Incidental Mutation 'R7498:Hmcn2'
ID 585897
Institutional Source Beutler Lab
Gene Symbol Hmcn2
Ensembl Gene ENSMUSG00000055632
Gene Name hemicentin 2
Synonyms
MMRRC Submission 045571-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7498 (G1)
Quality Score 99.0078
Status Validated
Chromosome 2
Chromosomal Location 31204427-31350750 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to C at 31273487 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113532] [ENSMUST00000226996]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000113532
SMART Domains Protein: ENSMUSP00000109160
Gene: ENSMUSG00000055632

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
VWA 37 211 1.21e-1 SMART
Blast:IG_like 263 340 2e-38 BLAST
IG 434 515 7.36e-2 SMART
IGc2 530 595 1.91e-9 SMART
IGc2 621 685 4.81e-15 SMART
IGc2 711 773 1.09e-13 SMART
IGc2 799 866 2.72e-14 SMART
IGc2 894 959 1.95e-15 SMART
IGc2 985 1049 5e-13 SMART
IGc2 1082 1147 1.09e-13 SMART
low complexity region 1151 1169 N/A INTRINSIC
IGc2 1173 1232 7.07e-13 SMART
IGc2 1260 1326 4.31e-17 SMART
IGc2 1354 1428 3e-16 SMART
IGc2 1456 1522 1.82e-15 SMART
IGc2 1550 1615 2.7e-18 SMART
IGc2 1644 1708 1.3e-11 SMART
IGc2 1736 1801 6.69e-14 SMART
IG 1826 1917 2.31e0 SMART
IGc2 1932 1997 4.62e-17 SMART
IGc2 2024 2091 3.25e-12 SMART
IGc2 2117 2182 1.28e-10 SMART
IGc2 2209 2276 3.76e-8 SMART
IGc2 2305 2370 2.6e-11 SMART
IGc2 2399 2464 1.32e-12 SMART
IGc2 2492 2557 2.06e-14 SMART
IGc2 2588 2653 3.9e-15 SMART
IGc2 2686 2751 2.64e-12 SMART
IGc2 2797 2862 9.05e-11 SMART
IGc2 2892 2957 4.7e-9 SMART
IGc2 2984 3049 1.44e-13 SMART
IGc2 3079 3144 9.33e-13 SMART
IGc2 3171 3236 3.79e-13 SMART
IGc2 3264 3331 1.85e-16 SMART
IGc2 3360 3425 9.61e-15 SMART
low complexity region 3433 3445 N/A INTRINSIC
IGc2 3453 3514 5.83e-14 SMART
IGc2 3542 3600 1.76e-8 SMART
low complexity region 3613 3627 N/A INTRINSIC
IGc2 3628 3693 5.2e-11 SMART
IGc2 3719 3784 2.64e-12 SMART
IGc2 3810 3877 3.35e-5 SMART
IGc2 3903 3968 3.73e-12 SMART
IGc2 3994 4058 4.39e-9 SMART
IGc2 4084 4149 1.79e-14 SMART
low complexity region 4157 4169 N/A INTRINSIC
IGc2 4175 4238 9.33e-13 SMART
IGc2 4265 4329 7.22e-19 SMART
IGc2 4355 4419 1.59e-15 SMART
Pfam:G2F 4431 4613 1.7e-56 PFAM
EGF_CA 4668 4708 5.78e-11 SMART
EGF_CA 4709 4753 9.39e-11 SMART
EGF_CA 4754 4796 7.69e-7 SMART
EGF_CA 4797 4837 2.19e-11 SMART
EGF_CA 4904 4943 6.74e-12 SMART
EGF_like 4944 4989 1.87e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226996
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 99% (75/76)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik G A 2: 68,498,012 (GRCm39) E148K unknown Het
Adgrl2 T A 3: 148,564,852 (GRCm39) K243* probably null Het
Adgrv1 A T 13: 81,588,344 (GRCm39) V4414E possibly damaging Het
Ahnak A T 19: 8,989,383 (GRCm39) I3556F probably benign Het
Akap6 C T 12: 53,189,488 (GRCm39) R2301* probably null Het
Alg6 A G 4: 99,636,933 (GRCm39) T305A probably damaging Het
Alpk1 C T 3: 127,473,427 (GRCm39) A859T probably benign Het
Apba3 T A 10: 81,104,735 (GRCm39) F3I possibly damaging Het
Birc6 A G 17: 74,967,465 (GRCm39) E4151G probably damaging Het
Bmp2k T A 5: 97,235,978 (GRCm39) F1134I probably benign Het
C6 A T 15: 4,792,846 (GRCm39) H317L probably damaging Het
Catsperg2 G A 7: 29,416,527 (GRCm39) S295L possibly damaging Het
Ccdc142 G T 6: 83,080,212 (GRCm39) R385L possibly damaging Het
Ciz1 A T 2: 32,261,761 (GRCm39) M482L probably benign Het
Crisp3 A G 17: 40,536,693 (GRCm39) probably null Het
Dcaf15 G A 8: 84,828,392 (GRCm39) P233S probably damaging Het
Def8 A G 8: 124,174,583 (GRCm39) N16S probably damaging Het
Dnah7b T G 1: 46,364,925 (GRCm39) S3569A probably damaging Het
Dok6 C T 18: 89,787,443 (GRCm39) probably benign Het
Dop1a A T 9: 86,376,464 (GRCm39) T233S possibly damaging Het
Ep300 T A 15: 81,524,044 (GRCm39) V1325D unknown Het
Fancm T A 12: 65,146,165 (GRCm39) H629Q probably benign Het
Fbxo10 T C 4: 45,062,194 (GRCm39) S111G probably benign Het
Fbxo21 T C 5: 118,140,239 (GRCm39) probably null Het
Fdx1 A C 9: 51,859,898 (GRCm39) L144R probably damaging Het
Fgfr3 GGACCTCTCCGTG GG 5: 33,892,766 (GRCm39) probably null Het
Flot2 G A 11: 77,944,188 (GRCm39) probably null Het
Fndc10 C T 4: 155,779,195 (GRCm39) R80C probably damaging Het
Fut8 A T 12: 77,459,708 (GRCm39) T274S probably benign Het
Gli2 T C 1: 118,763,565 (GRCm39) M1529V possibly damaging Het
Gm7361 C A 5: 26,466,188 (GRCm39) H183Q probably benign Het
Hdlbp T A 1: 93,341,337 (GRCm39) H1007L probably benign Het
Inhbb C T 1: 119,345,608 (GRCm39) R227H probably damaging Het
Kifc1 A G 17: 34,102,846 (GRCm39) F256L probably benign Het
Lman2 A T 13: 55,494,790 (GRCm39) F326Y probably damaging Het
Mcmdc2 T C 1: 9,989,302 (GRCm39) V242A probably benign Het
Mettl8 A C 2: 70,795,969 (GRCm39) V306G probably damaging Het
Mog A T 17: 37,322,984 (GRCm39) probably null Het
Morc2b G A 17: 33,356,833 (GRCm39) A313V possibly damaging Het
Myh3 A G 11: 66,987,874 (GRCm39) N1449S possibly damaging Het
Myh8 C A 11: 67,174,263 (GRCm39) T200K possibly damaging Het
Myo16 T A 8: 10,450,589 (GRCm39) H530Q unknown Het
Neb C T 2: 52,148,188 (GRCm39) R2686H probably damaging Het
Nudt2 T C 4: 41,480,539 (GRCm39) F141L possibly damaging Het
Obscn G A 11: 58,973,539 (GRCm39) H1931Y probably damaging Het
Odad3 A G 9: 21,913,553 (GRCm39) I73T probably damaging Het
Or10al5 A G 17: 38,063,242 (GRCm39) T166A probably damaging Het
Or2d4 A T 7: 106,543,575 (GRCm39) V211D possibly damaging Het
Or5p80 T A 7: 108,229,623 (GRCm39) C141* probably null Het
Plcb1 T A 2: 135,104,153 (GRCm39) L274* probably null Het
Plcb1 G T 2: 135,104,154 (GRCm39) L274F probably damaging Het
Potefam3d A C 8: 69,972,475 (GRCm39) Y91* probably null Het
Prc1 C T 7: 79,962,898 (GRCm39) T564M possibly damaging Het
Psd4 G A 2: 24,296,996 (GRCm39) R923Q probably damaging Het
Ptprj G A 2: 90,266,909 (GRCm39) Q1300* probably null Het
Rapgef6 G T 11: 54,510,830 (GRCm39) R249L probably damaging Het
Slain1 G A 14: 103,893,429 (GRCm39) probably null Het
Slfn9 A T 11: 82,873,013 (GRCm39) I630N probably damaging Het
Smg6 G A 11: 74,819,932 (GRCm39) A68T probably benign Het
Spata31h1 T A 10: 82,127,113 (GRCm39) T1966S probably benign Het
Spef2 T A 15: 9,727,625 (GRCm39) M153L probably benign Het
St8sia4 T A 1: 95,519,418 (GRCm39) M357L probably benign Het
Tal1 A T 4: 114,925,879 (GRCm39) H316L possibly damaging Het
Tenm4 A G 7: 96,497,224 (GRCm39) E1207G probably damaging Het
Tmem64 C A 4: 15,266,176 (GRCm39) H75Q probably benign Het
Tor4a A G 2: 25,085,804 (GRCm39) V33A probably benign Het
Traj52 C T 14: 54,402,818 (GRCm39) T15I Het
Trim50 G A 5: 135,392,768 (GRCm39) V228M probably benign Het
Trpm1 A T 7: 63,858,657 (GRCm39) I360F possibly damaging Het
Trpm6 A T 19: 18,853,484 (GRCm39) R1835W probably damaging Het
Ubn1 T C 16: 4,894,969 (GRCm39) S672P probably damaging Het
Ugt2a2 C T 5: 87,622,500 (GRCm39) C156Y probably damaging Het
Wnk1 T C 6: 119,904,157 (GRCm39) S2223G unknown Het
Wnt7b G T 15: 85,427,880 (GRCm39) A194E probably damaging Het
Zmpste24 A G 4: 120,940,028 (GRCm39) V206A probably benign Het
Other mutations in Hmcn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Hmcn2 APN 2 31,233,108 (GRCm39) missense probably damaging 1.00
IGL00966:Hmcn2 APN 2 31,319,006 (GRCm39) missense probably damaging 0.97
IGL00973:Hmcn2 APN 2 31,273,833 (GRCm39) intron probably benign
IGL01364:Hmcn2 APN 2 31,251,826 (GRCm39) nonsense probably null
IGL01486:Hmcn2 APN 2 31,226,633 (GRCm39) missense probably damaging 1.00
IGL01530:Hmcn2 APN 2 31,244,276 (GRCm39) missense possibly damaging 0.85
IGL01550:Hmcn2 APN 2 31,314,264 (GRCm39) missense possibly damaging 0.84
IGL01710:Hmcn2 APN 2 31,233,114 (GRCm39) missense probably damaging 1.00
IGL01764:Hmcn2 APN 2 31,295,642 (GRCm39) missense possibly damaging 0.93
IGL01924:Hmcn2 APN 2 31,288,929 (GRCm39) missense probably benign 0.00
IGL02003:Hmcn2 APN 2 31,318,994 (GRCm39) missense possibly damaging 0.90
IGL02117:Hmcn2 APN 2 31,347,185 (GRCm39) missense possibly damaging 0.75
IGL02205:Hmcn2 APN 2 31,290,139 (GRCm39) missense probably damaging 1.00
IGL02273:Hmcn2 APN 2 31,314,389 (GRCm39) missense probably benign 0.06
IGL02313:Hmcn2 APN 2 31,343,617 (GRCm39) missense possibly damaging 0.68
IGL02326:Hmcn2 APN 2 31,340,964 (GRCm39) missense probably damaging 0.97
IGL02486:Hmcn2 APN 2 31,310,107 (GRCm39) missense probably damaging 0.98
IGL02551:Hmcn2 APN 2 31,344,823 (GRCm39) missense possibly damaging 0.83
IGL02695:Hmcn2 APN 2 31,298,985 (GRCm39) missense possibly damaging 0.87
IGL02725:Hmcn2 APN 2 31,295,540 (GRCm39) missense probably damaging 1.00
IGL02792:Hmcn2 APN 2 31,236,602 (GRCm39) missense probably damaging 1.00
IGL02882:Hmcn2 APN 2 31,303,379 (GRCm39) nonsense probably null
IGL03003:Hmcn2 APN 2 31,323,498 (GRCm39) missense probably damaging 0.98
IGL03067:Hmcn2 APN 2 31,236,642 (GRCm39) missense probably damaging 1.00
IGL03137:Hmcn2 APN 2 31,252,242 (GRCm39) missense probably damaging 0.98
IGL03220:Hmcn2 APN 2 31,236,633 (GRCm39) missense possibly damaging 0.94
IGL03411:Hmcn2 APN 2 31,236,649 (GRCm39) missense possibly damaging 0.83
PIT4544001:Hmcn2 UTSW 2 31,318,262 (GRCm39) missense probably damaging 0.98
R0044:Hmcn2 UTSW 2 31,302,520 (GRCm39) missense probably damaging 0.98
R0044:Hmcn2 UTSW 2 31,302,520 (GRCm39) missense probably damaging 0.98
R0048:Hmcn2 UTSW 2 31,318,249 (GRCm39) missense possibly damaging 0.92
R0048:Hmcn2 UTSW 2 31,318,249 (GRCm39) missense possibly damaging 0.92
R0078:Hmcn2 UTSW 2 31,278,356 (GRCm39) missense probably damaging 1.00
R0090:Hmcn2 UTSW 2 31,316,210 (GRCm39) missense probably damaging 1.00
R0173:Hmcn2 UTSW 2 31,328,343 (GRCm39) critical splice donor site probably null
R0257:Hmcn2 UTSW 2 31,259,176 (GRCm39) splice site probably benign
R0266:Hmcn2 UTSW 2 31,335,365 (GRCm39) splice site probably benign
R0266:Hmcn2 UTSW 2 31,284,839 (GRCm39) missense probably benign 0.03
R0326:Hmcn2 UTSW 2 31,313,237 (GRCm39) nonsense probably null
R0366:Hmcn2 UTSW 2 31,314,218 (GRCm39) missense possibly damaging 0.88
R0400:Hmcn2 UTSW 2 31,290,141 (GRCm39) missense probably damaging 0.98
R0412:Hmcn2 UTSW 2 31,278,259 (GRCm39) missense probably damaging 0.98
R0436:Hmcn2 UTSW 2 31,295,624 (GRCm39) missense probably damaging 1.00
R0457:Hmcn2 UTSW 2 31,305,296 (GRCm39) critical splice donor site probably null
R0487:Hmcn2 UTSW 2 31,276,689 (GRCm39) missense possibly damaging 0.60
R0568:Hmcn2 UTSW 2 31,305,248 (GRCm39) missense probably benign 0.02
R0755:Hmcn2 UTSW 2 31,343,172 (GRCm39) missense probably damaging 0.99
R0811:Hmcn2 UTSW 2 31,310,383 (GRCm39) missense probably damaging 0.99
R0812:Hmcn2 UTSW 2 31,310,383 (GRCm39) missense probably damaging 0.99
R0964:Hmcn2 UTSW 2 31,281,523 (GRCm39) missense probably benign 0.23
R0988:Hmcn2 UTSW 2 31,225,463 (GRCm39) missense probably damaging 1.00
R1484:Hmcn2 UTSW 2 31,236,507 (GRCm39) missense probably damaging 1.00
R1509:Hmcn2 UTSW 2 31,204,491 (GRCm39) missense possibly damaging 0.86
R1535:Hmcn2 UTSW 2 31,310,419 (GRCm39) missense possibly damaging 0.91
R1574:Hmcn2 UTSW 2 31,294,899 (GRCm39) missense probably damaging 0.97
R1574:Hmcn2 UTSW 2 31,294,899 (GRCm39) missense probably damaging 0.97
R1600:Hmcn2 UTSW 2 31,320,799 (GRCm39) missense probably damaging 0.98
R1623:Hmcn2 UTSW 2 31,348,051 (GRCm39) missense possibly damaging 0.84
R1692:Hmcn2 UTSW 2 31,340,856 (GRCm39) missense possibly damaging 0.47
R1719:Hmcn2 UTSW 2 31,244,733 (GRCm39) missense probably damaging 1.00
R1747:Hmcn2 UTSW 2 31,347,997 (GRCm39) missense probably benign 0.00
R1756:Hmcn2 UTSW 2 31,286,132 (GRCm39) missense probably damaging 0.99
R1763:Hmcn2 UTSW 2 31,204,602 (GRCm39) missense probably damaging 1.00
R1815:Hmcn2 UTSW 2 31,283,055 (GRCm39) missense probably damaging 0.97
R1822:Hmcn2 UTSW 2 31,273,704 (GRCm39) missense probably damaging 0.99
R1858:Hmcn2 UTSW 2 31,305,295 (GRCm39) critical splice donor site probably null
R1895:Hmcn2 UTSW 2 31,295,647 (GRCm39) missense probably damaging 0.99
R1908:Hmcn2 UTSW 2 31,301,922 (GRCm39) critical splice donor site probably null
R1946:Hmcn2 UTSW 2 31,295,647 (GRCm39) missense probably damaging 0.99
R1966:Hmcn2 UTSW 2 31,279,341 (GRCm39) missense probably damaging 0.99
R2007:Hmcn2 UTSW 2 31,328,267 (GRCm39) missense possibly damaging 0.91
R2050:Hmcn2 UTSW 2 31,225,448 (GRCm39) missense probably damaging 1.00
R2055:Hmcn2 UTSW 2 31,268,294 (GRCm39) missense probably benign 0.33
R2097:Hmcn2 UTSW 2 31,270,431 (GRCm39) missense probably damaging 1.00
R2145:Hmcn2 UTSW 2 31,223,943 (GRCm39) splice site probably benign
R2155:Hmcn2 UTSW 2 31,350,361 (GRCm39) missense possibly damaging 0.68
R2170:Hmcn2 UTSW 2 31,270,293 (GRCm39) missense probably benign 0.08
R2188:Hmcn2 UTSW 2 31,309,947 (GRCm39) missense probably benign 0.14
R2208:Hmcn2 UTSW 2 31,270,309 (GRCm39) missense probably damaging 1.00
R2217:Hmcn2 UTSW 2 31,240,586 (GRCm39) missense probably benign 0.02
R2407:Hmcn2 UTSW 2 31,225,424 (GRCm39) critical splice acceptor site probably null
R2764:Hmcn2 UTSW 2 31,278,310 (GRCm39) missense probably damaging 0.98
R2913:Hmcn2 UTSW 2 31,350,222 (GRCm39) missense possibly damaging 0.68
R2986:Hmcn2 UTSW 2 31,251,010 (GRCm39) missense probably damaging 1.00
R3157:Hmcn2 UTSW 2 31,290,267 (GRCm39) missense probably damaging 0.99
R3406:Hmcn2 UTSW 2 31,323,284 (GRCm39) splice site probably benign
R3429:Hmcn2 UTSW 2 31,299,156 (GRCm39) missense possibly damaging 0.87
R3737:Hmcn2 UTSW 2 31,226,624 (GRCm39) nonsense probably null
R3739:Hmcn2 UTSW 2 31,226,624 (GRCm39) nonsense probably null
R3771:Hmcn2 UTSW 2 31,250,908 (GRCm39) missense probably damaging 0.99
R3772:Hmcn2 UTSW 2 31,250,908 (GRCm39) missense probably damaging 0.99
R3773:Hmcn2 UTSW 2 31,250,908 (GRCm39) missense probably damaging 0.99
R3804:Hmcn2 UTSW 2 31,242,897 (GRCm39) splice site probably null
R3837:Hmcn2 UTSW 2 31,303,419 (GRCm39) missense probably damaging 0.99
R3838:Hmcn2 UTSW 2 31,303,419 (GRCm39) missense probably damaging 0.99
R3846:Hmcn2 UTSW 2 31,320,362 (GRCm39) missense possibly damaging 0.51
R3925:Hmcn2 UTSW 2 31,343,169 (GRCm39) missense probably benign 0.00
R3934:Hmcn2 UTSW 2 31,270,496 (GRCm39) critical splice donor site probably null
R3946:Hmcn2 UTSW 2 31,272,406 (GRCm39) missense possibly damaging 0.91
R4035:Hmcn2 UTSW 2 31,226,624 (GRCm39) nonsense probably null
R4057:Hmcn2 UTSW 2 31,290,250 (GRCm39) missense probably damaging 1.00
R4583:Hmcn2 UTSW 2 31,303,277 (GRCm39) missense possibly damaging 0.84
R4623:Hmcn2 UTSW 2 31,286,722 (GRCm39) missense probably damaging 1.00
R4647:Hmcn2 UTSW 2 31,289,031 (GRCm39) missense possibly damaging 0.82
R4668:Hmcn2 UTSW 2 31,325,804 (GRCm39) missense probably benign 0.40
R4669:Hmcn2 UTSW 2 31,325,804 (GRCm39) missense probably benign 0.40
R4687:Hmcn2 UTSW 2 31,328,297 (GRCm39) missense probably benign 0.14
R4735:Hmcn2 UTSW 2 31,273,787 (GRCm39) missense probably benign 0.06
R4772:Hmcn2 UTSW 2 31,335,326 (GRCm39) missense probably benign 0.02
R4866:Hmcn2 UTSW 2 31,279,403 (GRCm39) missense possibly damaging 0.88
R4916:Hmcn2 UTSW 2 31,250,992 (GRCm39) missense probably damaging 0.98
R4943:Hmcn2 UTSW 2 31,225,504 (GRCm39) missense probably damaging 1.00
R4967:Hmcn2 UTSW 2 31,244,176 (GRCm39) critical splice acceptor site probably null
R4973:Hmcn2 UTSW 2 31,234,108 (GRCm39) missense probably benign 0.15
R4975:Hmcn2 UTSW 2 31,283,037 (GRCm39) missense possibly damaging 0.88
R4994:Hmcn2 UTSW 2 31,348,067 (GRCm39) critical splice donor site probably null
R4997:Hmcn2 UTSW 2 31,291,720 (GRCm39) missense probably damaging 1.00
R5045:Hmcn2 UTSW 2 31,299,093 (GRCm39) missense probably damaging 1.00
R5117:Hmcn2 UTSW 2 31,348,061 (GRCm39) missense possibly damaging 0.95
R5151:Hmcn2 UTSW 2 31,279,455 (GRCm39) missense probably null
R5232:Hmcn2 UTSW 2 31,347,760 (GRCm39) missense probably damaging 0.99
R5237:Hmcn2 UTSW 2 31,304,728 (GRCm39) missense probably benign 0.01
R5288:Hmcn2 UTSW 2 31,350,333 (GRCm39) missense probably benign 0.11
R5375:Hmcn2 UTSW 2 31,320,453 (GRCm39) missense possibly damaging 0.92
R5379:Hmcn2 UTSW 2 31,299,023 (GRCm39) missense probably damaging 0.99
R5385:Hmcn2 UTSW 2 31,350,333 (GRCm39) missense probably benign 0.11
R5412:Hmcn2 UTSW 2 31,236,629 (GRCm39) missense possibly damaging 0.77
R5426:Hmcn2 UTSW 2 31,226,556 (GRCm39) missense possibly damaging 0.95
R5434:Hmcn2 UTSW 2 31,310,375 (GRCm39) missense probably damaging 1.00
R5441:Hmcn2 UTSW 2 31,296,428 (GRCm39) missense possibly damaging 0.82
R5484:Hmcn2 UTSW 2 31,283,066 (GRCm39) nonsense probably null
R5492:Hmcn2 UTSW 2 31,310,318 (GRCm39) missense probably benign 0.03
R5572:Hmcn2 UTSW 2 31,304,538 (GRCm39) critical splice acceptor site probably null
R5572:Hmcn2 UTSW 2 31,304,537 (GRCm39) critical splice acceptor site probably null
R5591:Hmcn2 UTSW 2 31,234,059 (GRCm39) missense probably damaging 1.00
R5614:Hmcn2 UTSW 2 31,318,315 (GRCm39) missense probably damaging 0.99
R5634:Hmcn2 UTSW 2 31,223,893 (GRCm39) missense probably damaging 1.00
R5645:Hmcn2 UTSW 2 31,310,824 (GRCm39) missense possibly damaging 0.92
R5716:Hmcn2 UTSW 2 31,348,750 (GRCm39) missense possibly damaging 0.68
R5716:Hmcn2 UTSW 2 31,226,579 (GRCm39) missense probably damaging 1.00
R5725:Hmcn2 UTSW 2 31,273,827 (GRCm39) critical splice donor site probably null
R5760:Hmcn2 UTSW 2 31,304,580 (GRCm39) missense possibly damaging 0.91
R5774:Hmcn2 UTSW 2 31,299,147 (GRCm39) missense possibly damaging 0.94
R5838:Hmcn2 UTSW 2 31,347,819 (GRCm39) missense probably damaging 0.99
R5899:Hmcn2 UTSW 2 31,244,685 (GRCm39) missense possibly damaging 0.93
R5916:Hmcn2 UTSW 2 31,286,151 (GRCm39) missense probably damaging 1.00
R5973:Hmcn2 UTSW 2 31,310,335 (GRCm39) missense probably damaging 0.99
R6002:Hmcn2 UTSW 2 31,310,321 (GRCm39) missense probably damaging 0.99
R6018:Hmcn2 UTSW 2 31,260,804 (GRCm39) missense probably benign 0.13
R6063:Hmcn2 UTSW 2 31,324,725 (GRCm39) missense probably benign 0.06
R6161:Hmcn2 UTSW 2 31,246,266 (GRCm39) missense probably benign
R6166:Hmcn2 UTSW 2 31,259,274 (GRCm39) missense probably damaging 1.00
R6177:Hmcn2 UTSW 2 31,310,118 (GRCm39) nonsense probably null
R6191:Hmcn2 UTSW 2 31,348,758 (GRCm39) missense probably damaging 0.99
R6195:Hmcn2 UTSW 2 31,274,127 (GRCm39) missense probably damaging 0.96
R6273:Hmcn2 UTSW 2 31,301,846 (GRCm39) missense probably damaging 0.99
R6293:Hmcn2 UTSW 2 31,225,463 (GRCm39) missense probably damaging 1.00
R6349:Hmcn2 UTSW 2 31,278,385 (GRCm39) missense probably damaging 1.00
R6395:Hmcn2 UTSW 2 31,259,269 (GRCm39) missense probably damaging 1.00
R6448:Hmcn2 UTSW 2 31,310,832 (GRCm39) missense probably benign 0.02
R6450:Hmcn2 UTSW 2 31,251,812 (GRCm39) missense probably benign 0.11
R6479:Hmcn2 UTSW 2 31,315,480 (GRCm39) missense probably damaging 0.99
R6502:Hmcn2 UTSW 2 31,272,490 (GRCm39) missense probably damaging 0.99
R6511:Hmcn2 UTSW 2 31,246,354 (GRCm39) missense possibly damaging 0.79
R6537:Hmcn2 UTSW 2 31,305,280 (GRCm39) missense probably benign 0.00
R6880:Hmcn2 UTSW 2 31,233,068 (GRCm39) missense probably damaging 1.00
R6924:Hmcn2 UTSW 2 31,240,517 (GRCm39) splice site probably null
R6971:Hmcn2 UTSW 2 31,322,333 (GRCm39) missense probably benign 0.02
R7057:Hmcn2 UTSW 2 31,312,661 (GRCm39) missense probably damaging 0.99
R7141:Hmcn2 UTSW 2 31,250,908 (GRCm39) missense probably benign 0.17
R7268:Hmcn2 UTSW 2 31,347,978 (GRCm39) missense possibly damaging 0.48
R7307:Hmcn2 UTSW 2 31,233,093 (GRCm39) missense probably damaging 0.96
R7322:Hmcn2 UTSW 2 31,349,093 (GRCm39) missense probably damaging 0.99
R7334:Hmcn2 UTSW 2 31,343,147 (GRCm39) missense possibly damaging 0.82
R7334:Hmcn2 UTSW 2 31,325,806 (GRCm39) missense probably damaging 0.98
R7335:Hmcn2 UTSW 2 31,282,169 (GRCm39) missense possibly damaging 0.88
R7358:Hmcn2 UTSW 2 31,306,824 (GRCm39) missense probably damaging 1.00
R7359:Hmcn2 UTSW 2 31,278,395 (GRCm39) missense probably benign 0.13
R7488:Hmcn2 UTSW 2 31,310,842 (GRCm39) missense probably damaging 1.00
R7560:Hmcn2 UTSW 2 31,347,185 (GRCm39) missense probably benign
R7566:Hmcn2 UTSW 2 31,344,869 (GRCm39) missense probably damaging 0.96
R7570:Hmcn2 UTSW 2 31,313,923 (GRCm39) missense probably benign
R7574:Hmcn2 UTSW 2 31,345,531 (GRCm39) missense possibly damaging 0.68
R7599:Hmcn2 UTSW 2 31,246,298 (GRCm39) missense possibly damaging 0.93
R7654:Hmcn2 UTSW 2 31,236,581 (GRCm39) missense probably benign 0.00
R7662:Hmcn2 UTSW 2 31,272,357 (GRCm39) missense probably benign 0.01
R7666:Hmcn2 UTSW 2 31,270,245 (GRCm39) missense probably damaging 1.00
R7698:Hmcn2 UTSW 2 31,313,165 (GRCm39) missense probably damaging 0.98
R7722:Hmcn2 UTSW 2 31,272,512 (GRCm39) nonsense probably null
R7739:Hmcn2 UTSW 2 31,348,038 (GRCm39) missense possibly damaging 0.48
R7749:Hmcn2 UTSW 2 31,343,045 (GRCm39) splice site probably null
R7828:Hmcn2 UTSW 2 31,295,887 (GRCm39) missense possibly damaging 0.95
R7912:Hmcn2 UTSW 2 31,310,311 (GRCm39) missense probably benign 0.00
R7978:Hmcn2 UTSW 2 31,279,359 (GRCm39) missense probably benign 0.40
R8075:Hmcn2 UTSW 2 31,279,403 (GRCm39) missense possibly damaging 0.88
R8088:Hmcn2 UTSW 2 31,316,915 (GRCm39) nonsense probably null
R8101:Hmcn2 UTSW 2 31,240,082 (GRCm39) missense probably benign 0.08
R8124:Hmcn2 UTSW 2 31,290,136 (GRCm39) missense probably benign 0.01
R8145:Hmcn2 UTSW 2 31,313,117 (GRCm39) missense probably damaging 1.00
R8230:Hmcn2 UTSW 2 31,234,485 (GRCm39) missense possibly damaging 0.91
R8267:Hmcn2 UTSW 2 31,349,191 (GRCm39) missense probably benign
R8277:Hmcn2 UTSW 2 31,259,189 (GRCm39) missense probably benign 0.16
R8307:Hmcn2 UTSW 2 31,286,127 (GRCm39) missense probably damaging 0.99
R8353:Hmcn2 UTSW 2 31,275,353 (GRCm39) splice site probably null
R8415:Hmcn2 UTSW 2 31,281,088 (GRCm39) missense probably benign 0.15
R8416:Hmcn2 UTSW 2 31,281,088 (GRCm39) missense probably benign 0.15
R8437:Hmcn2 UTSW 2 31,281,088 (GRCm39) missense probably benign 0.15
R8438:Hmcn2 UTSW 2 31,281,088 (GRCm39) missense probably benign 0.15
R8440:Hmcn2 UTSW 2 31,281,088 (GRCm39) missense probably benign 0.15
R8442:Hmcn2 UTSW 2 31,281,088 (GRCm39) missense probably benign 0.15
R8497:Hmcn2 UTSW 2 31,313,357 (GRCm39) missense possibly damaging 0.92
R8520:Hmcn2 UTSW 2 31,244,726 (GRCm39) missense probably damaging 1.00
R8530:Hmcn2 UTSW 2 31,281,088 (GRCm39) missense probably benign 0.15
R8537:Hmcn2 UTSW 2 31,281,088 (GRCm39) missense probably benign 0.15
R8550:Hmcn2 UTSW 2 31,240,654 (GRCm39) critical splice donor site probably null
R8721:Hmcn2 UTSW 2 31,315,189 (GRCm39) missense probably damaging 1.00
R8795:Hmcn2 UTSW 2 31,315,393 (GRCm39) missense probably benign 0.01
R8802:Hmcn2 UTSW 2 31,301,288 (GRCm39) missense probably damaging 0.97
R8804:Hmcn2 UTSW 2 31,315,393 (GRCm39) missense probably benign 0.01
R8805:Hmcn2 UTSW 2 31,315,393 (GRCm39) missense probably benign 0.01
R8904:Hmcn2 UTSW 2 31,323,404 (GRCm39) missense possibly damaging 0.92
R8937:Hmcn2 UTSW 2 31,204,427 (GRCm39) start codon destroyed probably benign 0.01
R8947:Hmcn2 UTSW 2 31,278,220 (GRCm39) missense probably damaging 0.99
R8948:Hmcn2 UTSW 2 31,244,741 (GRCm39) missense probably damaging 1.00
R8950:Hmcn2 UTSW 2 31,244,741 (GRCm39) missense probably damaging 1.00
R8959:Hmcn2 UTSW 2 31,282,159 (GRCm39) missense probably damaging 1.00
R9025:Hmcn2 UTSW 2 31,347,967 (GRCm39) missense possibly damaging 0.56
R9039:Hmcn2 UTSW 2 31,244,646 (GRCm39) missense probably damaging 0.97
R9068:Hmcn2 UTSW 2 31,303,685 (GRCm39) missense probably benign 0.01
R9161:Hmcn2 UTSW 2 31,242,758 (GRCm39) missense probably benign 0.02
R9178:Hmcn2 UTSW 2 31,281,521 (GRCm39) missense possibly damaging 0.77
R9204:Hmcn2 UTSW 2 31,278,377 (GRCm39) missense probably damaging 0.98
R9317:Hmcn2 UTSW 2 31,350,328 (GRCm39) missense possibly damaging 0.91
R9341:Hmcn2 UTSW 2 31,279,359 (GRCm39) missense probably benign 0.40
R9343:Hmcn2 UTSW 2 31,279,359 (GRCm39) missense probably benign 0.40
R9355:Hmcn2 UTSW 2 31,328,302 (GRCm39) missense probably benign 0.18
R9371:Hmcn2 UTSW 2 31,301,917 (GRCm39) missense probably damaging 1.00
R9450:Hmcn2 UTSW 2 31,316,845 (GRCm39) missense probably damaging 1.00
R9477:Hmcn2 UTSW 2 31,286,031 (GRCm39) critical splice acceptor site probably null
R9483:Hmcn2 UTSW 2 31,320,375 (GRCm39) missense
R9536:Hmcn2 UTSW 2 31,335,130 (GRCm39) missense possibly damaging 0.86
R9580:Hmcn2 UTSW 2 31,294,875 (GRCm39) missense probably benign 0.16
R9593:Hmcn2 UTSW 2 31,244,742 (GRCm39) missense probably damaging 0.99
R9649:Hmcn2 UTSW 2 31,292,450 (GRCm39) missense possibly damaging 0.95
R9706:Hmcn2 UTSW 2 31,305,279 (GRCm39) missense probably benign 0.00
X0066:Hmcn2 UTSW 2 31,344,823 (GRCm39) missense possibly damaging 0.83
X0067:Hmcn2 UTSW 2 31,295,879 (GRCm39) missense possibly damaging 0.82
Z1088:Hmcn2 UTSW 2 31,349,076 (GRCm39) splice site probably null
Z1088:Hmcn2 UTSW 2 31,271,079 (GRCm39) missense probably benign 0.01
Z1176:Hmcn2 UTSW 2 31,319,103 (GRCm39) missense probably damaging 0.97
Z1176:Hmcn2 UTSW 2 31,315,428 (GRCm39) missense probably damaging 1.00
Z1176:Hmcn2 UTSW 2 31,234,041 (GRCm39) missense possibly damaging 0.95
Z1177:Hmcn2 UTSW 2 31,316,836 (GRCm39) missense probably damaging 0.99
Z1177:Hmcn2 UTSW 2 31,234,518 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGTTGGCTAGAGACACTG -3'
(R):5'- ACACGTTGGTTATGTGCCC -3'

Sequencing Primer
(F):5'- GCTAGAGACACTGGGGTGG -3'
(R):5'- CCTCTTCCCGGATGCTGG -3'
Posted On 2019-10-18