Incidental Mutation 'R7571:Tubgcp6'
ID585873
Institutional Source Beutler Lab
Gene Symbol Tubgcp6
Ensembl Gene ENSMUSG00000051786
Gene Nametubulin, gamma complex associated protein 6
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R7571 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location89098357-89123112 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 89100722 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 1694 (V1694G)
Ref Sequence ENSEMBL: ENSMUSP00000104977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041656] [ENSMUST00000082439] [ENSMUST00000109353] [ENSMUST00000130700] [ENSMUST00000166480]
Predicted Effect probably damaging
Transcript: ENSMUST00000041656
AA Change: V1686G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040132
Gene: ENSMUSG00000051786
AA Change: V1686G

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 355 1667 3.3e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082439
SMART Domains Protein: ENSMUSP00000081020
Gene: ENSMUSG00000035757

DomainStartEndE-ValueType
low complexity region 24 38 N/A INTRINSIC
Pfam:UPF0061 79 625 8.3e-131 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109353
AA Change: V1694G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104977
Gene: ENSMUSG00000051786
AA Change: V1694G

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 355 1675 2.8e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130700
SMART Domains Protein: ENSMUSP00000138382
Gene: ENSMUSG00000035757

DomainStartEndE-ValueType
low complexity region 24 38 N/A INTRINSIC
Pfam:UPF0061 80 241 1.5e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163290
SMART Domains Protein: ENSMUSP00000131359
Gene: ENSMUSG00000051786

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 91 288 2.9e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166480
SMART Domains Protein: ENSMUSP00000132108
Gene: ENSMUSG00000051786

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 2 123 5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169069
SMART Domains Protein: ENSMUSP00000132786
Gene: ENSMUSG00000051786

DomainStartEndE-ValueType
coiled coil region 77 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170877
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a large multisubunit complex required for microtubule nucleation at the centrosome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C02Rik A T 5: 30,482,158 E143V possibly damaging Het
Abca16 A T 7: 120,519,988 N985I probably benign Het
Abi3bp T A 16: 56,630,982 probably null Het
Acad12 A T 5: 121,607,194 Y309* probably null Het
Acadsb G T 7: 131,443,554 R405L probably damaging Het
Acan G A 7: 79,086,267 V154M probably damaging Het
Adam22 G A 5: 8,082,160 R894* probably null Het
Ahnak A T 19: 9,000,786 K90* probably null Het
Ak4 T C 4: 101,460,542 I103T probably benign Het
Ap4e1 C T 2: 127,019,336 L132F probably damaging Het
Apol7b C T 15: 77,423,477 V273I probably benign Het
Arhgef37 T A 18: 61,504,332 I420F probably damaging Het
Atg13 C T 2: 91,680,342 probably null Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Cabin1 A T 10: 75,646,666 S2148T probably damaging Het
Cacna1i T C 15: 80,375,336 V1269A probably damaging Het
Cdipt T C 7: 126,979,622 I195T probably benign Het
Ces2b A T 8: 104,835,009 H245L probably damaging Het
Clstn1 T G 4: 149,646,287 M825R probably benign Het
Cntn3 G A 6: 102,278,403 T178I probably damaging Het
Col7a1 A G 9: 108,982,707 M2789V probably null Het
Col9a2 A T 4: 121,039,784 I24F unknown Het
Cpne2 T C 8: 94,551,780 M134T probably benign Het
Cpt1b A G 15: 89,421,343 probably null Het
Crocc T C 4: 141,046,049 probably null Het
Cts8 T C 13: 61,248,167 Y330C probably damaging Het
Cwc22 T C 2: 77,917,067 D434G probably benign Het
Cyp3a13 T C 5: 137,898,863 I396M possibly damaging Het
D430042O09Rik C T 7: 125,708,021 probably benign Het
D5Ertd577e A T 5: 95,482,960 N232I probably damaging Het
Ddr2 A T 1: 170,001,851 I278N probably benign Het
Dnaaf5 A G 5: 139,170,208 E548G possibly damaging Het
Dync2h1 A G 9: 7,002,623 L3808P probably damaging Het
Faf2 T A 13: 54,650,214 W209R probably damaging Het
Fam129a T C 1: 151,718,297 V911A probably benign Het
Fam208b T C 13: 3,575,292 T1553A probably benign Het
Fbln2 A T 6: 91,268,575 E992D probably damaging Het
Fdxacb1 T A 9: 50,771,793 V352D probably damaging Het
Flg2 G T 3: 93,219,996 G2072* probably null Het
Flii A T 11: 60,721,136 L347Q probably damaging Het
Fndc3a A T 14: 72,589,896 H116Q probably damaging Het
Fnta A T 8: 26,015,465 M39K probably benign Het
Gabra4 A G 5: 71,571,992 S482P probably benign Het
Gapdhs G A 7: 30,737,958 P61S unknown Het
Gm10153 A T 7: 142,189,664 C242* probably null Het
Gp1ba A G 11: 70,640,094 I229V unknown Het
Grap2 T A 15: 80,643,704 L117Q probably damaging Het
Grik5 A G 7: 25,013,885 I766T possibly damaging Het
Hrh3 A T 2: 180,101,286 I183N probably damaging Het
Htr5a C A 5: 27,842,895 Y149* probably null Het
Ibtk T C 9: 85,722,300 I527V probably benign Het
Il33 T A 19: 29,956,941 S184R probably damaging Het
Kansl3 T A 1: 36,365,587 Q94L possibly damaging Het
Kcnh6 A G 11: 106,017,416 D286G probably benign Het
Kmt2e T A 5: 23,478,587 M281K probably damaging Het
Lrp2 T A 2: 69,516,403 H833L probably damaging Het
Meis1 A T 11: 18,941,702 V282E probably damaging Het
Mfsd8 T G 3: 40,830,662 D240A probably damaging Het
Muc5b A G 7: 141,847,249 T534A unknown Het
Myo18b G A 5: 112,830,328 L1243F probably damaging Het
Nefl A G 14: 68,084,674 I238V probably benign Het
Nexn T A 3: 152,253,647 I62F possibly damaging Het
Notch4 T C 17: 34,583,574 L1323P probably damaging Het
Olfr493 A T 7: 108,346,482 F166L probably benign Het
Olfr555 T C 7: 102,659,051 S77P probably damaging Het
Olfr906 T C 9: 38,488,656 V209A probably benign Het
Patj C A 4: 98,568,980 H1244N probably damaging Het
Peg10 T A 6: 4,756,082 D219E unknown Het
Pi4kb G T 3: 94,999,114 probably null Het
Piezo1 A G 8: 122,498,418 F614S Het
Pisd T A 5: 32,737,337 N372Y probably damaging Het
Piwil4 T C 9: 14,734,597 D178G probably benign Het
Plekho1 G T 3: 95,989,254 P301Q probably damaging Het
Pop1 T A 15: 34,528,947 W738R probably null Het
Ppp4r1 C T 17: 65,810,616 P125L possibly damaging Het
Prdm9 T A 17: 15,563,264 N13I probably damaging Het
Psd4 T G 2: 24,407,011 V932G probably damaging Het
Ptger3 T C 3: 157,641,775 S355P probably benign Het
Ptprb T C 10: 116,339,430 V823A probably damaging Het
Ptprj C T 2: 90,455,186 V841I probably benign Het
Ranbp3 T C 17: 56,707,923 S281P probably benign Het
Rasal3 T A 17: 32,395,861 M541L possibly damaging Het
Rassf1 A G 9: 107,551,783 T63A possibly damaging Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rgs4 G A 1: 169,744,358 T124I probably damaging Het
Rspo2 T A 15: 43,169,976 probably benign Het
Scgn T C 13: 23,953,914 D258G probably damaging Het
Shkbp1 A G 7: 27,347,131 S403P possibly damaging Het
Slc25a13 A G 6: 6,052,785 L525P probably damaging Het
Snd1 G T 6: 28,526,203 K193N possibly damaging Het
Sntg2 C T 12: 30,175,202 A516T probably damaging Het
Stard13 A G 5: 151,059,502 I699T probably damaging Het
Svil T A 18: 5,114,636 V1984D probably damaging Het
Swt1 A G 1: 151,394,719 S582P probably benign Het
Sypl2 A G 3: 108,214,538 *265Q probably null Het
Taar8a T A 10: 24,077,408 Y303* probably null Het
Tlr2 T A 3: 83,836,542 I745F probably damaging Het
Tnrc6b A G 15: 80,929,393 T1784A probably benign Het
Tpo C A 12: 30,119,432 M101I probably benign Het
Trpm2 G T 10: 77,937,950 R544S probably benign Het
Ttc14 A G 3: 33,809,251 R603G unknown Het
Uba6 C A 5: 86,147,111 K356N probably benign Het
Usp16 T C 16: 87,464,835 V113A possibly damaging Het
Vcam1 G A 3: 116,114,383 Q677* probably null Het
Vmn1r238 T A 18: 3,122,721 E231V probably damaging Het
Vmn1r70 T C 7: 10,633,944 F120L probably benign Het
Vmn2r116 T A 17: 23,384,856 probably null Het
Vmn2r5 A T 3: 64,504,404 C248S probably damaging Het
Vmn2r87 A T 10: 130,479,071 D215E probably damaging Het
Xkr4 T G 1: 3,670,688 I221L probably benign Het
Zfp366 T C 13: 99,246,387 I686T probably benign Het
Zfp398 T A 6: 47,866,732 C573S probably damaging Het
Other mutations in Tubgcp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Tubgcp6 APN 15 89104008 missense probably benign 0.00
IGL00556:Tubgcp6 APN 15 89100962 missense probably damaging 1.00
IGL00943:Tubgcp6 APN 15 89122397 nonsense probably null
IGL01284:Tubgcp6 APN 15 89110055 missense probably damaging 1.00
IGL01363:Tubgcp6 APN 15 89107525 missense probably damaging 1.00
IGL01386:Tubgcp6 APN 15 89107996 nonsense probably null
IGL01792:Tubgcp6 APN 15 89101281 missense probably damaging 1.00
IGL01866:Tubgcp6 APN 15 89103488 missense probably benign 0.01
IGL02596:Tubgcp6 APN 15 89100914 missense probably damaging 1.00
IGL02858:Tubgcp6 APN 15 89102315 nonsense probably null
IGL02873:Tubgcp6 APN 15 89103824 missense probably benign 0.00
IGL03400:Tubgcp6 APN 15 89108099 unclassified probably benign
IGL02796:Tubgcp6 UTSW 15 89122390 missense probably benign 0.03
R0010:Tubgcp6 UTSW 15 89103183 missense probably benign 0.00
R0308:Tubgcp6 UTSW 15 89122436 missense possibly damaging 0.85
R0440:Tubgcp6 UTSW 15 89103065 missense probably benign 0.12
R0631:Tubgcp6 UTSW 15 89100987 missense probably damaging 1.00
R1653:Tubgcp6 UTSW 15 89107442 missense probably damaging 1.00
R1901:Tubgcp6 UTSW 15 89116241 missense possibly damaging 0.68
R1902:Tubgcp6 UTSW 15 89116241 missense possibly damaging 0.68
R1905:Tubgcp6 UTSW 15 89100608 missense probably damaging 1.00
R2005:Tubgcp6 UTSW 15 89104166 missense probably benign 0.01
R2067:Tubgcp6 UTSW 15 89104489 missense probably benign 0.03
R2083:Tubgcp6 UTSW 15 89122376 missense probably damaging 1.00
R2285:Tubgcp6 UTSW 15 89122474 missense probably damaging 1.00
R2401:Tubgcp6 UTSW 15 89102984 missense probably benign 0.22
R2436:Tubgcp6 UTSW 15 89102365 missense probably benign 0.37
R3017:Tubgcp6 UTSW 15 89103082 nonsense probably null
R3054:Tubgcp6 UTSW 15 89122603 missense probably damaging 1.00
R3932:Tubgcp6 UTSW 15 89104414 unclassified probably benign
R4350:Tubgcp6 UTSW 15 89103995 missense probably benign 0.00
R4472:Tubgcp6 UTSW 15 89103654 missense probably damaging 0.98
R4864:Tubgcp6 UTSW 15 89103818 missense probably benign
R4937:Tubgcp6 UTSW 15 89101549 missense probably damaging 0.98
R4983:Tubgcp6 UTSW 15 89106291 missense probably damaging 1.00
R4996:Tubgcp6 UTSW 15 89103490 missense possibly damaging 0.89
R5044:Tubgcp6 UTSW 15 89099545 unclassified probably benign
R5122:Tubgcp6 UTSW 15 89116103 missense probably damaging 1.00
R5607:Tubgcp6 UTSW 15 89111150 missense probably benign 0.02
R5608:Tubgcp6 UTSW 15 89111150 missense probably benign 0.02
R5653:Tubgcp6 UTSW 15 89108612 missense possibly damaging 0.47
R5886:Tubgcp6 UTSW 15 89103247 missense possibly damaging 0.82
R5945:Tubgcp6 UTSW 15 89109217 splice site probably null
R6111:Tubgcp6 UTSW 15 89100920 missense possibly damaging 0.83
R6195:Tubgcp6 UTSW 15 89122791 missense probably benign 0.01
R6792:Tubgcp6 UTSW 15 89122877 start gained probably benign
R7074:Tubgcp6 UTSW 15 89120636 missense probably damaging 1.00
R7103:Tubgcp6 UTSW 15 89101029 missense probably damaging 0.96
R7274:Tubgcp6 UTSW 15 89102970 nonsense probably null
R7275:Tubgcp6 UTSW 15 89102943 nonsense probably null
R7514:Tubgcp6 UTSW 15 89120525 missense probably damaging 1.00
R7540:Tubgcp6 UTSW 15 89102323 missense possibly damaging 0.48
R7706:Tubgcp6 UTSW 15 89104223 missense probably benign
R7721:Tubgcp6 UTSW 15 89101401 missense probably damaging 1.00
R7996:Tubgcp6 UTSW 15 89109028 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GCATCCAACTTTCAGGCTCCTG -3'
(R):5'- GTGACCTGGAGGAGATTCAG -3'

Sequencing Primer
(F):5'- GCTCCTGCCCACCCTGG -3'
(R):5'- AGATTCAGCGGGCCCATG -3'
Posted On2019-10-17