Incidental Mutation 'R7490:Dsg4'
ID585887
Institutional Source Beutler Lab
Gene Symbol Dsg4
Ensembl Gene ENSMUSG00000001804
Gene Namedesmoglein 4
Synonymslah, CDHF13
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.664) question?
Stock #R7490 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location20436175-20471821 bp(+) (GRCm38)
Type of Mutationintron (22 bp from exon)
DNA Base Change (assembly) T to A at 20451936 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000019426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019426]
Predicted Effect probably null
Transcript: ENSMUST00000019426
SMART Domains Protein: ENSMUSP00000019426
Gene: ENSMUSG00000001804

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 70 155 1.54e-11 SMART
CA 179 267 4.27e-19 SMART
CA 290 384 5.48e-8 SMART
CA 411 495 9.4e-7 SMART
transmembrane domain 634 656 N/A INTRINSIC
low complexity region 724 736 N/A INTRINSIC
Pfam:Cadherin_C 749 849 3.1e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. This gene is expressed in the suprabasal epidermis and hair follicle. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the lanceolate hair phenotype in mice. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik T C 1: 53,163,230 D132G possibly damaging Het
Abca5 T C 11: 110,277,611 E1424G possibly damaging Het
Adamts4 C T 1: 171,256,600 Q549* probably null Het
Adcy4 A G 14: 55,770,433 I893T possibly damaging Het
Ago1 A T 4: 126,439,505 *858R probably null Het
Ank2 T A 3: 126,958,889 I393L probably damaging Het
Ankrd44 T C 1: 54,648,300 T987A probably benign Het
Ap2a1 G T 7: 44,902,789 N790K probably benign Het
Aqr A G 2: 114,158,868 probably null Het
Arel1 G T 12: 84,941,911 F21L probably damaging Het
Atp1a3 T C 7: 24,987,470 D743G probably damaging Het
Atp9a A T 2: 168,675,352 F354I probably benign Het
Bag6 A G 17: 35,140,842 H259R unknown Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 GTCACTGGTTCTGTG GTCACTGGTTCTGTGTTCACTGGTTCTGTG 3: 95,888,166 probably benign Het
BC028528 TGGTT TGGTTCTGTGGTCACGGGTT 3: 95,888,186 probably benign Het
Bckdk T A 7: 127,904,973 S15T unknown Het
C4b G T 17: 34,731,080 Y1405* probably null Het
Camk4 G A 18: 32,939,545 probably null Het
Car11 T A 7: 45,700,318 W16R probably benign Het
Ccdc80 A C 16: 45,096,400 E506D probably damaging Het
Chmp6 C T 11: 119,915,443 Q32* probably null Het
Colq G A 14: 31,545,086 P166S possibly damaging Het
Ctxn3 T C 18: 57,477,285 M58T probably damaging Het
Cxcl3 A T 5: 90,786,657 I93L unknown Het
Dnaaf2 T C 12: 69,197,606 Y227C probably damaging Het
Dner CGCTGCTGCTGCTGCTGCTGCTGCTGC CGCTGCTGCTGCTGCTGCTGCTGC 1: 84,585,549 probably benign Het
Dnmt3a G A 12: 3,904,204 G792D probably damaging Het
Ecm2 C T 13: 49,530,342 Q599* probably null Het
Fbxl13 T A 5: 21,523,060 R550* probably null Het
Gm4302 A T 10: 100,341,583 Q243L unknown Het
Gm7168 A T 17: 13,949,013 Y214F probably benign Het
Gtf3c1 C T 7: 125,647,491 D1549N probably damaging Het
Gtf3c5 A T 2: 28,571,141 D320E probably damaging Het
Hivep1 T A 13: 42,157,650 V1122D probably damaging Het
Ibtk T C 9: 85,718,934 probably null Het
Irs1 T A 1: 82,287,264 Q1077L probably damaging Het
Ivd A T 2: 118,876,892 M296L possibly damaging Het
Katnal1 T C 5: 148,891,682 D318G probably null Het
L3mbtl3 C T 10: 26,339,231 V194I unknown Het
Malt1 C A 18: 65,448,211 Q237K probably benign Het
March11 C T 15: 26,311,101 A221V possibly damaging Het
Mgea5 G A 19: 45,767,447 R586* probably null Het
Nfe2l3 A G 6: 51,457,544 I361M possibly damaging Het
Nrg1 G A 8: 31,818,654 R493C probably damaging Het
Olfr1019 A T 2: 85,840,963 V276E probably damaging Het
Olfr1212 A C 2: 88,959,048 Y194S probably benign Het
Olfr453 T C 6: 42,744,805 I256T probably damaging Het
Olfr577 G A 7: 102,973,810 P61S probably damaging Het
Olfr828 A T 9: 18,815,933 Y120* probably null Het
Olfr980 T A 9: 40,006,424 H175L probably damaging Het
Orai3 C T 7: 127,773,627 A100V possibly damaging Het
Oxsm T A 14: 16,241,066 M328L probably benign Het
Pan2 T C 10: 128,308,440 V186A probably benign Het
Pkd1l1 T A 11: 8,916,265 D980V Het
Ppp1r16b T C 2: 158,761,468 Y438H probably damaging Het
Ppp4c A T 7: 126,787,332 H164Q probably damaging Het
Prl8a2 C A 13: 27,352,770 T125K possibly damaging Het
Rasa2 T C 9: 96,566,122 N494S possibly damaging Het
Rpl18a T C 8: 70,895,506 D147G probably benign Het
Scg3 T C 9: 75,669,277 D272G possibly damaging Het
Serpinb6c T A 13: 33,893,835 D184V probably benign Het
Simc1 T G 13: 54,524,349 L170R possibly damaging Het
Slx4 T C 16: 3,980,131 E1463G possibly damaging Het
Stk31 T A 6: 49,439,232 probably null Het
Tas1r3 A G 4: 155,862,023 I375T probably damaging Het
Tbc1d24 T C 17: 24,182,520 D405G probably damaging Het
Tcerg1l G A 7: 138,259,828 P391S probably damaging Het
Tiam1 T C 16: 89,898,195 S125G probably benign Het
Trim16 C A 11: 62,834,123 H246N probably damaging Het
Tti1 T A 2: 157,995,472 N896I probably damaging Het
Ubash3a A G 17: 31,232,312 N395S probably damaging Het
Uggt1 T C 1: 36,164,508 I1014V probably benign Het
Vmn1r30 T A 6: 58,435,229 Q206L possibly damaging Het
Washc5 T A 15: 59,337,204 N1057I probably benign Het
Xpo4 GGTATTAGCGGAGT GGT 14: 57,602,621 probably null Het
Zcchc14 A T 8: 121,605,017 S536T unknown Het
Other mutations in Dsg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Dsg4 APN 18 20461326 missense probably benign 0.22
IGL01723:Dsg4 APN 18 20466510 missense probably damaging 1.00
IGL02249:Dsg4 APN 18 20461304 missense possibly damaging 0.69
IGL02445:Dsg4 APN 18 20446250 splice site probably benign
IGL02553:Dsg4 APN 18 20462520 missense probably benign
IGL02578:Dsg4 APN 18 20471193 missense possibly damaging 0.94
IGL02634:Dsg4 APN 18 20458580 missense probably benign 0.01
IGL02677:Dsg4 APN 18 20464876 missense possibly damaging 0.62
IGL02741:Dsg4 APN 18 20471496 missense probably benign
IGL02747:Dsg4 APN 18 20446938 missense probably damaging 0.97
IGL03342:Dsg4 APN 18 20451823 missense probably damaging 1.00
burrito UTSW 18 20451862 missense possibly damaging 0.81
R0043:Dsg4 UTSW 18 20452972 missense probably damaging 1.00
R0375:Dsg4 UTSW 18 20470879 missense probably damaging 1.00
R0537:Dsg4 UTSW 18 20458571 missense probably damaging 1.00
R0619:Dsg4 UTSW 18 20461359 missense probably benign 0.00
R0622:Dsg4 UTSW 18 20449788 missense possibly damaging 0.51
R0765:Dsg4 UTSW 18 20454646 splice site probably benign
R0786:Dsg4 UTSW 18 20449372 critical splice donor site probably null
R1114:Dsg4 UTSW 18 20466483 missense possibly damaging 0.62
R1249:Dsg4 UTSW 18 20446872 nonsense probably null
R1372:Dsg4 UTSW 18 20449676 splice site probably null
R1382:Dsg4 UTSW 18 20465124 missense probably benign 0.00
R1392:Dsg4 UTSW 18 20446247 splice site probably benign
R1442:Dsg4 UTSW 18 20462660 missense possibly damaging 0.76
R1503:Dsg4 UTSW 18 20449679 missense probably damaging 1.00
R1704:Dsg4 UTSW 18 20471589 missense probably damaging 1.00
R1716:Dsg4 UTSW 18 20462461 nonsense probably null
R1765:Dsg4 UTSW 18 20456831 missense probably benign 0.01
R1817:Dsg4 UTSW 18 20471245 missense probably damaging 1.00
R1982:Dsg4 UTSW 18 20471212 missense probably damaging 1.00
R2025:Dsg4 UTSW 18 20466636 nonsense probably null
R2097:Dsg4 UTSW 18 20471044 missense probably damaging 1.00
R2198:Dsg4 UTSW 18 20461442 missense probably benign
R3551:Dsg4 UTSW 18 20451756 missense probably damaging 1.00
R3742:Dsg4 UTSW 18 20471001 missense probably damaging 1.00
R3853:Dsg4 UTSW 18 20449234 missense probably benign
R3955:Dsg4 UTSW 18 20449375 splice site probably null
R4006:Dsg4 UTSW 18 20470965 missense probably damaging 0.97
R4012:Dsg4 UTSW 18 20451862 missense possibly damaging 0.81
R4171:Dsg4 UTSW 18 20458579 nonsense probably null
R4254:Dsg4 UTSW 18 20471538 missense probably benign 0.07
R4504:Dsg4 UTSW 18 20461436 missense probably benign 0.00
R4559:Dsg4 UTSW 18 20470921 missense probably damaging 1.00
R4607:Dsg4 UTSW 18 20471245 missense probably damaging 1.00
R4612:Dsg4 UTSW 18 20462413 missense probably benign 0.10
R4683:Dsg4 UTSW 18 20461409 missense probably benign
R4700:Dsg4 UTSW 18 20456908 missense possibly damaging 0.91
R4749:Dsg4 UTSW 18 20446831 missense possibly damaging 0.88
R4775:Dsg4 UTSW 18 20471127 missense possibly damaging 0.48
R4809:Dsg4 UTSW 18 20466621 missense possibly damaging 0.82
R5276:Dsg4 UTSW 18 20446839 missense probably benign 0.21
R5426:Dsg4 UTSW 18 20458484 missense probably damaging 1.00
R5767:Dsg4 UTSW 18 20462492 nonsense probably null
R5982:Dsg4 UTSW 18 20465169 missense possibly damaging 0.76
R6280:Dsg4 UTSW 18 20466667 missense probably damaging 1.00
R6305:Dsg4 UTSW 18 20449790 missense probably damaging 1.00
R6489:Dsg4 UTSW 18 20471363 missense possibly damaging 0.93
R7013:Dsg4 UTSW 18 20458521 missense possibly damaging 0.58
R7040:Dsg4 UTSW 18 20451852 missense probably benign 0.01
R7196:Dsg4 UTSW 18 20466480 missense probably damaging 1.00
R7432:Dsg4 UTSW 18 20446266 nonsense probably null
R7438:Dsg4 UTSW 18 20466628 missense probably damaging 0.96
R7612:Dsg4 UTSW 18 20470990 missense probably damaging 1.00
R7639:Dsg4 UTSW 18 20449712 missense probably damaging 1.00
R7905:Dsg4 UTSW 18 20454669 missense probably damaging 1.00
R7988:Dsg4 UTSW 18 20454669 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGAGGGATTGAATCTAGTAGAAT -3'
(R):5'- TGACCCAGTGCCATTATTTGT -3'

Sequencing Primer
(F):5'- CACTGGTGGTAAAGTTAAGTGCCAC -3'
(R):5'- TCCTGAGCACTGGACTA -3'
Posted On2019-10-18