Incidental Mutation 'R0620:Haus6'
ID58588
Institutional Source Beutler Lab
Gene Symbol Haus6
Ensembl Gene ENSMUSG00000038047
Gene NameHAUS augmin-like complex, subunit 6
Synonyms6230416J20Rik, D4Ertd27e
MMRRC Submission 038809-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.629) question?
Stock #R0620 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location86578855-86612055 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86583514 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 707 (F707I)
Ref Sequence ENSEMBL: ENSMUSP00000070504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070607]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070607
AA Change: F707I

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000070504
Gene: ENSMUSG00000038047
AA Change: F707I

DomainStartEndE-ValueType
Pfam:HAUS6_N 14 238 1.1e-77 PFAM
low complexity region 613 624 N/A INTRINSIC
low complexity region 771 785 N/A INTRINSIC
low complexity region 915 927 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128381
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158333
Meta Mutation Damage Score 0.0773 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the augmin complex. The augmin complex plays a role in microtubule attachment to the kinetochore and central spindle formation. This protein may have a role in efficient chromosome congression and segregation by promoting microtubule-dependent microtubule amplification. Pseudogenes of this gene are located on chromosomes 7 and 20. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E2.5 and E7.5 with delayed or incomplete clustering of microtubule-organizing centers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,328,375 Q973L probably damaging Het
Adamts9 T C 6: 92,858,113 T679A possibly damaging Het
Ahr T C 12: 35,508,194 T276A probably benign Het
Akap9 A T 5: 4,064,136 Q3138H probably damaging Het
Armt1 T A 10: 4,432,689 F7I probably benign Het
B3galt2 A G 1: 143,646,140 R5G probably damaging Het
Bod1l T C 5: 41,801,233 N2750S probably benign Het
Cadps2 T A 6: 23,583,396 E365V probably damaging Het
Cd200r3 T A 16: 44,957,717 probably null Het
Cst7 T A 2: 150,575,886 probably benign Het
Defb30 A T 14: 63,049,763 probably benign Het
Dido1 C T 2: 180,659,851 G2087S probably benign Het
Dio2 A G 12: 90,738,071 Y72H probably benign Het
Dnah11 C T 12: 117,987,469 E3035K probably damaging Het
Dnajb13 T C 7: 100,503,249 K287E possibly damaging Het
Dnajc11 G A 4: 151,973,628 V244I possibly damaging Het
Ect2 C T 3: 27,139,652 A226T probably damaging Het
Ercc8 G A 13: 108,174,061 probably null Het
Fam120b T A 17: 15,402,927 M389K probably benign Het
Fam151a A G 4: 106,747,931 M497V probably benign Het
Fam186b C A 15: 99,280,128 G439V probably benign Het
Fank1 A G 7: 133,876,765 Y185C probably damaging Het
Gart T C 16: 91,630,602 probably benign Het
Glb1l T C 1: 75,199,720 Y572C probably damaging Het
Gm11563 C T 11: 99,658,437 A164T unknown Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
Gsdmc3 T A 15: 63,859,693 D330V probably damaging Het
H2-DMa C T 17: 34,137,960 T144M probably damaging Het
Hmcn1 T A 1: 150,594,016 T4971S probably benign Het
Ints6 A T 14: 62,696,759 F766L probably benign Het
Kdm5d T A Y: 927,330 M650K probably damaging Het
Kif21b T C 1: 136,159,428 F881S possibly damaging Het
Klrk1 C A 6: 129,614,635 Q176H possibly damaging Het
Ky T C 9: 102,537,621 V244A probably benign Het
Mia2 T A 12: 59,154,419 L191M possibly damaging Het
Miga2 T A 2: 30,381,744 probably benign Het
Mtss1l C T 8: 110,737,948 P322S probably damaging Het
Nalcn A G 14: 123,299,141 probably benign Het
Ncbp3 T A 11: 73,049,845 probably benign Het
Nprl3 G A 11: 32,234,876 L378F probably damaging Het
Ntrk2 A T 13: 58,846,821 M184L probably benign Het
Olfr311 T G 11: 58,841,443 C110G probably damaging Het
Olfr738 G T 14: 50,413,697 C51F probably benign Het
Osbpl9 T C 4: 109,083,128 E287G probably damaging Het
Parva T C 7: 112,576,411 F250L probably damaging Het
Pcdhb11 C T 18: 37,421,811 Q65* probably null Het
Phtf1 A G 3: 103,993,765 T377A probably damaging Het
Pkp4 G A 2: 59,322,643 V612I possibly damaging Het
Plscr2 C A 9: 92,287,654 S52R probably benign Het
Pnisr C T 4: 21,874,092 probably benign Het
Pole2 A C 12: 69,209,879 S291A probably damaging Het
Ppp2r5d A G 17: 46,684,018 F586L probably benign Het
Prrx1 G A 1: 163,257,816 R182C probably damaging Het
Ptprs A G 17: 56,429,103 I110T possibly damaging Het
Rasgrf2 G A 13: 91,919,817 probably benign Het
Riox2 T C 16: 59,491,892 V464A probably benign Het
Robo2 A G 16: 73,967,802 V646A possibly damaging Het
Ros1 T A 10: 52,118,348 I1279F probably damaging Het
Siglec1 G A 2: 131,074,268 T1254M probably benign Het
Snx7 T C 3: 117,846,675 N62D probably damaging Het
Sp100 G A 1: 85,659,867 probably null Het
Stil A T 4: 115,007,159 I86L possibly damaging Het
Tbc1d16 T A 11: 119,209,038 D170V probably benign Het
Tmem2 T A 19: 21,817,971 S743T probably benign Het
Trappc13 G A 13: 104,161,081 T105M probably damaging Het
Trhr T A 15: 44,229,500 S378T probably benign Het
Ttc7b T C 12: 100,500,073 probably null Het
Vegfc A T 8: 54,157,139 Y110F probably benign Het
Vmn1r184 C A 7: 26,267,177 P116H possibly damaging Het
Vmn2r5 A T 3: 64,503,814 C444* probably null Het
Zfp341 A G 2: 154,634,273 E460G possibly damaging Het
Zfp819 T A 7: 43,616,444 V41E probably benign Het
Other mutations in Haus6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Haus6 APN 4 86607981 missense probably benign 0.32
IGL02307:Haus6 APN 4 86583835 missense possibly damaging 0.53
IGL03113:Haus6 APN 4 86583106 nonsense probably null
IGL03384:Haus6 APN 4 86583525 missense probably benign
R0436:Haus6 UTSW 4 86585807 missense probably benign 0.00
R0491:Haus6 UTSW 4 86602846 missense possibly damaging 0.93
R1118:Haus6 UTSW 4 86585326 critical splice donor site probably null
R1969:Haus6 UTSW 4 86604246 missense probably damaging 0.99
R1985:Haus6 UTSW 4 86593609 missense possibly damaging 0.96
R2213:Haus6 UTSW 4 86581992 missense possibly damaging 0.53
R2448:Haus6 UTSW 4 86589001 missense possibly damaging 0.53
R2567:Haus6 UTSW 4 86585885 nonsense probably null
R2760:Haus6 UTSW 4 86583176 nonsense probably null
R3714:Haus6 UTSW 4 86602867 missense probably benign 0.01
R3962:Haus6 UTSW 4 86611804 missense possibly damaging 0.85
R4180:Haus6 UTSW 4 86583574 missense probably benign 0.00
R4736:Haus6 UTSW 4 86600749 critical splice donor site probably null
R4738:Haus6 UTSW 4 86600749 critical splice donor site probably null
R4929:Haus6 UTSW 4 86595433 missense probably benign 0.03
R4933:Haus6 UTSW 4 86585287 intron probably benign
R5027:Haus6 UTSW 4 86605696 missense possibly damaging 0.92
R5199:Haus6 UTSW 4 86582985 missense possibly damaging 0.85
R5240:Haus6 UTSW 4 86583178 missense possibly damaging 0.86
R5580:Haus6 UTSW 4 86599266 missense possibly damaging 0.73
R5781:Haus6 UTSW 4 86601263 missense possibly damaging 0.92
R5865:Haus6 UTSW 4 86586357 missense possibly damaging 0.73
R5926:Haus6 UTSW 4 86599316 missense probably benign
R6154:Haus6 UTSW 4 86583756 missense possibly damaging 0.96
R7166:Haus6 UTSW 4 86583687 missense possibly damaging 0.72
R7183:Haus6 UTSW 4 86583752 missense possibly damaging 0.53
R7418:Haus6 UTSW 4 86594773 missense possibly damaging 0.73
R7843:Haus6 UTSW 4 86586341 missense possibly damaging 0.85
R7926:Haus6 UTSW 4 86586341 missense possibly damaging 0.85
Z1088:Haus6 UTSW 4 86602874 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- CCTGAGTGTCCCAAACAGTGTGTG -3'
(R):5'- TGCCAGTGCTAGAGAAGTGTCGTC -3'

Sequencing Primer
(F):5'- GACTTAGGCGACCAACTTCTG -3'
(R):5'- AGAAGTGTCGTCAGAGTCTTCATC -3'
Posted On2013-07-11