posted On2019-10-17