Incidental Mutation 'R7571:Ahnak'
ID 585885
Institutional Source Beutler Lab
Gene Symbol Ahnak
Ensembl Gene ENSMUSG00000069833
Gene Name AHNAK nucleoprotein
Synonyms DY6, 1110004P15Rik, 2310047C17Rik
MMRRC Submission 045711-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.313) question?
Stock # R7571 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 8966648-9054278 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 8978150 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 90 (K90*)
Ref Sequence ENSEMBL: ENSMUSP00000090633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092955] [ENSMUST00000092956]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000092955
AA Change: K90*
SMART Domains Protein: ENSMUSP00000090632
Gene: ENSMUSG00000069833
AA Change: K90*

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
PDZ 20 91 2.31e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000092956
AA Change: K90*
SMART Domains Protein: ENSMUSP00000090633
Gene: ENSMUSG00000069833
AA Change: K90*

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
PDZ 20 91 2.31e-5 SMART
internal_repeat_2 163 1515 5.22e-182 PROSPERO
internal_repeat_1 224 2314 N/A PROSPERO
internal_repeat_2 1532 3028 5.22e-182 PROSPERO
internal_repeat_1 2660 5095 N/A PROSPERO
low complexity region 5336 5353 N/A INTRINSIC
low complexity region 5493 5504 N/A INTRINSIC
low complexity region 5580 5600 N/A INTRINSIC
low complexity region 5620 5636 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a large (700 kDa) structural scaffold protein consisting of a central domain with 128 aa repeats. The encoded protein may play a role in such diverse processes as blood-brain barrier formation, cell structure and migration, cardiac calcium channel regulation, and tumor metastasis. A much shorter variant encoding a 17 kDa isoform exists for this gene, and the shorter isoform initiates a feedback loop that regulates alternative splicing of this gene. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit decreased T cell proliferation and increased susceptibility to parasitic infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,119,211 (GRCm39) N985I probably benign Het
Abi3bp T A 16: 56,451,345 (GRCm39) probably null Het
Acad12 A T 5: 121,745,257 (GRCm39) Y309* probably null Het
Acadsb G T 7: 131,045,283 (GRCm39) R405L probably damaging Het
Acan G A 7: 78,736,015 (GRCm39) V154M probably damaging Het
Adam22 G A 5: 8,132,160 (GRCm39) R894* probably null Het
Ak4 T C 4: 101,317,739 (GRCm39) I103T probably benign Het
Ap4e1 C T 2: 126,861,256 (GRCm39) L132F probably damaging Het
Apol7b C T 15: 77,307,677 (GRCm39) V273I probably benign Het
Arhgef37 T A 18: 61,637,403 (GRCm39) I420F probably damaging Het
Atg13 C T 2: 91,510,687 (GRCm39) probably null Het
Bach1 G A 16: 87,516,179 (GRCm39) R240Q probably benign Het
Cabin1 A T 10: 75,482,500 (GRCm39) S2148T probably damaging Het
Cacna1i T C 15: 80,259,537 (GRCm39) V1269A probably damaging Het
Cdipt T C 7: 126,578,794 (GRCm39) I195T probably benign Het
Ces2b A T 8: 105,561,641 (GRCm39) H245L probably damaging Het
Cimip2c A T 5: 30,639,502 (GRCm39) E143V possibly damaging Het
Clstn1 T G 4: 149,730,744 (GRCm39) M825R probably benign Het
Cntn3 G A 6: 102,255,364 (GRCm39) T178I probably damaging Het
Col7a1 A G 9: 108,811,775 (GRCm39) M2789V probably null Het
Col9a2 A T 4: 120,896,981 (GRCm39) I24F unknown Het
Cpne2 T C 8: 95,278,408 (GRCm39) M134T probably benign Het
Cpt1b A G 15: 89,305,546 (GRCm39) probably null Het
Crocc T C 4: 140,773,360 (GRCm39) probably null Het
Cts8 T C 13: 61,395,981 (GRCm39) Y330C probably damaging Het
Cwc22 T C 2: 77,747,411 (GRCm39) D434G probably benign Het
Cyp3a13 T C 5: 137,897,125 (GRCm39) I396M possibly damaging Het
Ddr2 A T 1: 169,829,420 (GRCm39) I278N probably benign Het
Dnaaf5 A G 5: 139,155,963 (GRCm39) E548G possibly damaging Het
Dync2h1 A G 9: 7,002,623 (GRCm39) L3808P probably damaging Het
Faf2 T A 13: 54,798,027 (GRCm39) W209R probably damaging Het
Fbln2 A T 6: 91,245,557 (GRCm39) E992D probably damaging Het
Fdxacb1 T A 9: 50,683,093 (GRCm39) V352D probably damaging Het
Flg2 G T 3: 93,127,303 (GRCm39) G2072* probably null Het
Flii A T 11: 60,611,962 (GRCm39) L347Q probably damaging Het
Fndc3a A T 14: 72,827,336 (GRCm39) H116Q probably damaging Het
Fnta A T 8: 26,505,493 (GRCm39) M39K probably benign Het
Gabra4 A G 5: 71,729,335 (GRCm39) S482P probably benign Het
Gapdhs G A 7: 30,437,383 (GRCm39) P61S unknown Het
Gm10153 A T 7: 141,743,401 (GRCm39) C242* probably null Het
Gp1ba A G 11: 70,530,920 (GRCm39) I229V unknown Het
Grap2 T A 15: 80,527,905 (GRCm39) L117Q probably damaging Het
Grik5 A G 7: 24,713,310 (GRCm39) I766T possibly damaging Het
Hrh3 A T 2: 179,743,079 (GRCm39) I183N probably damaging Het
Htr5a C A 5: 28,047,893 (GRCm39) Y149* probably null Het
Ibtk T C 9: 85,604,353 (GRCm39) I527V probably benign Het
Il33 T A 19: 29,934,341 (GRCm39) S184R probably damaging Het
Kansl3 T A 1: 36,404,668 (GRCm39) Q94L possibly damaging Het
Katnip C T 7: 125,307,193 (GRCm39) probably benign Het
Kcnh6 A G 11: 105,908,242 (GRCm39) D286G probably benign Het
Kmt2e T A 5: 23,683,585 (GRCm39) M281K probably damaging Het
Lrp2 T A 2: 69,346,747 (GRCm39) H833L probably damaging Het
Meis1 A T 11: 18,891,702 (GRCm39) V282E probably damaging Het
Mfsd8 T G 3: 40,785,097 (GRCm39) D240A probably damaging Het
Muc5b A G 7: 141,400,986 (GRCm39) T534A unknown Het
Myo18b G A 5: 112,978,194 (GRCm39) L1243F probably damaging Het
Nefl A G 14: 68,322,123 (GRCm39) I238V probably benign Het
Nexn T A 3: 151,959,284 (GRCm39) I62F possibly damaging Het
Niban1 T C 1: 151,594,048 (GRCm39) V911A probably benign Het
Notch4 T C 17: 34,802,548 (GRCm39) L1323P probably damaging Het
Or51h1 T C 7: 102,308,258 (GRCm39) S77P probably damaging Het
Or5p68 A T 7: 107,945,689 (GRCm39) F166L probably benign Het
Or8b1 T C 9: 38,399,952 (GRCm39) V209A probably benign Het
Patj C A 4: 98,457,217 (GRCm39) H1244N probably damaging Het
Peg10 T A 6: 4,756,082 (GRCm39) D219E unknown Het
Pi4kb G T 3: 94,906,425 (GRCm39) probably null Het
Piezo1 A G 8: 123,225,157 (GRCm39) F614S Het
Pisd T A 5: 32,894,681 (GRCm39) N372Y probably damaging Het
Piwil4 T C 9: 14,645,893 (GRCm39) D178G probably benign Het
Plekho1 G T 3: 95,896,566 (GRCm39) P301Q probably damaging Het
Pop1 T A 15: 34,529,093 (GRCm39) W738R probably null Het
Ppp4r1 C T 17: 66,117,611 (GRCm39) P125L possibly damaging Het
Pramel48 A T 5: 95,630,819 (GRCm39) N232I probably damaging Het
Prdm9 T A 17: 15,783,526 (GRCm39) N13I probably damaging Het
Psd4 T G 2: 24,297,023 (GRCm39) V932G probably damaging Het
Ptger3 T C 3: 157,347,412 (GRCm39) S355P probably benign Het
Ptprb T C 10: 116,175,335 (GRCm39) V823A probably damaging Het
Ptprj C T 2: 90,285,530 (GRCm39) V841I probably benign Het
Ranbp3 T C 17: 57,014,923 (GRCm39) S281P probably benign Het
Rasal3 T A 17: 32,614,835 (GRCm39) M541L possibly damaging Het
Rassf1 A G 9: 107,428,982 (GRCm39) T63A possibly damaging Het
Rcor3 C A 1: 191,822,173 (GRCm39) G8V probably damaging Het
Rgs4 G A 1: 169,571,927 (GRCm39) T124I probably damaging Het
Rspo2 T A 15: 43,033,372 (GRCm39) probably benign Het
Scgn T C 13: 24,137,897 (GRCm39) D258G probably damaging Het
Shkbp1 A G 7: 27,046,556 (GRCm39) S403P possibly damaging Het
Slc25a13 A G 6: 6,052,785 (GRCm39) L525P probably damaging Het
Snd1 G T 6: 28,526,202 (GRCm39) K193N possibly damaging Het
Sntg2 C T 12: 30,225,201 (GRCm39) A516T probably damaging Het
Stard13 A G 5: 150,982,967 (GRCm39) I699T probably damaging Het
Svil T A 18: 5,114,636 (GRCm39) V1984D probably damaging Het
Swt1 A G 1: 151,270,470 (GRCm39) S582P probably benign Het
Sypl2 A G 3: 108,121,854 (GRCm39) *265Q probably null Het
Taar8a T A 10: 23,953,306 (GRCm39) Y303* probably null Het
Tasor2 T C 13: 3,625,292 (GRCm39) T1553A probably benign Het
Tlr2 T A 3: 83,743,849 (GRCm39) I745F probably damaging Het
Tnrc6b A G 15: 80,813,594 (GRCm39) T1784A probably benign Het
Tpo C A 12: 30,169,431 (GRCm39) M101I probably benign Het
Trpm2 G T 10: 77,773,784 (GRCm39) R544S probably benign Het
Ttc14 A G 3: 33,863,400 (GRCm39) R603G unknown Het
Tubgcp6 A C 15: 88,984,925 (GRCm39) V1694G probably damaging Het
Uba6 C A 5: 86,294,970 (GRCm39) K356N probably benign Het
Usp16 T C 16: 87,261,723 (GRCm39) V113A possibly damaging Het
Vcam1 G A 3: 115,908,032 (GRCm39) Q677* probably null Het
Vmn1r238 T A 18: 3,122,721 (GRCm39) E231V probably damaging Het
Vmn1r70 T C 7: 10,367,871 (GRCm39) F120L probably benign Het
Vmn2r116 T A 17: 23,603,830 (GRCm39) probably null Het
Vmn2r5 A T 3: 64,411,825 (GRCm39) C248S probably damaging Het
Vmn2r87 A T 10: 130,314,940 (GRCm39) D215E probably damaging Het
Xkr4 T G 1: 3,740,911 (GRCm39) I221L probably benign Het
Zfp366 T C 13: 99,382,895 (GRCm39) I686T probably benign Het
Zfp398 T A 6: 47,843,666 (GRCm39) C573S probably damaging Het
Other mutations in Ahnak
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Ahnak APN 19 8,984,587 (GRCm39) missense probably damaging 0.99
IGL00509:Ahnak APN 19 8,987,315 (GRCm39) missense possibly damaging 0.94
IGL00539:Ahnak APN 19 8,985,272 (GRCm39) missense possibly damaging 0.50
IGL00558:Ahnak APN 19 8,981,671 (GRCm39) missense possibly damaging 0.93
IGL00567:Ahnak APN 19 8,990,747 (GRCm39) missense probably benign 0.24
IGL00706:Ahnak APN 19 8,991,094 (GRCm39) nonsense probably null
IGL00807:Ahnak APN 19 8,985,886 (GRCm39) missense possibly damaging 0.92
IGL00870:Ahnak APN 19 8,991,062 (GRCm39) missense probably damaging 1.00
IGL01101:Ahnak APN 19 8,990,251 (GRCm39) intron probably benign
IGL01118:Ahnak APN 19 8,989,942 (GRCm39) missense probably damaging 1.00
IGL01288:Ahnak APN 19 8,979,858 (GRCm39) missense possibly damaging 0.94
IGL01324:Ahnak APN 19 8,980,396 (GRCm39) missense probably damaging 1.00
IGL01341:Ahnak APN 19 8,989,067 (GRCm39) missense probably benign
IGL01541:Ahnak APN 19 8,985,243 (GRCm39) missense possibly damaging 0.95
IGL01580:Ahnak APN 19 8,980,203 (GRCm39) missense probably benign 0.02
IGL01595:Ahnak APN 19 8,980,865 (GRCm39) nonsense probably null
IGL01746:Ahnak APN 19 8,982,276 (GRCm39) missense possibly damaging 0.89
IGL01766:Ahnak APN 19 8,977,482 (GRCm39) missense unknown
IGL01821:Ahnak APN 19 8,989,482 (GRCm39) missense probably benign
IGL01913:Ahnak APN 19 8,983,428 (GRCm39) nonsense probably null
IGL01934:Ahnak APN 19 8,980,021 (GRCm39) missense probably damaging 1.00
IGL01940:Ahnak APN 19 8,983,921 (GRCm39) missense probably benign 0.14
IGL01958:Ahnak APN 19 8,992,273 (GRCm39) missense possibly damaging 0.59
IGL02145:Ahnak APN 19 8,980,219 (GRCm39) missense probably benign 0.11
IGL02246:Ahnak APN 19 8,985,632 (GRCm39) missense probably damaging 1.00
IGL02282:Ahnak APN 19 8,983,351 (GRCm39) missense probably damaging 1.00
IGL02428:Ahnak APN 19 8,992,197 (GRCm39) missense possibly damaging 0.83
IGL02442:Ahnak APN 19 8,981,380 (GRCm39) missense probably damaging 1.00
IGL02474:Ahnak APN 19 8,982,297 (GRCm39) missense probably benign 0.13
IGL02483:Ahnak APN 19 8,980,672 (GRCm39) missense probably benign 0.01
IGL02616:Ahnak APN 19 8,982,991 (GRCm39) missense probably benign 0.03
IGL02630:Ahnak APN 19 8,989,441 (GRCm39) missense probably damaging 1.00
IGL02690:Ahnak APN 19 8,989,948 (GRCm39) nonsense probably null
IGL02717:Ahnak APN 19 8,979,751 (GRCm39) missense probably benign 0.00
IGL02721:Ahnak APN 19 8,987,071 (GRCm39) missense probably benign 0.07
IGL02737:Ahnak APN 19 8,981,957 (GRCm39) missense probably benign 0.17
IGL02850:Ahnak APN 19 8,979,960 (GRCm39) missense probably benign 0.00
IGL03071:Ahnak APN 19 8,989,282 (GRCm39) missense possibly damaging 0.63
IGL03072:Ahnak APN 19 8,983,872 (GRCm39) missense probably benign 0.11
IGL03094:Ahnak APN 19 8,980,911 (GRCm39) missense possibly damaging 0.64
IGL03140:Ahnak APN 19 8,982,576 (GRCm39) intron probably benign
IGL03176:Ahnak APN 19 8,979,813 (GRCm39) missense probably damaging 1.00
IGL03176:Ahnak APN 19 8,985,530 (GRCm39) missense possibly damaging 0.56
IGL03189:Ahnak APN 19 8,988,603 (GRCm39) missense possibly damaging 0.65
IGL03357:Ahnak APN 19 8,986,689 (GRCm39) intron probably benign
IGL03371:Ahnak APN 19 8,981,592 (GRCm39) missense possibly damaging 0.91
Eskimo UTSW 19 8,986,938 (GRCm39) missense probably benign 0.31
Nanook UTSW 19 8,980,595 (GRCm39) missense probably benign 0.42
Netsilik UTSW 19 8,979,685 (GRCm39) missense probably benign 0.00
IGL03097:Ahnak UTSW 19 8,979,751 (GRCm39) missense probably benign 0.00
PIT4403001:Ahnak UTSW 19 8,983,540 (GRCm39) missense possibly damaging 0.87
R0054:Ahnak UTSW 19 8,989,420 (GRCm39) missense probably damaging 1.00
R0094:Ahnak UTSW 19 8,991,257 (GRCm39) missense probably benign 0.12
R0110:Ahnak UTSW 19 8,995,596 (GRCm39) nonsense probably null
R0141:Ahnak UTSW 19 8,984,044 (GRCm39) missense probably damaging 1.00
R0166:Ahnak UTSW 19 8,983,089 (GRCm39) missense probably damaging 1.00
R0309:Ahnak UTSW 19 8,979,859 (GRCm39) missense probably damaging 1.00
R0368:Ahnak UTSW 19 8,985,714 (GRCm39) nonsense probably null
R0386:Ahnak UTSW 19 8,988,508 (GRCm39) missense possibly damaging 0.94
R0401:Ahnak UTSW 19 8,992,480 (GRCm39) missense probably benign 0.24
R0415:Ahnak UTSW 19 8,990,235 (GRCm39) intron probably benign
R0463:Ahnak UTSW 19 8,986,771 (GRCm39) intron probably benign
R0469:Ahnak UTSW 19 8,995,596 (GRCm39) nonsense probably null
R0470:Ahnak UTSW 19 8,986,331 (GRCm39) missense probably benign 0.29
R0487:Ahnak UTSW 19 8,991,484 (GRCm39) missense probably damaging 0.99
R0487:Ahnak UTSW 19 8,984,515 (GRCm39) missense probably benign 0.00
R0499:Ahnak UTSW 19 8,977,628 (GRCm39) splice site probably benign
R0506:Ahnak UTSW 19 8,986,492 (GRCm39) missense probably damaging 1.00
R0510:Ahnak UTSW 19 8,995,596 (GRCm39) nonsense probably null
R0557:Ahnak UTSW 19 8,979,308 (GRCm39) missense probably benign 0.10
R0570:Ahnak UTSW 19 8,991,062 (GRCm39) missense probably damaging 1.00
R0610:Ahnak UTSW 19 8,985,242 (GRCm39) missense probably benign 0.08
R0646:Ahnak UTSW 19 8,990,766 (GRCm39) nonsense probably null
R0659:Ahnak UTSW 19 8,992,366 (GRCm39) missense possibly damaging 0.60
R0791:Ahnak UTSW 19 8,994,098 (GRCm39) missense probably benign 0.01
R0792:Ahnak UTSW 19 8,994,098 (GRCm39) missense probably benign 0.01
R0840:Ahnak UTSW 19 8,982,427 (GRCm39) missense probably damaging 1.00
R0847:Ahnak UTSW 19 8,983,797 (GRCm39) nonsense probably null
R0941:Ahnak UTSW 19 8,987,278 (GRCm39) missense probably damaging 1.00
R0962:Ahnak UTSW 19 8,990,212 (GRCm39) intron probably benign
R1017:Ahnak UTSW 19 8,987,907 (GRCm39) missense probably damaging 0.99
R1037:Ahnak UTSW 19 8,984,982 (GRCm39) missense probably benign 0.27
R1085:Ahnak UTSW 19 8,990,489 (GRCm39) missense possibly damaging 0.50
R1113:Ahnak UTSW 19 8,982,984 (GRCm39) missense probably benign 0.29
R1140:Ahnak UTSW 19 8,981,609 (GRCm39) missense probably damaging 1.00
R1158:Ahnak UTSW 19 8,991,290 (GRCm39) missense probably benign 0.00
R1218:Ahnak UTSW 19 8,992,983 (GRCm39) missense probably damaging 1.00
R1225:Ahnak UTSW 19 8,980,247 (GRCm39) missense probably damaging 1.00
R1245:Ahnak UTSW 19 8,981,533 (GRCm39) missense probably benign 0.44
R1421:Ahnak UTSW 19 8,992,995 (GRCm39) missense possibly damaging 0.95
R1447:Ahnak UTSW 19 8,984,446 (GRCm39) missense probably damaging 0.98
R1464:Ahnak UTSW 19 8,982,260 (GRCm39) missense probably damaging 1.00
R1464:Ahnak UTSW 19 8,982,260 (GRCm39) missense probably damaging 1.00
R1466:Ahnak UTSW 19 8,993,239 (GRCm39) missense probably damaging 1.00
R1466:Ahnak UTSW 19 8,993,239 (GRCm39) missense probably damaging 1.00
R1471:Ahnak UTSW 19 8,990,296 (GRCm39) intron probably benign
R1507:Ahnak UTSW 19 8,987,441 (GRCm39) missense probably damaging 1.00
R1521:Ahnak UTSW 19 8,982,092 (GRCm39) missense probably benign 0.11
R1568:Ahnak UTSW 19 8,979,739 (GRCm39) missense probably damaging 0.98
R1569:Ahnak UTSW 19 8,981,458 (GRCm39) missense possibly damaging 0.78
R1616:Ahnak UTSW 19 8,986,351 (GRCm39) missense possibly damaging 0.94
R1638:Ahnak UTSW 19 8,986,813 (GRCm39) missense probably benign 0.01
R1680:Ahnak UTSW 19 8,987,327 (GRCm39) missense probably benign 0.05
R1713:Ahnak UTSW 19 8,989,173 (GRCm39) missense possibly damaging 0.95
R1722:Ahnak UTSW 19 8,988,019 (GRCm39) missense probably damaging 0.99
R1771:Ahnak UTSW 19 8,991,117 (GRCm39) missense probably benign 0.24
R1795:Ahnak UTSW 19 8,979,802 (GRCm39) missense possibly damaging 0.79
R1823:Ahnak UTSW 19 8,982,269 (GRCm39) missense probably damaging 0.99
R1842:Ahnak UTSW 19 8,983,231 (GRCm39) missense probably damaging 0.99
R1854:Ahnak UTSW 19 8,991,196 (GRCm39) missense possibly damaging 0.61
R1856:Ahnak UTSW 19 8,979,412 (GRCm39) missense possibly damaging 0.86
R1886:Ahnak UTSW 19 8,993,343 (GRCm39) missense probably damaging 0.98
R1888:Ahnak UTSW 19 8,984,452 (GRCm39) missense probably damaging 1.00
R1888:Ahnak UTSW 19 8,984,452 (GRCm39) missense probably damaging 1.00
R1912:Ahnak UTSW 19 8,995,245 (GRCm39) missense probably damaging 1.00
R1913:Ahnak UTSW 19 8,985,286 (GRCm39) missense probably damaging 0.99
R1942:Ahnak UTSW 19 8,992,447 (GRCm39) missense probably damaging 0.98
R1987:Ahnak UTSW 19 8,992,615 (GRCm39) missense probably damaging 1.00
R2006:Ahnak UTSW 19 8,984,439 (GRCm39) missense probably damaging 1.00
R2013:Ahnak UTSW 19 8,991,937 (GRCm39) missense probably damaging 0.98
R2014:Ahnak UTSW 19 8,990,545 (GRCm39) missense probably damaging 0.99
R2047:Ahnak UTSW 19 8,991,664 (GRCm39) missense possibly damaging 0.67
R2048:Ahnak UTSW 19 8,984,420 (GRCm39) missense probably damaging 0.99
R2060:Ahnak UTSW 19 8,985,405 (GRCm39) missense probably benign 0.08
R2083:Ahnak UTSW 19 8,988,921 (GRCm39) missense probably damaging 1.00
R2157:Ahnak UTSW 19 8,978,048 (GRCm39) missense possibly damaging 0.92
R2167:Ahnak UTSW 19 8,988,858 (GRCm39) nonsense probably null
R2208:Ahnak UTSW 19 8,995,096 (GRCm39) missense probably benign 0.00
R2224:Ahnak UTSW 19 8,990,355 (GRCm39) intron probably benign
R2268:Ahnak UTSW 19 8,987,938 (GRCm39) missense possibly damaging 0.66
R2420:Ahnak UTSW 19 8,986,620 (GRCm39) missense possibly damaging 0.89
R2426:Ahnak UTSW 19 8,980,215 (GRCm39) missense possibly damaging 0.81
R2910:Ahnak UTSW 19 8,989,018 (GRCm39) missense probably damaging 0.99
R2911:Ahnak UTSW 19 8,989,018 (GRCm39) missense probably damaging 0.99
R2981:Ahnak UTSW 19 8,977,512 (GRCm39) missense probably damaging 0.97
R3151:Ahnak UTSW 19 8,987,308 (GRCm39) missense probably benign 0.12
R3155:Ahnak UTSW 19 8,987,541 (GRCm39) missense possibly damaging 0.49
R3422:Ahnak UTSW 19 8,984,116 (GRCm39) missense probably benign 0.05
R3422:Ahnak UTSW 19 8,983,072 (GRCm39) missense probably benign 0.39
R3430:Ahnak UTSW 19 8,984,322 (GRCm39) missense probably benign 0.42
R3433:Ahnak UTSW 19 8,987,358 (GRCm39) missense probably benign 0.01
R3711:Ahnak UTSW 19 8,985,262 (GRCm39) missense probably benign
R3723:Ahnak UTSW 19 8,994,217 (GRCm39) missense possibly damaging 0.79
R3775:Ahnak UTSW 19 8,986,387 (GRCm39) missense possibly damaging 0.91
R3858:Ahnak UTSW 19 8,988,223 (GRCm39) missense possibly damaging 0.82
R3859:Ahnak UTSW 19 8,988,223 (GRCm39) missense possibly damaging 0.82
R3922:Ahnak UTSW 19 8,983,692 (GRCm39) missense probably benign 0.20
R3924:Ahnak UTSW 19 8,983,692 (GRCm39) missense probably benign 0.20
R3926:Ahnak UTSW 19 8,983,692 (GRCm39) missense probably benign 0.20
R4026:Ahnak UTSW 19 8,988,663 (GRCm39) missense probably damaging 0.97
R4051:Ahnak UTSW 19 8,991,691 (GRCm39) missense probably damaging 1.00
R4209:Ahnak UTSW 19 8,979,964 (GRCm39) missense probably damaging 1.00
R4234:Ahnak UTSW 19 8,978,150 (GRCm39) nonsense probably null
R4237:Ahnak UTSW 19 8,979,147 (GRCm39) missense probably benign 0.02
R4285:Ahnak UTSW 19 8,994,203 (GRCm39) nonsense probably null
R4331:Ahnak UTSW 19 8,993,184 (GRCm39) missense probably damaging 1.00
R4342:Ahnak UTSW 19 8,989,447 (GRCm39) missense possibly damaging 0.79
R4430:Ahnak UTSW 19 8,980,404 (GRCm39) missense probably benign 0.00
R4554:Ahnak UTSW 19 8,992,294 (GRCm39) missense probably damaging 1.00
R4602:Ahnak UTSW 19 8,988,189 (GRCm39) missense possibly damaging 0.66
R4612:Ahnak UTSW 19 8,981,088 (GRCm39) missense probably benign 0.44
R4655:Ahnak UTSW 19 8,986,065 (GRCm39) missense probably damaging 1.00
R4656:Ahnak UTSW 19 8,982,219 (GRCm39) missense possibly damaging 0.80
R4700:Ahnak UTSW 19 8,982,045 (GRCm39) missense probably benign 0.02
R4704:Ahnak UTSW 19 8,989,622 (GRCm39) intron probably benign
R4704:Ahnak UTSW 19 8,990,545 (GRCm39) missense probably damaging 0.99
R4705:Ahnak UTSW 19 8,994,270 (GRCm39) missense probably benign 0.07
R4707:Ahnak UTSW 19 8,994,099 (GRCm39) missense probably benign 0.03
R4732:Ahnak UTSW 19 8,984,665 (GRCm39) missense probably damaging 1.00
R4733:Ahnak UTSW 19 8,984,665 (GRCm39) missense probably damaging 1.00
R4778:Ahnak UTSW 19 8,989,339 (GRCm39) missense possibly damaging 0.79
R4782:Ahnak UTSW 19 8,989,863 (GRCm39) intron probably benign
R4832:Ahnak UTSW 19 8,989,824 (GRCm39) intron probably benign
R4882:Ahnak UTSW 19 8,983,261 (GRCm39) missense probably damaging 0.98
R4884:Ahnak UTSW 19 8,990,118 (GRCm39) intron probably benign
R4895:Ahnak UTSW 19 8,994,805 (GRCm39) missense probably benign 0.43
R4930:Ahnak UTSW 19 8,988,331 (GRCm39) missense possibly damaging 0.79
R4951:Ahnak UTSW 19 8,995,199 (GRCm39) missense probably damaging 1.00
R4968:Ahnak UTSW 19 8,992,464 (GRCm39) missense probably damaging 1.00
R5026:Ahnak UTSW 19 8,987,995 (GRCm39) missense possibly damaging 0.46
R5050:Ahnak UTSW 19 8,989,822 (GRCm39) intron probably benign
R5073:Ahnak UTSW 19 8,980,595 (GRCm39) missense probably benign 0.42
R5110:Ahnak UTSW 19 8,992,123 (GRCm39) missense probably damaging 1.00
R5119:Ahnak UTSW 19 8,991,008 (GRCm39) missense probably benign 0.00
R5128:Ahnak UTSW 19 8,994,451 (GRCm39) missense probably damaging 1.00
R5139:Ahnak UTSW 19 8,982,019 (GRCm39) missense probably damaging 1.00
R5150:Ahnak UTSW 19 8,988,268 (GRCm39) missense possibly damaging 0.46
R5151:Ahnak UTSW 19 8,994,933 (GRCm39) missense probably benign 0.03
R5165:Ahnak UTSW 19 8,993,029 (GRCm39) missense possibly damaging 0.95
R5236:Ahnak UTSW 19 8,978,048 (GRCm39) missense possibly damaging 0.92
R5361:Ahnak UTSW 19 8,992,705 (GRCm39) missense possibly damaging 0.92
R5366:Ahnak UTSW 19 8,994,099 (GRCm39) missense possibly damaging 0.65
R5387:Ahnak UTSW 19 8,981,055 (GRCm39) missense probably damaging 1.00
R5396:Ahnak UTSW 19 8,984,539 (GRCm39) missense probably damaging 0.99
R5583:Ahnak UTSW 19 8,984,281 (GRCm39) missense probably damaging 0.99
R5587:Ahnak UTSW 19 8,986,840 (GRCm39) missense possibly damaging 0.88
R5620:Ahnak UTSW 19 8,990,458 (GRCm39) nonsense probably null
R5643:Ahnak UTSW 19 8,988,021 (GRCm39) missense possibly damaging 0.66
R5644:Ahnak UTSW 19 8,988,021 (GRCm39) missense possibly damaging 0.66
R5657:Ahnak UTSW 19 8,991,979 (GRCm39) missense probably damaging 0.99
R5688:Ahnak UTSW 19 8,979,883 (GRCm39) missense probably benign 0.01
R5702:Ahnak UTSW 19 8,979,204 (GRCm39) missense probably damaging 1.00
R5727:Ahnak UTSW 19 8,994,111 (GRCm39) missense probably damaging 0.99
R5730:Ahnak UTSW 19 8,987,617 (GRCm39) missense possibly damaging 0.81
R5755:Ahnak UTSW 19 8,979,096 (GRCm39) missense probably benign 0.06
R5760:Ahnak UTSW 19 8,990,926 (GRCm39) missense probably damaging 1.00
R5789:Ahnak UTSW 19 8,979,685 (GRCm39) missense probably benign 0.00
R5790:Ahnak UTSW 19 8,992,612 (GRCm39) missense probably damaging 0.99
R5795:Ahnak UTSW 19 8,989,746 (GRCm39) nonsense probably null
R5808:Ahnak UTSW 19 8,987,599 (GRCm39) missense possibly damaging 0.91
R5867:Ahnak UTSW 19 8,987,416 (GRCm39) missense probably damaging 0.99
R5878:Ahnak UTSW 19 8,985,706 (GRCm39) missense probably damaging 1.00
R5898:Ahnak UTSW 19 8,995,575 (GRCm39) missense probably damaging 1.00
R5898:Ahnak UTSW 19 8,991,131 (GRCm39) missense possibly damaging 0.63
R5912:Ahnak UTSW 19 8,989,267 (GRCm39) missense probably damaging 0.99
R5935:Ahnak UTSW 19 8,992,546 (GRCm39) missense possibly damaging 0.91
R5969:Ahnak UTSW 19 8,993,949 (GRCm39) missense probably damaging 1.00
R5988:Ahnak UTSW 19 8,986,711 (GRCm39) intron probably benign
R6000:Ahnak UTSW 19 8,990,475 (GRCm39) nonsense probably null
R6005:Ahnak UTSW 19 8,992,525 (GRCm39) missense possibly damaging 0.61
R6101:Ahnak UTSW 19 8,981,463 (GRCm39) missense probably benign 0.20
R6105:Ahnak UTSW 19 8,981,463 (GRCm39) missense probably benign 0.20
R6116:Ahnak UTSW 19 8,990,327 (GRCm39) intron probably benign
R6209:Ahnak UTSW 19 8,989,930 (GRCm39) missense probably damaging 1.00
R6240:Ahnak UTSW 19 8,990,947 (GRCm39) missense probably damaging 1.00
R6255:Ahnak UTSW 19 8,985,389 (GRCm39) missense possibly damaging 0.95
R6263:Ahnak UTSW 19 8,995,641 (GRCm39) missense probably benign 0.03
R6287:Ahnak UTSW 19 8,992,367 (GRCm39) missense probably benign 0.02
R6296:Ahnak UTSW 19 8,980,669 (GRCm39) missense probably damaging 0.99
R6315:Ahnak UTSW 19 8,983,990 (GRCm39) missense probably damaging 0.99
R6328:Ahnak UTSW 19 8,984,512 (GRCm39) missense probably benign 0.11
R6331:Ahnak UTSW 19 8,983,989 (GRCm39) missense probably benign 0.18
R6355:Ahnak UTSW 19 8,986,126 (GRCm39) missense probably benign 0.02
R6409:Ahnak UTSW 19 8,986,938 (GRCm39) missense probably benign 0.31
R6567:Ahnak UTSW 19 8,986,170 (GRCm39) missense probably benign 0.27
R6572:Ahnak UTSW 19 8,985,340 (GRCm39) missense probably damaging 0.99
R6574:Ahnak UTSW 19 8,994,411 (GRCm39) missense probably benign 0.04
R6590:Ahnak UTSW 19 8,986,945 (GRCm39) missense probably benign 0.29
R6620:Ahnak UTSW 19 8,992,674 (GRCm39) missense possibly damaging 0.95
R6690:Ahnak UTSW 19 8,986,945 (GRCm39) missense probably benign 0.29
R6731:Ahnak UTSW 19 8,988,926 (GRCm39) missense possibly damaging 0.85
R6756:Ahnak UTSW 19 8,984,925 (GRCm39) missense possibly damaging 0.59
R6846:Ahnak UTSW 19 8,989,221 (GRCm39) missense possibly damaging 0.66
R6854:Ahnak UTSW 19 8,992,599 (GRCm39) missense probably damaging 1.00
R6857:Ahnak UTSW 19 9,014,532 (GRCm39) nonsense probably null
R6863:Ahnak UTSW 19 8,989,729 (GRCm39) intron probably benign
R6876:Ahnak UTSW 19 8,991,484 (GRCm39) missense probably damaging 0.99
R6958:Ahnak UTSW 19 8,992,579 (GRCm39) missense possibly damaging 0.88
R7126:Ahnak UTSW 19 8,979,723 (GRCm39) missense possibly damaging 0.61
R7181:Ahnak UTSW 19 8,990,852 (GRCm39) missense probably damaging 1.00
R7183:Ahnak UTSW 19 8,995,032 (GRCm39) missense probably damaging 1.00
R7202:Ahnak UTSW 19 8,995,163 (GRCm39) missense probably damaging 1.00
R7235:Ahnak UTSW 19 8,989,852 (GRCm39) missense unknown
R7241:Ahnak UTSW 19 8,986,395 (GRCm39) missense possibly damaging 0.65
R7269:Ahnak UTSW 19 8,983,981 (GRCm39) missense probably damaging 1.00
R7311:Ahnak UTSW 19 8,979,507 (GRCm39) missense probably benign 0.04
R7311:Ahnak UTSW 19 8,987,191 (GRCm39) missense possibly damaging 0.56
R7329:Ahnak UTSW 19 8,979,156 (GRCm39) missense probably damaging 0.99
R7339:Ahnak UTSW 19 8,985,529 (GRCm39) missense possibly damaging 0.75
R7390:Ahnak UTSW 19 8,980,569 (GRCm39) missense probably benign 0.02
R7400:Ahnak UTSW 19 8,991,977 (GRCm39) missense probably damaging 0.99
R7444:Ahnak UTSW 19 8,984,787 (GRCm39) missense probably benign 0.08
R7483:Ahnak UTSW 19 8,982,186 (GRCm39) missense probably damaging 1.00
R7498:Ahnak UTSW 19 8,989,383 (GRCm39) missense probably benign 0.14
R7521:Ahnak UTSW 19 8,979,715 (GRCm39) missense possibly damaging 0.89
R7522:Ahnak UTSW 19 8,979,686 (GRCm39) missense probably benign 0.01
R7552:Ahnak UTSW 19 8,984,188 (GRCm39) missense probably benign 0.18
R7563:Ahnak UTSW 19 8,988,529 (GRCm39) missense probably damaging 0.99
R7565:Ahnak UTSW 19 8,993,520 (GRCm39) missense probably benign 0.05
R7583:Ahnak UTSW 19 8,983,457 (GRCm39) missense possibly damaging 0.90
R7600:Ahnak UTSW 19 8,981,938 (GRCm39) missense possibly damaging 0.89
R7771:Ahnak UTSW 19 8,992,411 (GRCm39) missense probably damaging 0.99
R7787:Ahnak UTSW 19 8,986,679 (GRCm39) missense unknown
R7827:Ahnak UTSW 19 8,982,708 (GRCm39) nonsense probably null
R7857:Ahnak UTSW 19 8,984,832 (GRCm39) missense probably damaging 0.97
R7916:Ahnak UTSW 19 8,983,196 (GRCm39) missense possibly damaging 0.66
R7939:Ahnak UTSW 19 8,991,448 (GRCm39) nonsense probably null
R7959:Ahnak UTSW 19 8,988,013 (GRCm39) missense possibly damaging 0.46
R7962:Ahnak UTSW 19 8,990,164 (GRCm39) missense unknown
R7979:Ahnak UTSW 19 8,988,796 (GRCm39) missense probably damaging 1.00
R8006:Ahnak UTSW 19 8,989,447 (GRCm39) missense possibly damaging 0.79
R8013:Ahnak UTSW 19 8,986,699 (GRCm39) missense unknown
R8033:Ahnak UTSW 19 8,981,074 (GRCm39) missense probably benign 0.10
R8124:Ahnak UTSW 19 8,984,487 (GRCm39) missense probably damaging 0.99
R8125:Ahnak UTSW 19 8,989,240 (GRCm39) missense possibly damaging 0.95
R8129:Ahnak UTSW 19 8,977,464 (GRCm39) start codon destroyed not run
R8151:Ahnak UTSW 19 8,982,043 (GRCm39) missense possibly damaging 0.59
R8190:Ahnak UTSW 19 8,979,619 (GRCm39) missense probably benign 0.01
R8221:Ahnak UTSW 19 8,987,800 (GRCm39) nonsense probably null
R8241:Ahnak UTSW 19 8,984,659 (GRCm39) missense probably benign 0.15
R8244:Ahnak UTSW 19 8,993,037 (GRCm39) missense probably benign 0.44
R8248:Ahnak UTSW 19 8,979,310 (GRCm39) missense probably damaging 1.00
R8261:Ahnak UTSW 19 8,982,817 (GRCm39) missense probably damaging 1.00
R8330:Ahnak UTSW 19 8,987,026 (GRCm39) missense possibly damaging 0.86
R8380:Ahnak UTSW 19 8,995,219 (GRCm39) missense probably benign 0.05
R8407:Ahnak UTSW 19 8,993,037 (GRCm39) missense probably benign 0.44
R8409:Ahnak UTSW 19 8,993,037 (GRCm39) missense probably benign 0.44
R8463:Ahnak UTSW 19 8,986,113 (GRCm39) missense probably benign 0.07
R8511:Ahnak UTSW 19 8,989,719 (GRCm39) missense unknown
R8528:Ahnak UTSW 19 8,985,092 (GRCm39) missense probably damaging 1.00
R8549:Ahnak UTSW 19 8,988,847 (GRCm39) missense probably damaging 1.00
R8674:Ahnak UTSW 19 8,983,360 (GRCm39) missense probably damaging 0.98
R8716:Ahnak UTSW 19 8,986,438 (GRCm39) missense probably damaging 1.00
R8722:Ahnak UTSW 19 8,990,710 (GRCm39) nonsense probably null
R8751:Ahnak UTSW 19 8,987,509 (GRCm39) missense probably damaging 1.00
R8752:Ahnak UTSW 19 8,992,901 (GRCm39) missense probably damaging 1.00
R8783:Ahnak UTSW 19 8,988,837 (GRCm39) missense probably damaging 1.00
R8844:Ahnak UTSW 19 8,984,254 (GRCm39) missense probably damaging 1.00
R8859:Ahnak UTSW 19 8,984,567 (GRCm39) missense probably damaging 1.00
R8882:Ahnak UTSW 19 8,978,106 (GRCm39) missense probably damaging 1.00
R8907:Ahnak UTSW 19 8,986,452 (GRCm39) missense probably benign 0.24
R8938:Ahnak UTSW 19 8,989,099 (GRCm39) missense probably benign 0.00
R8975:Ahnak UTSW 19 8,990,101 (GRCm39) missense probably damaging 1.00
R8983:Ahnak UTSW 19 8,981,477 (GRCm39) missense possibly damaging 0.75
R9017:Ahnak UTSW 19 8,987,487 (GRCm39) missense probably damaging 1.00
R9027:Ahnak UTSW 19 8,984,617 (GRCm39) missense possibly damaging 0.94
R9081:Ahnak UTSW 19 8,985,890 (GRCm39) missense possibly damaging 0.81
R9104:Ahnak UTSW 19 8,987,711 (GRCm39) missense probably benign 0.01
R9112:Ahnak UTSW 19 8,987,149 (GRCm39) missense probably damaging 0.98
R9145:Ahnak UTSW 19 8,992,287 (GRCm39) missense probably benign 0.38
R9189:Ahnak UTSW 19 8,988,247 (GRCm39) missense possibly damaging 0.92
R9221:Ahnak UTSW 19 8,989,943 (GRCm39) missense probably damaging 1.00
R9261:Ahnak UTSW 19 8,993,503 (GRCm39) missense possibly damaging 0.63
R9299:Ahnak UTSW 19 8,989,824 (GRCm39) intron probably benign
R9325:Ahnak UTSW 19 8,991,257 (GRCm39) missense probably benign 0.12
R9337:Ahnak UTSW 19 8,989,824 (GRCm39) intron probably benign
R9340:Ahnak UTSW 19 8,994,411 (GRCm39) missense probably benign 0.04
R9351:Ahnak UTSW 19 8,985,232 (GRCm39) missense probably damaging 1.00
R9416:Ahnak UTSW 19 8,990,266 (GRCm39) missense unknown
R9462:Ahnak UTSW 19 8,981,299 (GRCm39) missense probably damaging 0.96
R9469:Ahnak UTSW 19 8,988,225 (GRCm39) missense probably damaging 1.00
R9485:Ahnak UTSW 19 8,979,438 (GRCm39) missense probably benign 0.16
R9503:Ahnak UTSW 19 8,987,458 (GRCm39) missense probably damaging 1.00
R9524:Ahnak UTSW 19 9,014,617 (GRCm39) missense
R9534:Ahnak UTSW 19 8,980,976 (GRCm39) missense probably benign 0.20
R9598:Ahnak UTSW 19 8,981,149 (GRCm39) missense probably benign 0.42
R9611:Ahnak UTSW 19 8,989,162 (GRCm39) missense probably damaging 0.99
R9624:Ahnak UTSW 19 8,989,846 (GRCm39) missense unknown
R9649:Ahnak UTSW 19 8,985,786 (GRCm39) nonsense probably null
R9683:Ahnak UTSW 19 8,984,719 (GRCm39) missense possibly damaging 0.94
R9691:Ahnak UTSW 19 8,989,090 (GRCm39) missense possibly damaging 0.49
R9712:Ahnak UTSW 19 8,984,393 (GRCm39) small deletion probably benign
R9712:Ahnak UTSW 19 8,984,392 (GRCm39) small deletion probably benign
R9713:Ahnak UTSW 19 8,984,393 (GRCm39) small deletion probably benign
R9715:Ahnak UTSW 19 8,984,393 (GRCm39) small deletion probably benign
R9725:Ahnak UTSW 19 8,991,607 (GRCm39) missense probably damaging 1.00
R9725:Ahnak UTSW 19 8,981,533 (GRCm39) missense probably benign 0.44
R9747:Ahnak UTSW 19 8,987,541 (GRCm39) missense possibly damaging 0.49
R9798:Ahnak UTSW 19 8,990,983 (GRCm39) missense probably damaging 0.99
RF007:Ahnak UTSW 19 8,990,965 (GRCm39) missense possibly damaging 0.45
X0021:Ahnak UTSW 19 8,990,983 (GRCm39) missense probably damaging 0.99
X0027:Ahnak UTSW 19 8,989,401 (GRCm39) missense probably damaging 1.00
Z1088:Ahnak UTSW 19 8,993,446 (GRCm39) missense probably damaging 0.99
Z1176:Ahnak UTSW 19 8,986,220 (GRCm39) missense probably damaging 0.97
Z1177:Ahnak UTSW 19 8,994,832 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCTCTGTGCTTGAATGGG -3'
(R):5'- GAATGGAACCAGCCACATGC -3'

Sequencing Primer
(F):5'- CCTCTGTGCTTGAATGGGCAATAC -3'
(R):5'- AACCAGCAGAGAGAAGTCAC -3'
Posted On 2019-10-17