Incidental Mutation 'R7571:Pop1'
ID 585867
Institutional Source Beutler Lab
Gene Symbol Pop1
Ensembl Gene ENSMUSG00000022325
Gene Name processing of precursor 1, ribonuclease P/MRP family, (S. cerevisiae)
Synonyms 4932434G09Rik
MMRRC Submission 045711-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.957) question?
Stock # R7571 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 34495457-34530799 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 34529093 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 738 (W738R)
Ref Sequence ENSEMBL: ENSMUSP00000052654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052290] [ENSMUST00000079028]
AlphaFold Q8K205
Predicted Effect probably null
Transcript: ENSMUST00000052290
AA Change: W738R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052654
Gene: ENSMUSG00000022325
AA Change: W738R

DomainStartEndE-ValueType
Pfam:POP1 107 190 6.2e-21 PFAM
Pfam:POP1 179 257 2.5e-23 PFAM
low complexity region 382 387 N/A INTRINSIC
Pfam:POPLD 647 738 1.4e-30 PFAM
low complexity region 931 940 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000079028
AA Change: W708R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078037
Gene: ENSMUSG00000022325
AA Change: W708R

DomainStartEndE-ValueType
Pfam:POP1 107 258 1e-46 PFAM
low complexity region 382 387 N/A INTRINSIC
Pfam:POPLD 617 708 1.2e-34 PFAM
low complexity region 901 910 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the protein subunit of two different small nucleolar ribonucleoprotein complexes: the endoribonuclease for mitochondrial RNA processing complex and the ribonuclease P complex. The encoded protein is a ribonuclease that localizes to the nucleus and functions in pre-RNA processing. This protein is also an autoantigen in patients suffering from connective tissue diseases. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,119,211 (GRCm39) N985I probably benign Het
Abi3bp T A 16: 56,451,345 (GRCm39) probably null Het
Acad12 A T 5: 121,745,257 (GRCm39) Y309* probably null Het
Acadsb G T 7: 131,045,283 (GRCm39) R405L probably damaging Het
Acan G A 7: 78,736,015 (GRCm39) V154M probably damaging Het
Adam22 G A 5: 8,132,160 (GRCm39) R894* probably null Het
Ahnak A T 19: 8,978,150 (GRCm39) K90* probably null Het
Ak4 T C 4: 101,317,739 (GRCm39) I103T probably benign Het
Ap4e1 C T 2: 126,861,256 (GRCm39) L132F probably damaging Het
Apol7b C T 15: 77,307,677 (GRCm39) V273I probably benign Het
Arhgef37 T A 18: 61,637,403 (GRCm39) I420F probably damaging Het
Atg13 C T 2: 91,510,687 (GRCm39) probably null Het
Bach1 G A 16: 87,516,179 (GRCm39) R240Q probably benign Het
Cabin1 A T 10: 75,482,500 (GRCm39) S2148T probably damaging Het
Cacna1i T C 15: 80,259,537 (GRCm39) V1269A probably damaging Het
Cdipt T C 7: 126,578,794 (GRCm39) I195T probably benign Het
Ces2b A T 8: 105,561,641 (GRCm39) H245L probably damaging Het
Cimip2c A T 5: 30,639,502 (GRCm39) E143V possibly damaging Het
Clstn1 T G 4: 149,730,744 (GRCm39) M825R probably benign Het
Cntn3 G A 6: 102,255,364 (GRCm39) T178I probably damaging Het
Col7a1 A G 9: 108,811,775 (GRCm39) M2789V probably null Het
Col9a2 A T 4: 120,896,981 (GRCm39) I24F unknown Het
Cpne2 T C 8: 95,278,408 (GRCm39) M134T probably benign Het
Cpt1b A G 15: 89,305,546 (GRCm39) probably null Het
Crocc T C 4: 140,773,360 (GRCm39) probably null Het
Cts8 T C 13: 61,395,981 (GRCm39) Y330C probably damaging Het
Cwc22 T C 2: 77,747,411 (GRCm39) D434G probably benign Het
Cyp3a13 T C 5: 137,897,125 (GRCm39) I396M possibly damaging Het
Ddr2 A T 1: 169,829,420 (GRCm39) I278N probably benign Het
Dnaaf5 A G 5: 139,155,963 (GRCm39) E548G possibly damaging Het
Dync2h1 A G 9: 7,002,623 (GRCm39) L3808P probably damaging Het
Faf2 T A 13: 54,798,027 (GRCm39) W209R probably damaging Het
Fbln2 A T 6: 91,245,557 (GRCm39) E992D probably damaging Het
Fdxacb1 T A 9: 50,683,093 (GRCm39) V352D probably damaging Het
Flg2 G T 3: 93,127,303 (GRCm39) G2072* probably null Het
Flii A T 11: 60,611,962 (GRCm39) L347Q probably damaging Het
Fndc3a A T 14: 72,827,336 (GRCm39) H116Q probably damaging Het
Fnta A T 8: 26,505,493 (GRCm39) M39K probably benign Het
Gabra4 A G 5: 71,729,335 (GRCm39) S482P probably benign Het
Gapdhs G A 7: 30,437,383 (GRCm39) P61S unknown Het
Gm10153 A T 7: 141,743,401 (GRCm39) C242* probably null Het
Gp1ba A G 11: 70,530,920 (GRCm39) I229V unknown Het
Grap2 T A 15: 80,527,905 (GRCm39) L117Q probably damaging Het
Grik5 A G 7: 24,713,310 (GRCm39) I766T possibly damaging Het
Hrh3 A T 2: 179,743,079 (GRCm39) I183N probably damaging Het
Htr5a C A 5: 28,047,893 (GRCm39) Y149* probably null Het
Ibtk T C 9: 85,604,353 (GRCm39) I527V probably benign Het
Il33 T A 19: 29,934,341 (GRCm39) S184R probably damaging Het
Kansl3 T A 1: 36,404,668 (GRCm39) Q94L possibly damaging Het
Katnip C T 7: 125,307,193 (GRCm39) probably benign Het
Kcnh6 A G 11: 105,908,242 (GRCm39) D286G probably benign Het
Kmt2e T A 5: 23,683,585 (GRCm39) M281K probably damaging Het
Lrp2 T A 2: 69,346,747 (GRCm39) H833L probably damaging Het
Meis1 A T 11: 18,891,702 (GRCm39) V282E probably damaging Het
Mfsd8 T G 3: 40,785,097 (GRCm39) D240A probably damaging Het
Muc5b A G 7: 141,400,986 (GRCm39) T534A unknown Het
Myo18b G A 5: 112,978,194 (GRCm39) L1243F probably damaging Het
Nefl A G 14: 68,322,123 (GRCm39) I238V probably benign Het
Nexn T A 3: 151,959,284 (GRCm39) I62F possibly damaging Het
Niban1 T C 1: 151,594,048 (GRCm39) V911A probably benign Het
Notch4 T C 17: 34,802,548 (GRCm39) L1323P probably damaging Het
Or51h1 T C 7: 102,308,258 (GRCm39) S77P probably damaging Het
Or5p68 A T 7: 107,945,689 (GRCm39) F166L probably benign Het
Or8b1 T C 9: 38,399,952 (GRCm39) V209A probably benign Het
Patj C A 4: 98,457,217 (GRCm39) H1244N probably damaging Het
Peg10 T A 6: 4,756,082 (GRCm39) D219E unknown Het
Pi4kb G T 3: 94,906,425 (GRCm39) probably null Het
Piezo1 A G 8: 123,225,157 (GRCm39) F614S Het
Pisd T A 5: 32,894,681 (GRCm39) N372Y probably damaging Het
Piwil4 T C 9: 14,645,893 (GRCm39) D178G probably benign Het
Plekho1 G T 3: 95,896,566 (GRCm39) P301Q probably damaging Het
Ppp4r1 C T 17: 66,117,611 (GRCm39) P125L possibly damaging Het
Pramel48 A T 5: 95,630,819 (GRCm39) N232I probably damaging Het
Prdm9 T A 17: 15,783,526 (GRCm39) N13I probably damaging Het
Psd4 T G 2: 24,297,023 (GRCm39) V932G probably damaging Het
Ptger3 T C 3: 157,347,412 (GRCm39) S355P probably benign Het
Ptprb T C 10: 116,175,335 (GRCm39) V823A probably damaging Het
Ptprj C T 2: 90,285,530 (GRCm39) V841I probably benign Het
Ranbp3 T C 17: 57,014,923 (GRCm39) S281P probably benign Het
Rasal3 T A 17: 32,614,835 (GRCm39) M541L possibly damaging Het
Rassf1 A G 9: 107,428,982 (GRCm39) T63A possibly damaging Het
Rcor3 C A 1: 191,822,173 (GRCm39) G8V probably damaging Het
Rgs4 G A 1: 169,571,927 (GRCm39) T124I probably damaging Het
Rspo2 T A 15: 43,033,372 (GRCm39) probably benign Het
Scgn T C 13: 24,137,897 (GRCm39) D258G probably damaging Het
Shkbp1 A G 7: 27,046,556 (GRCm39) S403P possibly damaging Het
Slc25a13 A G 6: 6,052,785 (GRCm39) L525P probably damaging Het
Snd1 G T 6: 28,526,202 (GRCm39) K193N possibly damaging Het
Sntg2 C T 12: 30,225,201 (GRCm39) A516T probably damaging Het
Stard13 A G 5: 150,982,967 (GRCm39) I699T probably damaging Het
Svil T A 18: 5,114,636 (GRCm39) V1984D probably damaging Het
Swt1 A G 1: 151,270,470 (GRCm39) S582P probably benign Het
Sypl2 A G 3: 108,121,854 (GRCm39) *265Q probably null Het
Taar8a T A 10: 23,953,306 (GRCm39) Y303* probably null Het
Tasor2 T C 13: 3,625,292 (GRCm39) T1553A probably benign Het
Tlr2 T A 3: 83,743,849 (GRCm39) I745F probably damaging Het
Tnrc6b A G 15: 80,813,594 (GRCm39) T1784A probably benign Het
Tpo C A 12: 30,169,431 (GRCm39) M101I probably benign Het
Trpm2 G T 10: 77,773,784 (GRCm39) R544S probably benign Het
Ttc14 A G 3: 33,863,400 (GRCm39) R603G unknown Het
Tubgcp6 A C 15: 88,984,925 (GRCm39) V1694G probably damaging Het
Uba6 C A 5: 86,294,970 (GRCm39) K356N probably benign Het
Usp16 T C 16: 87,261,723 (GRCm39) V113A possibly damaging Het
Vcam1 G A 3: 115,908,032 (GRCm39) Q677* probably null Het
Vmn1r238 T A 18: 3,122,721 (GRCm39) E231V probably damaging Het
Vmn1r70 T C 7: 10,367,871 (GRCm39) F120L probably benign Het
Vmn2r116 T A 17: 23,603,830 (GRCm39) probably null Het
Vmn2r5 A T 3: 64,411,825 (GRCm39) C248S probably damaging Het
Vmn2r87 A T 10: 130,314,940 (GRCm39) D215E probably damaging Het
Xkr4 T G 1: 3,740,911 (GRCm39) I221L probably benign Het
Zfp366 T C 13: 99,382,895 (GRCm39) I686T probably benign Het
Zfp398 T A 6: 47,843,666 (GRCm39) C573S probably damaging Het
Other mutations in Pop1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Pop1 APN 15 34,508,875 (GRCm39) missense probably benign 0.00
IGL02192:Pop1 APN 15 34,529,217 (GRCm39) missense probably benign 0.08
IGL02680:Pop1 APN 15 34,502,619 (GRCm39) missense probably damaging 0.99
IGL02958:Pop1 APN 15 34,530,509 (GRCm39) missense probably damaging 0.99
H8562:Pop1 UTSW 15 34,530,358 (GRCm39) missense probably benign 0.00
PIT4802001:Pop1 UTSW 15 34,529,229 (GRCm39) missense probably benign 0.00
R0244:Pop1 UTSW 15 34,516,037 (GRCm39) nonsense probably null
R0281:Pop1 UTSW 15 34,530,004 (GRCm39) splice site probably null
R0453:Pop1 UTSW 15 34,526,352 (GRCm39) missense possibly damaging 0.82
R0579:Pop1 UTSW 15 34,510,115 (GRCm39) missense possibly damaging 0.68
R1054:Pop1 UTSW 15 34,509,955 (GRCm39) missense probably benign 0.30
R1501:Pop1 UTSW 15 34,510,503 (GRCm39) missense probably benign 0.01
R1614:Pop1 UTSW 15 34,530,356 (GRCm39) missense possibly damaging 0.46
R1994:Pop1 UTSW 15 34,530,617 (GRCm39) missense probably damaging 1.00
R2084:Pop1 UTSW 15 34,508,744 (GRCm39) splice site probably benign
R4020:Pop1 UTSW 15 34,508,926 (GRCm39) missense probably benign 0.01
R4550:Pop1 UTSW 15 34,529,082 (GRCm39) missense probably damaging 1.00
R4579:Pop1 UTSW 15 34,515,970 (GRCm39) intron probably benign
R5672:Pop1 UTSW 15 34,530,325 (GRCm39) missense possibly damaging 0.63
R6139:Pop1 UTSW 15 34,529,204 (GRCm39) missense probably benign 0.26
R6161:Pop1 UTSW 15 34,526,456 (GRCm39) missense probably damaging 1.00
R6821:Pop1 UTSW 15 34,508,785 (GRCm39) missense possibly damaging 0.86
R7053:Pop1 UTSW 15 34,530,421 (GRCm39) missense probably benign 0.01
R7195:Pop1 UTSW 15 34,510,525 (GRCm39) missense probably damaging 0.97
R7543:Pop1 UTSW 15 34,530,593 (GRCm39) missense probably damaging 1.00
R7587:Pop1 UTSW 15 34,502,559 (GRCm39) missense probably damaging 0.97
R8401:Pop1 UTSW 15 34,508,755 (GRCm39) missense probably damaging 1.00
R8406:Pop1 UTSW 15 34,529,316 (GRCm39) missense probably benign
R8707:Pop1 UTSW 15 34,529,349 (GRCm39) missense probably benign 0.02
R9044:Pop1 UTSW 15 34,530,554 (GRCm39) missense possibly damaging 0.94
R9066:Pop1 UTSW 15 34,516,060 (GRCm39) missense possibly damaging 0.68
R9236:Pop1 UTSW 15 34,499,558 (GRCm39) missense probably damaging 0.98
R9600:Pop1 UTSW 15 34,512,881 (GRCm39) missense probably benign 0.06
R9711:Pop1 UTSW 15 34,530,227 (GRCm39) missense probably benign
RF001:Pop1 UTSW 15 34,502,583 (GRCm39) missense probably damaging 1.00
RF002:Pop1 UTSW 15 34,502,583 (GRCm39) missense probably damaging 1.00
Z1088:Pop1 UTSW 15 34,499,465 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTGCATGAGTTCTTTCAGTTCTG -3'
(R):5'- TGGTTTTCAGCTATGCCTGC -3'

Sequencing Primer
(F):5'- ACGTGTTTATGGCCAAGCAC -3'
(R):5'- GCCTCATTAGATAGTTGGCAGATCTC -3'
Posted On 2019-10-17