Incidental Mutation 'R7503:Cfap54'
ID 585915
Institutional Source Beutler Lab
Gene Symbol Cfap54
Ensembl Gene ENSMUSG00000020014
Gene Name cilia and flagella associated protein 54
Synonyms LOC380653, Gm872, 4930485B16Rik
MMRRC Submission 045576-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.086) question?
Stock # R7503 (G1)
Quality Score 154.008
Status Validated
Chromosome 10
Chromosomal Location 92611481-92917480 bp(-) (GRCm39)
Type of Mutation splice site (179 bp from exon)
DNA Base Change (assembly) T to A at 92723298 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168110] [ENSMUST00000212902]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000168110
SMART Domains Protein: ENSMUSP00000129517
Gene: ENSMUSG00000020014

DomainStartEndE-ValueType
low complexity region 3 37 N/A INTRINSIC
low complexity region 39 48 N/A INTRINSIC
Pfam:DUF4486 104 642 1.1e-269 PFAM
low complexity region 842 851 N/A INTRINSIC
low complexity region 902 915 N/A INTRINSIC
Blast:FN3 916 1002 4e-48 BLAST
low complexity region 1409 1426 N/A INTRINSIC
low complexity region 1974 1984 N/A INTRINSIC
low complexity region 2354 2370 N/A INTRINSIC
low complexity region 2500 2513 N/A INTRINSIC
low complexity region 2605 2616 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000212902
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (63/63)
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene causes background-dependent lethality and hydroencephaly, male sterility associated with defects in spermiogenesis, and impaired mucociliary clearance. Airway epithelial cilia show structural defects and a decrease in ciliary beat frequency and cilia-driven flow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230072I06Rik G A 8: 12,329,554 (GRCm39) G3D unknown Het
Aif1 A T 17: 35,390,549 (GRCm39) I67N probably damaging Het
Akap11 T C 14: 78,749,441 (GRCm39) D982G Het
Anpep A G 7: 79,476,385 (GRCm39) L827P probably damaging Het
Arhgef5 A T 6: 43,250,933 (GRCm39) K561N probably benign Het
Arsj T C 3: 126,158,493 (GRCm39) F24S probably benign Het
Bard1 T C 1: 71,069,995 (GRCm39) D661G probably damaging Het
Cc2d2b A G 19: 40,783,056 (GRCm39) I618V unknown Het
Cfap251 G T 5: 123,435,521 (GRCm39) E994* probably null Het
Cfhr2 T A 1: 139,758,952 (GRCm39) I33F probably damaging Het
Dsc1 G A 18: 20,218,922 (GRCm39) H827Y probably damaging Het
Eif3i C T 4: 129,494,207 (GRCm39) D31N probably damaging Het
Eno1b A T 18: 48,179,878 (GRCm39) T19S probably damaging Het
Eva1a G A 6: 82,048,210 (GRCm39) W29* probably null Het
Evc T C 5: 37,458,111 (GRCm39) K803R unknown Het
F5 T A 1: 164,019,779 (GRCm39) N751K probably damaging Het
Fam120a A T 13: 49,102,723 (GRCm39) N177K probably benign Het
Farp2 T G 1: 93,495,219 (GRCm39) I164R probably benign Het
Gm20379 C T 13: 92,442,565 (GRCm39) P26L Het
Hmgcs2 T C 3: 98,209,940 (GRCm39) S433P probably damaging Het
Inava T C 1: 136,143,675 (GRCm39) D587G possibly damaging Het
Ints2 T C 11: 86,122,881 (GRCm39) T633A probably benign Het
Invs C T 4: 48,396,347 (GRCm39) T340M probably damaging Het
Mef2c A C 13: 83,810,623 (GRCm39) D391A possibly damaging Het
Msh4 A C 3: 153,573,387 (GRCm39) S756A probably damaging Het
Mylk3 T C 8: 86,080,218 (GRCm39) T490A probably benign Het
Myo1b A T 1: 51,815,761 (GRCm39) probably null Het
Nsmce1 A G 7: 125,071,106 (GRCm39) S107P probably benign Het
Or52a24 T A 7: 103,381,474 (GRCm39) S114T probably damaging Het
Or5d43 T C 2: 88,105,039 (GRCm39) Y118C probably damaging Het
Pcdhb21 G A 18: 37,648,028 (GRCm39) D386N probably benign Het
Pcdhb22 T G 18: 37,652,155 (GRCm39) L208V probably benign Het
Pigu C T 2: 155,173,064 (GRCm39) probably null Het
Plcz1 T A 6: 139,936,474 (GRCm39) E585V probably damaging Het
Pnpla7 C A 2: 24,873,544 (GRCm39) C183* probably null Het
Pomgnt1 T C 4: 116,009,949 (GRCm39) V133A possibly damaging Het
Prl3d3 A G 13: 27,345,096 (GRCm39) Y156C probably benign Het
Prpf39 A G 12: 65,100,167 (GRCm39) D280G probably benign Het
Recql5 C A 11: 115,785,881 (GRCm39) A631S probably benign Het
Runx3 C A 4: 134,882,679 (GRCm39) N138K probably damaging Het
Scaper T C 9: 55,715,038 (GRCm39) D750G probably damaging Het
Slc16a3 T C 11: 120,847,853 (GRCm39) L347P probably damaging Het
Slc25a1 G T 16: 17,744,303 (GRCm39) Y209* probably null Het
Smad2 A G 18: 76,419,956 (GRCm39) S88G probably benign Het
Sorcs1 A G 19: 50,141,490 (GRCm39) C1125R probably benign Het
Spata21 T A 4: 140,822,614 (GRCm39) I140N probably benign Het
Speer3 A T 5: 13,843,348 (GRCm39) D85V probably benign Het
Spopfm1 A T 3: 94,173,780 (GRCm39) M259L probably benign Het
Stra6 A G 9: 58,058,528 (GRCm39) N463S possibly damaging Het
Tmem14a T G 1: 21,299,623 (GRCm39) probably null Het
Tsc1 T A 2: 28,577,088 (GRCm39) L1130Q possibly damaging Het
Ttn T C 2: 76,611,401 (GRCm39) D17377G possibly damaging Het
Utf1 A G 7: 139,524,046 (GRCm39) D87G probably damaging Het
Vmn2r6 G A 3: 64,447,372 (GRCm39) Q565* probably null Het
Vmn2r63 A T 7: 42,583,014 (GRCm39) M67K probably benign Het
Vmn2r90 T C 17: 17,933,510 (GRCm39) Y357H not run Het
Vmn2r97 A G 17: 19,148,470 (GRCm39) T122A probably benign Het
Wdhd1 T C 14: 47,488,248 (GRCm39) E753G probably benign Het
Wdr11 A G 7: 129,204,834 (GRCm39) N213S probably benign Het
Xdh A C 17: 74,233,205 (GRCm39) D207E probably damaging Het
Zfp281 T A 1: 136,554,678 (GRCm39) I552N possibly damaging Het
Zzef1 T A 11: 72,716,893 (GRCm39) I361K probably damaging Het
Other mutations in Cfap54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Cfap54 APN 10 92,917,385 (GRCm39) missense unknown
IGL02034:Cfap54 APN 10 92,897,347 (GRCm39) missense probably damaging 0.99
IGL02082:Cfap54 APN 10 92,917,320 (GRCm39) missense unknown
IGL02434:Cfap54 APN 10 92,902,616 (GRCm39) missense probably benign 0.20
R0011:Cfap54 UTSW 10 92,901,087 (GRCm39) missense probably damaging 0.97
R0011:Cfap54 UTSW 10 92,901,087 (GRCm39) missense probably damaging 0.97
R0032:Cfap54 UTSW 10 92,768,559 (GRCm39) missense probably benign 0.04
R0032:Cfap54 UTSW 10 92,768,559 (GRCm39) missense probably benign 0.04
R0040:Cfap54 UTSW 10 92,812,901 (GRCm39) missense probably benign 0.33
R0044:Cfap54 UTSW 10 92,871,295 (GRCm39) missense probably null 0.46
R0086:Cfap54 UTSW 10 92,864,456 (GRCm39) missense possibly damaging 0.86
R0104:Cfap54 UTSW 10 92,864,514 (GRCm39) missense probably damaging 1.00
R0194:Cfap54 UTSW 10 92,870,524 (GRCm39) unclassified probably benign
R0234:Cfap54 UTSW 10 92,735,022 (GRCm39) nonsense probably null
R0308:Cfap54 UTSW 10 92,721,226 (GRCm39) missense unknown
R0332:Cfap54 UTSW 10 92,871,319 (GRCm39) missense probably damaging 1.00
R0409:Cfap54 UTSW 10 92,612,075 (GRCm39) missense probably benign 0.00
R0433:Cfap54 UTSW 10 92,814,942 (GRCm39) splice site probably benign
R0436:Cfap54 UTSW 10 92,874,837 (GRCm39) missense possibly damaging 0.95
R0463:Cfap54 UTSW 10 92,710,805 (GRCm39) critical splice donor site probably null
R0523:Cfap54 UTSW 10 92,744,745 (GRCm39) utr 3 prime probably benign
R0551:Cfap54 UTSW 10 92,860,984 (GRCm39) missense probably benign 0.35
R0595:Cfap54 UTSW 10 92,720,598 (GRCm39) missense unknown
R0617:Cfap54 UTSW 10 92,665,512 (GRCm39) splice site probably benign
R0632:Cfap54 UTSW 10 92,720,958 (GRCm39) missense unknown
R0730:Cfap54 UTSW 10 92,870,599 (GRCm39) missense probably benign 0.05
R0786:Cfap54 UTSW 10 92,803,397 (GRCm39) missense possibly damaging 0.72
R0883:Cfap54 UTSW 10 92,706,531 (GRCm39) missense unknown
R1004:Cfap54 UTSW 10 92,902,558 (GRCm39) splice site probably benign
R1033:Cfap54 UTSW 10 92,675,311 (GRCm39) missense probably benign 0.07
R1168:Cfap54 UTSW 10 92,773,782 (GRCm39) missense probably damaging 0.99
R1186:Cfap54 UTSW 10 92,711,856 (GRCm39) missense unknown
R1429:Cfap54 UTSW 10 92,656,900 (GRCm39) missense probably benign 0.01
R1443:Cfap54 UTSW 10 92,768,583 (GRCm39) missense probably damaging 1.00
R1467:Cfap54 UTSW 10 92,805,625 (GRCm39) missense probably benign 0.01
R1467:Cfap54 UTSW 10 92,805,625 (GRCm39) missense probably benign 0.01
R1557:Cfap54 UTSW 10 92,820,089 (GRCm39) missense possibly damaging 0.68
R1687:Cfap54 UTSW 10 92,768,502 (GRCm39) missense probably damaging 1.00
R1690:Cfap54 UTSW 10 92,871,304 (GRCm39) missense possibly damaging 0.95
R1711:Cfap54 UTSW 10 92,846,882 (GRCm39) missense probably damaging 1.00
R1756:Cfap54 UTSW 10 92,883,923 (GRCm39) missense probably damaging 1.00
R1769:Cfap54 UTSW 10 92,740,125 (GRCm39) critical splice donor site probably null
R1835:Cfap54 UTSW 10 92,798,237 (GRCm39) missense probably benign 0.35
R1889:Cfap54 UTSW 10 92,870,572 (GRCm39) missense possibly damaging 0.94
R1915:Cfap54 UTSW 10 92,720,564 (GRCm39) missense unknown
R1958:Cfap54 UTSW 10 92,833,204 (GRCm39) missense probably benign 0.18
R2005:Cfap54 UTSW 10 92,720,630 (GRCm39) missense unknown
R2018:Cfap54 UTSW 10 92,852,466 (GRCm39) missense probably benign 0.00
R2045:Cfap54 UTSW 10 92,874,671 (GRCm39) splice site probably null
R2059:Cfap54 UTSW 10 92,778,841 (GRCm39) unclassified probably benign
R2100:Cfap54 UTSW 10 92,837,799 (GRCm39) missense possibly damaging 0.84
R2110:Cfap54 UTSW 10 92,722,229 (GRCm39) missense unknown
R2392:Cfap54 UTSW 10 92,860,873 (GRCm39) critical splice donor site probably null
R2508:Cfap54 UTSW 10 92,833,236 (GRCm39) missense possibly damaging 0.72
R2852:Cfap54 UTSW 10 92,776,017 (GRCm39) missense probably damaging 1.00
R2857:Cfap54 UTSW 10 92,881,144 (GRCm39) missense probably damaging 0.99
R2871:Cfap54 UTSW 10 92,757,281 (GRCm39) missense possibly damaging 0.86
R2871:Cfap54 UTSW 10 92,757,281 (GRCm39) missense possibly damaging 0.86
R3107:Cfap54 UTSW 10 92,830,545 (GRCm39) missense probably benign 0.04
R3108:Cfap54 UTSW 10 92,830,545 (GRCm39) missense probably benign 0.04
R3157:Cfap54 UTSW 10 92,834,918 (GRCm39) missense probably benign 0.03
R3158:Cfap54 UTSW 10 92,834,918 (GRCm39) missense probably benign 0.03
R3159:Cfap54 UTSW 10 92,834,918 (GRCm39) missense probably benign 0.03
R3161:Cfap54 UTSW 10 92,881,140 (GRCm39) missense probably damaging 1.00
R3162:Cfap54 UTSW 10 92,881,140 (GRCm39) missense probably damaging 1.00
R3162:Cfap54 UTSW 10 92,881,140 (GRCm39) missense probably damaging 1.00
R3508:Cfap54 UTSW 10 92,721,286 (GRCm39) missense unknown
R3730:Cfap54 UTSW 10 92,847,335 (GRCm39) nonsense probably null
R3770:Cfap54 UTSW 10 92,714,398 (GRCm39) missense unknown
R3776:Cfap54 UTSW 10 92,880,962 (GRCm39) missense probably damaging 1.00
R3778:Cfap54 UTSW 10 92,740,206 (GRCm39) utr 3 prime probably benign
R3795:Cfap54 UTSW 10 92,778,735 (GRCm39) unclassified probably benign
R3834:Cfap54 UTSW 10 92,636,985 (GRCm39) splice site probably benign
R3891:Cfap54 UTSW 10 92,874,708 (GRCm39) missense possibly damaging 0.87
R3932:Cfap54 UTSW 10 92,665,619 (GRCm39) missense probably benign 0.03
R3973:Cfap54 UTSW 10 92,675,333 (GRCm39) missense possibly damaging 0.95
R3974:Cfap54 UTSW 10 92,675,333 (GRCm39) missense possibly damaging 0.95
R3976:Cfap54 UTSW 10 92,675,333 (GRCm39) missense possibly damaging 0.95
R3978:Cfap54 UTSW 10 92,798,274 (GRCm39) missense probably benign 0.01
R4190:Cfap54 UTSW 10 92,720,885 (GRCm39) missense unknown
R4389:Cfap54 UTSW 10 92,803,362 (GRCm39) missense probably benign 0.37
R4542:Cfap54 UTSW 10 92,860,991 (GRCm39) missense probably benign 0.12
R4564:Cfap54 UTSW 10 92,675,402 (GRCm39) unclassified probably benign
R4576:Cfap54 UTSW 10 92,879,090 (GRCm39) critical splice donor site probably null
R4620:Cfap54 UTSW 10 92,805,619 (GRCm39) missense probably benign 0.01
R4714:Cfap54 UTSW 10 92,651,780 (GRCm39) missense probably benign 0.01
R4762:Cfap54 UTSW 10 92,897,315 (GRCm39) splice site probably null
R4776:Cfap54 UTSW 10 92,808,556 (GRCm39) missense possibly damaging 0.96
R4819:Cfap54 UTSW 10 92,672,339 (GRCm39) nonsense probably null
R4827:Cfap54 UTSW 10 92,737,937 (GRCm39) utr 3 prime probably benign
R4832:Cfap54 UTSW 10 92,803,390 (GRCm39) missense probably benign 0.01
R4965:Cfap54 UTSW 10 92,902,661 (GRCm39) missense probably benign 0.23
R5001:Cfap54 UTSW 10 92,800,396 (GRCm39) missense probably benign 0.01
R5060:Cfap54 UTSW 10 92,875,013 (GRCm39) missense probably damaging 1.00
R5067:Cfap54 UTSW 10 92,902,628 (GRCm39) missense probably benign 0.17
R5069:Cfap54 UTSW 10 92,773,636 (GRCm39) missense probably benign
R5094:Cfap54 UTSW 10 92,734,861 (GRCm39) utr 3 prime probably benign
R5109:Cfap54 UTSW 10 92,773,753 (GRCm39) missense probably benign 0.03
R5127:Cfap54 UTSW 10 92,722,249 (GRCm39) splice site probably null
R5143:Cfap54 UTSW 10 92,865,020 (GRCm39) missense possibly damaging 0.73
R5147:Cfap54 UTSW 10 92,773,700 (GRCm39) missense probably benign 0.00
R5158:Cfap54 UTSW 10 92,901,059 (GRCm39) missense probably damaging 1.00
R5256:Cfap54 UTSW 10 92,880,885 (GRCm39) splice site probably null
R5256:Cfap54 UTSW 10 92,770,953 (GRCm39) nonsense probably null
R5266:Cfap54 UTSW 10 92,651,764 (GRCm39) missense probably benign 0.16
R5304:Cfap54 UTSW 10 92,656,968 (GRCm39) missense probably damaging 0.97
R5369:Cfap54 UTSW 10 92,897,119 (GRCm39) intron probably benign
R5406:Cfap54 UTSW 10 92,837,720 (GRCm39) missense probably benign 0.33
R5471:Cfap54 UTSW 10 92,864,522 (GRCm39) missense probably damaging 1.00
R5485:Cfap54 UTSW 10 92,864,979 (GRCm39) missense probably damaging 1.00
R5540:Cfap54 UTSW 10 92,808,470 (GRCm39) missense possibly damaging 0.85
R5586:Cfap54 UTSW 10 92,808,473 (GRCm39) nonsense probably null
R5614:Cfap54 UTSW 10 92,880,911 (GRCm39) missense probably damaging 1.00
R5634:Cfap54 UTSW 10 92,740,125 (GRCm39) critical splice donor site probably benign
R5680:Cfap54 UTSW 10 92,814,879 (GRCm39) nonsense probably null
R5797:Cfap54 UTSW 10 92,803,438 (GRCm39) missense probably benign 0.11
R5859:Cfap54 UTSW 10 92,852,386 (GRCm39) nonsense probably null
R5878:Cfap54 UTSW 10 92,800,423 (GRCm39) missense probably benign 0.01
R5910:Cfap54 UTSW 10 92,901,043 (GRCm39) missense probably damaging 0.99
R5936:Cfap54 UTSW 10 92,798,274 (GRCm39) missense probably benign 0.01
R5994:Cfap54 UTSW 10 92,874,943 (GRCm39) missense probably damaging 0.99
R6080:Cfap54 UTSW 10 92,881,197 (GRCm39) missense possibly damaging 0.64
R6268:Cfap54 UTSW 10 92,874,771 (GRCm39) missense probably damaging 1.00
R6296:Cfap54 UTSW 10 92,902,708 (GRCm39) missense probably damaging 1.00
R6409:Cfap54 UTSW 10 92,803,354 (GRCm39) missense probably benign 0.04
R6545:Cfap54 UTSW 10 92,672,319 (GRCm39) missense probably benign 0.31
R6570:Cfap54 UTSW 10 92,651,820 (GRCm39) missense unknown
R6597:Cfap54 UTSW 10 92,834,902 (GRCm39) missense possibly damaging 0.85
R6702:Cfap54 UTSW 10 92,704,596 (GRCm39) missense unknown
R6703:Cfap54 UTSW 10 92,704,596 (GRCm39) missense unknown
R6720:Cfap54 UTSW 10 92,656,981 (GRCm39) missense probably benign 0.07
R6841:Cfap54 UTSW 10 92,710,877 (GRCm39) missense unknown
R6910:Cfap54 UTSW 10 92,672,374 (GRCm39) missense probably benign 0.29
R6953:Cfap54 UTSW 10 92,830,540 (GRCm39) missense probably benign 0.19
R7009:Cfap54 UTSW 10 92,710,881 (GRCm39) missense unknown
R7129:Cfap54 UTSW 10 92,852,433 (GRCm39) missense probably benign 0.06
R7131:Cfap54 UTSW 10 92,656,966 (GRCm39) missense probably benign 0.03
R7171:Cfap54 UTSW 10 92,612,072 (GRCm39) missense probably damaging 0.99
R7189:Cfap54 UTSW 10 92,773,590 (GRCm39) missense unknown
R7225:Cfap54 UTSW 10 92,740,236 (GRCm39) missense unknown
R7270:Cfap54 UTSW 10 92,675,320 (GRCm39) missense probably benign 0.03
R7323:Cfap54 UTSW 10 92,637,000 (GRCm39) missense probably benign 0.00
R7380:Cfap54 UTSW 10 92,883,840 (GRCm39) missense probably damaging 1.00
R7395:Cfap54 UTSW 10 92,720,565 (GRCm39) missense unknown
R7411:Cfap54 UTSW 10 92,704,617 (GRCm39) missense unknown
R7622:Cfap54 UTSW 10 92,792,806 (GRCm39) missense unknown
R7679:Cfap54 UTSW 10 92,803,374 (GRCm39) missense probably benign 0.01
R7776:Cfap54 UTSW 10 92,704,603 (GRCm39) missense unknown
R7844:Cfap54 UTSW 10 92,737,920 (GRCm39) missense unknown
R7980:Cfap54 UTSW 10 92,817,922 (GRCm39) missense possibly damaging 0.95
R7988:Cfap54 UTSW 10 92,737,941 (GRCm39) missense unknown
R8101:Cfap54 UTSW 10 92,720,658 (GRCm39) missense unknown
R8119:Cfap54 UTSW 10 92,704,672 (GRCm39) missense unknown
R8134:Cfap54 UTSW 10 92,714,378 (GRCm39) missense unknown
R8168:Cfap54 UTSW 10 92,744,739 (GRCm39) missense unknown
R8179:Cfap54 UTSW 10 92,833,178 (GRCm39) missense possibly damaging 0.68
R8392:Cfap54 UTSW 10 92,798,279 (GRCm39) missense unknown
R8436:Cfap54 UTSW 10 92,800,398 (GRCm39) missense unknown
R8505:Cfap54 UTSW 10 92,814,855 (GRCm39) missense probably benign 0.03
R8671:Cfap54 UTSW 10 92,790,934 (GRCm39) missense unknown
R8716:Cfap54 UTSW 10 92,800,494 (GRCm39) missense probably benign 0.00
R8816:Cfap54 UTSW 10 92,714,454 (GRCm39) missense unknown
R8822:Cfap54 UTSW 10 92,875,003 (GRCm39) missense probably benign 0.09
R8827:Cfap54 UTSW 10 92,774,110 (GRCm39) missense unknown
R8920:Cfap54 UTSW 10 92,776,199 (GRCm39) critical splice acceptor site probably null
R8924:Cfap54 UTSW 10 92,837,685 (GRCm39) missense probably damaging 0.99
R8954:Cfap54 UTSW 10 92,879,255 (GRCm39) missense probably damaging 1.00
R8963:Cfap54 UTSW 10 92,864,562 (GRCm39) nonsense probably null
R9010:Cfap54 UTSW 10 92,734,921 (GRCm39) missense unknown
R9017:Cfap54 UTSW 10 92,651,883 (GRCm39) missense probably benign 0.07
R9093:Cfap54 UTSW 10 92,651,770 (GRCm39) missense probably benign 0.03
R9095:Cfap54 UTSW 10 92,846,882 (GRCm39) missense probably damaging 1.00
R9142:Cfap54 UTSW 10 92,820,097 (GRCm39) missense possibly damaging 0.87
R9178:Cfap54 UTSW 10 92,830,579 (GRCm39) missense probably benign 0.10
R9196:Cfap54 UTSW 10 92,873,753 (GRCm39) missense probably benign 0.22
R9203:Cfap54 UTSW 10 92,880,990 (GRCm39) missense probably benign 0.30
R9258:Cfap54 UTSW 10 92,770,960 (GRCm39) missense unknown
R9275:Cfap54 UTSW 10 92,875,048 (GRCm39) missense possibly damaging 0.86
R9287:Cfap54 UTSW 10 92,805,565 (GRCm39) missense possibly damaging 0.50
R9289:Cfap54 UTSW 10 92,656,936 (GRCm39) missense possibly damaging 0.83
R9310:Cfap54 UTSW 10 92,798,177 (GRCm39) missense unknown
R9397:Cfap54 UTSW 10 92,833,147 (GRCm39) missense probably damaging 0.96
R9462:Cfap54 UTSW 10 92,737,920 (GRCm39) missense unknown
R9697:Cfap54 UTSW 10 92,792,851 (GRCm39) missense unknown
R9746:Cfap54 UTSW 10 92,637,081 (GRCm39) missense probably benign 0.03
R9755:Cfap54 UTSW 10 92,757,230 (GRCm39) missense unknown
X0022:Cfap54 UTSW 10 92,768,476 (GRCm39) missense probably damaging 1.00
X0022:Cfap54 UTSW 10 92,714,465 (GRCm39) missense unknown
X0027:Cfap54 UTSW 10 92,837,750 (GRCm39) missense possibly damaging 0.86
X0027:Cfap54 UTSW 10 92,714,400 (GRCm39) missense unknown
Z1177:Cfap54 UTSW 10 92,814,888 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAAAGACTTGGTGTCCTGC -3'
(R):5'- TCTGTACGTACGAGTTTAACATCC -3'

Sequencing Primer
(F):5'- CTGTCCAGGTAATAAACTCAAGAGTG -3'
(R):5'- CGTACGAGTTTAACATCCTGACAAG -3'
Posted On 2019-10-18